Development of a Highly Potent Analogue and a Long-Acting

Subscriber access provided by Universiteit Leiden / LUMC

Article

Development of a Highly Potent Analogue and a Long-Acting Analogue of Oxytocin for the Treatment of Social Impairment-Like Behaviors Wataru Ichinose, Stanislav M. Cherepanov, Anna A. Shabalova, Shigeru Yokoyama, Teruko Yuhi, Hiroaki Yamaguchi, Ayu Watanabe, Yasuhiko Yamamoto, Hiroshi Okamoto, Shinichi Horike, Junpei Terakawa, Takiko Daikoku, Mizuki Watanabe, Nariyasu Mano, Haruhiro Higashida, and Satoshi Shuto J. Med. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.jmedchem.8b01691 • Publication Date (Web): 21 Mar 2019 Downloaded from http://pubs.acs.org on March 21, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 54 1 2 3 4 5 6 1 7 8 9 10 2 11 12 13 14 3 15 16 17 18 19 4 20 21 22 5 23 24 25 6 26 27 7 28 29 30 31 8 32 33 9 34 35 36 10 37 38 11 39 40 41 12 42 43 13 44 45 46 47 14 48 49 15 50 51 16 52 53 54 17 55 56 57 58 59 60

Journal of Medicinal Chemistry

Development of a Highly Potent Analogue and a LongActing Analogue of Oxytocin for the Treatment of Social Impairment-Like Behaviors Wataru Ichinose,†# Stanislav M. Cherepanov,‡# Anna A. Shabalova, Shigeru Yokoyama,‡ Teruko Yuhi,‡ Hiroaki Yamaguchi,§ Ayu Watanabe,§ Yasuhiko Yamamoto,+ Hiroshi Okamoto,+ Shinichi Horike,$ Junpei Terakawa,$ Takiko Daikoku,$ Mizuki Watanabe,† Nariyasu Mano§ Haruhiro Higashida,‡,* and Satoshi Shuto†&,* †Faculty

of Pharmaceutical Sciences and

&Center

for Research and Education on Drug

Discovery, Hokkaido University, Sapporo 060-0812, Japan ‡Department

of Basic Research on Social Recognition, Research Center for Child Mental

Development, Kanazawa University, Kanazawa 920-8640, Japan §Faculty

of Pharmaceutical Sciences, Tohoku University and Department of Pharmaceutical Sciences,

Tohoku University Hospital, Sendai 980-8574, Japan +Department

of Biochemistry and Molecular Vascular Biology, Graduate School of Medical Sciences,

Kanazawa University, Kanazawa 920-8640, Japan. $Kanazawa

University Advanced Science Research Center, Kanazawa 920-8640, Japan.

1

ACS Paragon Plus Environment

Journal of Medicinal Chemistry 1 2 1 3 2 4 5 6 3 7 8 4 9 10 5 11 12 13 6 14 15 7 16 17 8 18 19 9 20 21 22 10 23 24 11 25 26 27 12 28 29 30 31 13 32 33 34 14 35 36 37 38 15 39 40 16 41 42 17 43 44 45 18 46 47 19 48 49 20 50 51 52 21 53 54 55 22 56 57 23 58 59 60

Page 2 of 54

ABSTRACT: The nonapeptide hormone oxytocin (OT) has pivotal brain roles in social recognition and interaction and is thus a promising therapeutic drug for social deficits. Because of its peptide structure, however, OT is rapidly eliminated from the bloodstream, which decreases its potential therapeutic effects in the brain. We found that newly synthesized OT analogues in which the Pro7 of OT was replaced with N-(pfluorobenzyl)glycine (2) or N-(3-hydroxypropyl)glycine (5) exhibited highly potent binding affinities for OT receptors and Ca2+ mobilization effects by selectively activating OT receptors over vasopressin receptors in HEK cells, where 2 was identified as a superagonist (EMax = 131 %) for OT receptors. Furthermore, the two OT analogues had remarkably long-acting effect, up to 16–24 h, in recovery from impaired social behaviors in two strains of CD38 knockout mice that exhibit autism spectrum disorderlike social behavioral deficits, whereas the effect of OT itself rapidly diminished.

INTRODUCTION Oxytocin (OT) is a peptide hormone and neuromodulator that exists in peripheral organs and tissues such as the uterus and mammary glands as well as in the central nervous system (CNS), and is mainly synthesized in the neurons of the supraoptic and paraventricular nuclei of the hypothalamus.1 OT in peripheral organs induces uterine contractions and milk ejection during delivery and lactation in the female reproductive period.2 OT also acts as a key molecule for neurotropic functions in both sexes.3 The molecule enhances social communication, such as social behavior, recognition, and memory in many species of mammals, including humans.4 Autism spectrum disorder (ASD) is a congenital neurodevelopmental disease characterized by impairments in social communication, social interactions, as well as repetitive behaviors and restricted 2


Page 3 of 54 1 2 1 3 4 2 5 6 7 3 8 9 4 10 11 5 12 13 14 6 15 16 17 7 18 19 8 20 21 9 22 23 24 10 25 26 11 27 28 12 29 30 31 13 32 33 14 34 35 15 36 37 38 16 39 40 17 41 42 18 43 44 19 45 46 47 20 48 49 21 50 51 22 52 53 54 23 55 56 57 58 59 60


interests.5 Several therapeutic strategies have been applied to the treatment of ASD to improve the social impairment,6,7 including some small molecules drugs are under clinical studies such as bumetanide,8 but there are still no sufficiently effective medications on the market. Therefore, OT may be a valuable lead for the development of a new medicine that takes advantage of the biological basis of social behavior in healthy subjects and restores normal social behavior in patients with psychiatric diseases such as ASD, depression and schizophrenia.9 As a central neuromodulator, defects in the OT system may be related to the abnormal social communication behavior of patients with ASD, because the concentration of OT in the blood or salivary glands is low in ASD patients,10 and gene mutations of OT receptor (OTR) coding and non-coding regions are detected at a higher rate in ASD patients.11,12 In addition, gene mutations of transmembrane proteins, such as CD38 and CD157, which are related to the cascade of events induced by OT secretion,13, 14, 15, 16 lead

to autism-like social memory defects and hyperactivity, and mice lacking these genes provide

a possible behavioral model of attention deficient hyperactivity disorder.13 Single nucleotide polymorphisms of CD38 and CD157 genes are associated with ASD,17, 18 which suggests the importance of OT signaling mediated by CD38 and CD157 in social behavior. According to these findings, we previously developed CD38 knockout (CD38KO) mice19 that exhibited social amnesia,20 which is a key deficiency in ASD patients. Other remarkable features of CD38KO mice are a deficit in paternal nurturing behavior21 and in reward activity in male mice in the sucrose–intake test.21 Male CD38KO mice exhibit a notable decrease in immobility time in the tail suspension test,22 which represents hypermobility as a type of neurodevelopmental disorder such as attention-deficit hyperactivity disorder-like behavior, rather than depression. Interestingly, administration of OT rescued these impairments in CD38KO mice.21,22 Because these behavioral modifications were an important point in studies on OT analogues as described below, we were interested in further validating the pharmacological effects of OT and its

3


Journal of Medicinal Chemistry 1 2 1 3 4 2 5 6 7 8 3 9 10 4 11 12 5 13 14 15 6 16 17 7 18 19 8 20 21 9 22 23 24 25 10 26 27 11 28 29 12 30 31 32 13 33 34 14 35 36 15 37 38 39 16 40 41 17 42 43 18 44 45 19 46 47 48 20 49 50 21 51 52 22 53 54 55 56 57 58 59 60

Page 4 of 54

analogues on these phenotypes with CD38 null mutant mice newly created by using the CRISPR/CAS9 gene editing method (CD38KOCC). Some recent clinical trials of single intranasal OT administration in ASD patients restored emotional recognition and steady eye gaze.23,24 The optimal dosing regimen of repeated applications of OT in ASD patients has not yet been determined, because repeated intranasal application of OT failed to produce positive effects on the primary endpoints in some clinical trials.25,26 Several reports have indicated that intranasal OT administration increases episodes of social interactions as scored by caregivers and family observations at home,27 which suggests that OT has therapeutic benefits for ASD patients.27,28,29 We previously reported three OT analogues, designated lipooxytocins (LOTs), in which a palmitoyl group was linked to the cysteine terminal amino group and/or the tyrosine aromatic hydroxyl group of OT.30,31 These OT analogues and OT displayed curative effects against social impairments in CD38 and CD157 knockout mice, which exhibit ASD-like social behavioral deficits,21 with a single i.p. injection at a dose of 1-3 ng/g of body weight .22,30,31 Unlike OT, the LOT analogues are not immediately effective for the treatment of ASD-related behavioral deficits in these knockout mice, consistent with the finding that LOT analogues fail to elicit cytosolic Ca2+ mobilization by activating OTRs immediately after application in OTR-expressing HEK 293 cells in culture.31 In sharp contrast to OT, however, their efficiency lasted approximately 24 h longer than that of OT, because OT, a natural peptide, is rapidly eliminated in the body. We previously reported that i.p. injections of a LOT analogue resulted in a longlasting elevation of the OT concentration in the cerebrospinal fluid (CSF), and the concentration was higher than that produced by i.p. injections of OT,31 which suggested that the LOT analogue was easily transported into the CSF due to its lipophilic property.

4


Page 5 of 54 1 2 1 3 4 2 5 6 7 3 8 9 4 10 11 5 12 13 14 6 15 16 7 17 18 8 19 20 21 9 22 23 24 25 10 26 27 28 11 29 30 12 31 32 33 13 34 35 14 36 37 15 38 39 40 16 41 42 17 43 44 18 45 46 47 19 48 49 50 20 51 52 21 53 54 22 55 56 57 23 58 59 60


In the present paper, we describe highly potent OT analogues 2 and 5; in particular, 2 seems to be a “superagonist” that expresses greater agonistic efficacy than the natural full agonist OT and the clinically applied 1-deamino-1-carba-2-tyrosine(O-methyl)-oxytocin (carbetocin).32 Analogues 2 and 5 ameliorated social behavioral deficits more effectively and for a remarkably longer time than OT, like LOTs, in spite of their lacking lipophilic chains unlike LOTs. We studied the effects of these analogues on pup retrieval as a parental behavior, abnormal emotional deficits in the sucrose preference test, and hypermobility in tail suspension tests, with two types of CD38 knockout mouse models of a developmental disorder such as ASD, in which the behaviors are sensitive to OT.

RESULTS AND DISCUSION Design of New OT Analogues. Many structure-activity relationship (SAR) studies have focused on enhancing the binding potency of the ligand to OTRs, as well as on decreasing the binding affinity for vasopressin receptor (AVPR) subtypes (V1aR, V1bR, and V2R) to minimize non-specific effects on peripheral organs.33-40 These SAR studies revealed that deamination at the terminal cysteine residue, Cys1, induces an increase in OTR selectivity over AVPR. The modification was adopted as the first option in recent SAR studies because deamination also improved the hydrophobicity and chemical stability of OT. The medicine used clinically to induce uterine contraction, carbetocin, is also a deaminoOT analogue.41,42 Recently, Wiśniewski and co-workers reported an excellent study on OT analogues.43 They synthesized a series of deamino-OT derivatives in which Pro7 and the disulfide linkage (-S-S-) between Cys1 and Cys6 in OT were replaced with N-substituted glycine residues and a thioether linkage (-CH2-S-), respectively.43 In their screening, some OT analogues, such as 1 and 4 (Table 1), exhibited high agonistic activity on hOTR (EC50: 0.025 nM for 1 and 0.27 nM for 4) and significantly lower activity on hAVPRs 5


Journal of Medicinal Chemistry 1 2 1 3 4 2 5 6 7 3 8 9 4 10 11 5 12 13 14 6 15 16 7 17 18 8 19 20 21 9 22 23 24 10 25 26 11 27 28 12 29 30 31 13 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 54

(EC50: >10 nM (hV1aR and hV1bR) for 1 and EC50: >10 nM (hV1aR), 7.7 nM (hV1aR) for 4) . Analogue 1, named merotocin, is now in clinical trials for inducing milk ejection in premature labor.44 We were very interested in these results in relation to our previous studies on LOTs with long-acting anti-anxiety effects, as described above, in which we conjugated long acyl chains at the terminal amino group on Cys1 and the phenolic hydroxyl group on Tyr2 of OT.30,31 We postulated that, in LOTs, the hydrophobic acyl chains would enhance intracerebral transfer, which leads to slow release of OT as a prodrug. Therefore, we expected that, using peptides such as 1 and 4 instead of OT, development of efficient prodrugs without AVPRs activity might be achieved by their lipidation. As OT-related compounds, merotocin and its derivatives exhibit potent and selective OT agonistic activity. Thus, in the present study, we designed OT analogues 2, 3, 5, and 6 (Table 1) in which Pro7 was replaced with N-p-fluorobenzyl- or N-(3-hydroxypropyl)glycine, similar to Wiśniewski’s deamino-OT analogues 1 and 4, respectively,43 but the terminal amine at Cys1 of OT was preserved because of its potential exploitation for lipidation.

6


Page 7 of 54


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1

Table 1. Molecular structures of OT and its analogues.

2 3

Synthesis. OT analogues 2, 3, 5, and 6 were synthesized by the Fmoc strategy45 with Rink amide resin

4

as summarized in Scheme 1. The standard amino acid coupling was conducted with a solution of

5

Fmoc-Xaa-OH (3.0 equiv), DIC (3.0 equiv), and HOAt (3.0 eqiuv) in NMP and Fmoc group was

6

removed with 20% piperidine in DMF. To introduce the N-(p-fluorobenzyl)- or N-(3-(tert-

7

butoxy)propyl) group at the glycine residue, the resin was successively treated with

8

bromoacetic acid/DIC/HOAt in NMP and p-fluorobenzylamine or 3-(tert-butoxy)propylamine

9

in DMF at room temperature.

7

Journal of Medicinal Chemistry 1 2 1 3 4 2 5 6 7 3 8 9 4 10 11 12 13 5 14 15 6 16 17 7 18 19 20 8 21 22 23 9 24 25 10 26 27 28 11 29 30 31 12 32 33 34 13 35 36 37 38 14 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 15 57 58 59 60

Page 8 of 54

For the synthesis of 2 and 5, the terminal Fmoc group was removed on the resin. After treating the resin with TFA/TIS/H2O (96/2/2), the cleaved linear precursors peptide was subjected to a cyclization reaction under oxidative conditions with I2 in MeOH. The HPLC purification gave the desired cyclic peptides 2 (total yield 38%) and 5 (total yield 26%), respectively. For the synthesis of 3 and 6, after completing the amino acid coupling on the resin, the resulting resin was successively treated with Pd(PPh3)4 and piperidine to remove the allyl group and Fmoc group, respectively, which was then treated with PyBop, HOAt and DIPEA to give the corresponding cyclized peptides. After cleavage of the peptides from the resin with TFA/TIS/H2O (96/2/2), hydrogenation of the cleaved cyclic peptides and HPLC purification provided the cyclic peptides 3 (total yield 23%) and 6 (total yield 11%), respectively. Known 1 and 4 were also prepared as reference ligands for biological evaluation by the previously reported method.43

Scheme 1. Synthesis of OT analogues 2, 3, 5, and 6.

8


Page 9 of 54 1 2 1 3 4 5 6 2 7 8 3 9 10 11 4 12 13 5 14 15 6 16 17 18 7 19 20 8 21 22 23 9 24 25 26 10 27 28 29 11 30 31 12 32 33 34 13 35 36 37 14 38 39 40 15 41 42 43 16 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Receptor Binding Assay. We first examined [3H]OT binding of compounds to the human OTRs (hOTRs) in crude membrane fractions of HEK cells expressing hOTRs, and the data are summarized in Table 2. [3H]OT bound specifically and reversibly to OTRs with a Kd of 0.3 ± 0.06 nM (data obtained from two experiments, each performed in duplicate; Figure S1), whereas non-specific binding was defined in the presence of 1 µM unlabeled OT. The binding affinities of OT, AVP, carbetocin, and compounds 1–6 were determined by using a radioactive competitive assay. Displacement of bound [3H]OT was measured over a concentration range of 1 pM–1 µM (Figure 1). AVP and all screened analogues showed strong binding affinity for hOTR (Ki ≤ 3.0 nM). Particularly, compound 2 exhibited high binding affinity for hOTR comparable to that of native OT (Ki = 0.58 nM vs 0.51 nM), whereas the affinities of other examined compounds slightly decreased relative to that of OT. Compounds 2 (Ki = 0.51 nM) and 3 (Ki = 0.90 nM) derived from analogue 1 with N-(p-fluorobenzyl)glycine had higher affinity than those of compounds 5 (Ki = 1.4 nM) and 6 (Ki = 3.0 nM) derived from analogue 4 with N-(3-hydroxypropyl)glycine. The affinity of carbetocin (Ki = 1.81 nM) was in accord with the reported value.41

9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Remaining [3H]OT (%)


Page 10 of 54

OT AVP Carbetocin 1

100

2 3 4 5 6

50

0 -12

-10

-8

-6

Log M

1 2

Figure 1. Representative radioligand concentration displacement curves for OT, AVP, OT, and

3

comounds 1–6. All curves were normalized to percentage of displacement of [3H]OT. Data are

4

means ± SEM from results obtained from two experiments, each performed in duplicate.

5

Table 2. Binding affinity and biological activities of OT, AVP and analogs.

Compou nd

Binding affinity Ki nM (95% CI) hOTR

OT

0.58 (0.42-0.80)

Agonist potency EC50, nM (95% confidence interval)

Agonist efficacy Emax %

Selectivity

hOTR

hV1aR

hV1bR

hV1aR/hOTR

hV1bR/hOT R

hOTR

0.01 (0.004-0.02)

0.19 (0.1-0.32)

0.24 (0.19-0.3)

18.8

24.2

100

AVP

2.0 (1.42-2.86)

0.1 (0.053-0.21)

0.004 (0.001- 0.011)

0.0035 (0.0007-0.016)

0.03

0.03

39

Carbetoci n

1.8 (1.17-2.80)

0.01 (0.001-0.09)

2.3 (0.2-25)

4.8 (1.28-17.8)

226

479

57

1

1.1 (0.85-1.43)

0.025 (0.01-0.062)

>10

>10

>400

>400

61

2

0.51 (0.44-0.72)

0.028 (0.01-0.062)

2.2 (0.55- 8.47)

0.50 (0.15-1.6)

75.3

17.5

131

3

0.90 (0.63-1.30)

0.089 (0.02-0.36)

4.0 (0.79- 20.6)

0.80 (0.35-1.85)

45.0

9.0

82

4

1.4 (1.02-1.9)

0.27 (0.061-1.19)

>10

7.7 (3.58-16.49)

>37

28.4

57

10


Page 11 of 54 1 2 3 4 5 6 7 8 1 9 10 2 11 12 3 13 4 14 5 15 16 6 17 7 18 19 8 20 21 9 22 23 10 24 25 26 11 27 28 12 29 30 13 31 32 33 14 34 35 15 36 37 16 38 39 40 17 41 42 18 43 44 19 45 46 20 47 48 49 21 50 51 52 22 53 54 23 55 56 57 58 59 60


5

1.4 (0.92-2.10)

0.031 (0.004-0.26)

>10

>10

>323

>322

88

6

3.0 (2.10-4.23)

0.15 (0.021-1)

>10

>10

>66.6

>66.6

50

aK

was determined by radioactive binding displacement assay and experiments were performed twice in duplicate. bEC50 values of agonist activities were determined at hOTR, hV1aR, and hV1bR using the [Ca2+]i measurement with a microspectrofluorometric system, number of independent experiments: n = 3. Each experiment was performed in duplicate, number of measured cells in each cell-dish: 20. cEmax values of agonist potencies were calculated from EC50 curves for hOTR, hV1aR, and hV1bR. i

Agonist-Induced Increase in Intracellular Ca2+ Concentrations. We examined receptor activation followed by Ca2+-mobilization from intracellular inositol-1,4,5-trisphosphate-sensitive Ca2+ stores by measuring cytosolic free Ca2+ concentrations ([Ca2+]i) in HEK-293 cells expressing hOTRs, human vasopressin 1a receptors (hV1aRs), and human vasopressin 1b receptors (hV1bRs). Overall data, including the half-maximal effective concentration (EC50), Emax, and thus selectivity, for OT, AVP, carbetocin, and OT analogues 1–6 are presented in Table 2. Their potency for hOTR is ranked with EC50 values as OT (0.010 nM), carbetocin (0.010 nM) > 1 (0.025 nM) ≈ 2 (0.028 nM) ≈ 5 (0.031 nM) > 3 (0.089 nM) ≈ AVP (0.10 nM) ≈ 6 (0.15 nM) > 4 (0.27 nM). Compounds 1, 3, 4, and 6 maintained partial agonist properties for hOTR (Emax = 61% for 1, 82% for 3, 57% for 4, 50% for 6), while 5 showed almost full agonistic potency (Emax = 88%), as summarized in Table 2. Surprisingly, 2 demonstrated “superagonistic” potency compared with OT (Emax = 131% vs. 100%; Table 2, Figure 2A and 2C). Partial agonistic effects on both hV1aR and hV1bR were induced by 2 (Figure 2A), while almost no agonistic effect on either receptor was induced by 5 (Figure 2B). The hOTR selectivitiy vs. hV1aR and hV1bR of compounds was also summarized in Table 2. The hOTR selectivity vs. hV1aR of peptides 1–6 was higher than that of OT; particularly, 2 and 5 showed high

11


Journal of Medicinal Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 54

1

selectivity of >400-fold and >323-fold, respectively. Also, 2 and 5 showed high hOTR selectivity vs.

2

hV1bR; >400-fold and >323-fold, respectively.

3

On the basis of these in vitro experimental results, particularly with regard to their hOTR

4

selectivity and agonistic potency, we focused on OT analogues 2 and 5, in which the Pro7 of OT was

5

replaced with N-(p-fluorobenzyl)glycine or N-(3-hydroxypropyl)glycine, respectively, and the terminal

6

amino group and S-S linkage of OT were preserved, different from carbetocin and its deamino-OT

7

derivatives 1 and 4. Thereafter, we tested and compared the in vivo effects of compounds 2 and 5 with

8

that of OT.

12


Page 13 of 54

B 150

OTR V1AR V1BR

100

50

0 -12

-10

% of maximum response


A

150

OTR V1AR V1BR

100

50

0 -12

-8

-10

-8

M

M 150

OT AVP 2 5

100

50

0 -12

-10

-8


D

C % of maximum response

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 1 28 29 2 30 31 3 32 33 34 4 35 36 37 5 38 39 40 6 41 42 43 7 44 45 46 8 47 48 49 9 50 51 10 52 53 11 54 55 12 56 57 58 13 59 60


150

OT AVP 2 5

100

50

0 -12

-10

-8

M

M

Figure 2. Agonistic activities of OT analogues. Agonistic activities of 2 (A) and 5 (B) for hOTR, hV1aR, and hV1bR. Activities of OT, AVP, 2, and 5 for hOTR (C) and hV1aR (D), determined by [Ca2+]i microspectrofluorometric measurement. A value of 100% indicated the maximum Ca2+release after OT application. Number of independent experiments: n = 3. Each experiment was performed in duplicate, number of measured cells in each cell-dish: 20.

Parental Retrieval Test. We examined the effects of OT, 2, and 5 on parental behavior by using the latency to retrieve pups by WT and CD38KO sires, a social behavior test that we previously developed.20– 22

Thirty minutes after a single intraperitoneal injection of phosphate-buffered saline (PBS), WT sires

showed retrieval behavior with a mean latency of 233 ± 68 s (n = 10), whereas CD38KO sires had a mean latency of 600 ± 0 (n = 13, Figure 3A), which replicated previous results.22 The latencies to retrieve pups by CD38KO sires 30 min after a single intraperitoneal injection of 100 ng/100 g body weight of OT, 2, or 13 ACS Paragon Plus Environment

Journal of Medicinal Chemistry 1 2 1 3 4 2 5 6 7 3 8 9 4 10 11 12 5 13 14 15 6 16 17 7 18 19 8 20 21 9 22 23 24 10 25 26 11 27 28 12 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 13 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 54

5 were 240 ± 69 s (n = 10), 297 ± 87 s (n = 10), and 346 ± 82 s (n = 10), respectively. One-way ANOVA revealed significant differences between groups (F4,45 = 8.45, p = 0.0001). Bonferroni’s post hoc tests showed significant differences between CD38KO sires treated with OT (p = 0.006), 2 (p = 0.032), and 5 (P = 0.048). Next, we examined how long the effects of OT, 2, and 5 lasted. As shown in Figure 3B, the activity of OT was completely lost at 6 h. Treatment with both 2 and 5 significantly affected the latency to retrieve pups to the nest at 6 and 12 h; at 24 h, however, only 5 was still active. Compared with the PBS controls, the latencies to retrieve pups at 5, 12, and 24 h after injection of 2 (10 mice/group) were 381 ± 65 s (p = 0.045), 155 ± 65 s (p = 0.0001), and 413 ±79 s (p = 0.16); and after injection of 5 were 293 ± 86 s (p = 0.0013), 386 ± 75 s (p = 0.0001), and 100 ± 94 s (p = 0.00013), respectively. Two-way ANOVA indicated significant effects of interaction (F12, 180 = 4.31, p = 0.0001), time (F4,180 = 3.74, p = 0.006), and treatment conditions (F3, 180 = 28.943, p = 0.0001).

14


Page 15 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 1 21 22 23 2 24 25 26 3 27 28 29 4 30 31 5 32 33 34 6 35 36 37 7 38 39 8 40 41 42 9 43 44 45 46 10 47 48 49 11 50 51 52 12 53 54 55 13 56 57 14 58 59 60


B

Figure 3. Pup retrieval behavior by sires. The latencies for pup retrieval by WT or CD38KO sires at 30 min (A) and the time-course (B) after a single intraperitoneal injection of phosphatebuffered saline (PBS), OT, 2, or 5 (100 ng/100 g body weight); n = 10/group. One-way ANOVA followed by Bonferroni’s post hoc test was performed for 30 min (F4,45 = 8.45, p = 0.0001), and two-way ANOVA followed by Bonferroni’s post hoc test was performed for the time-course (time F4,180 = 3.74, p = 0.006; treatment F3,180= 28.94, p = 0.0001; interaction F12,

180

= 4.31, p =

0.0001). The significance levels of the Bonferroni post hoc test performed to compare the test treatments with the CD38KO treated by PBS were * p < 0.05 and ** p < 0.01.

To clarify the long-acting effects of 2 and 5 in comparison with OT, we evaluated them with two additional mouse models described below. Tail Suspension Test. The long-acting effects of 2 and 5 were next examined in a tail suspension test, which evaluates depression-like emotional behavior. Our previous findings22 revealed a shorter duration 15


Journal of Medicinal Chemistry 1 2 1 3 4 2 5 6 7 3 8 9 4 10 11 5 12 13 14 6 15 16 17 7 18 19 8 20 21 9 22 23 24 10 25 26 11 27 28 12 29 30 31 13 32 33 14 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 15 55 56 57 58 59 60

Page 16 of 54

of immobility in male CD38KO mice than in WT mice. CD38KO mice exhibit hyperactivity rather than the decreased activity that is typical in this task.22,13 This was confirmed by newly created Cd38 geneknockout mice using the CRISP-CAS9 gene-editing method,46 designated as CD38KOCC mice. CD38KOCC mice exhibited a shorter duration of immobility than WT ICR mice, and similar hyperactivity as CD38KO (Figure S2) mice. Therefore, we used this new mouse line as a mouse model of hyperactivity. The effects of OT, 2 and 5 were examined at 30 min and 24 h after injection (Figure 4). Immobility was enhanced in CD38KOCC male mice at 30 min (74.2 ± 2.9 s, n = 5) and treatment with OT, 2, or 5 significantly increased the immobility to 171 ± 13.46 s (n = 5, p = 0.012), 149.5 ± 13.8 s (n = 8, p = 0.029), and 151.83 ± 21.3 s (n = 6) , respectively. After 24 h, only compound 5 significantly increased immobility (157.3 ± 21.4 s, n = 5, p = 0.039) compared with that after PBS treatment (56.5 ± 18.8 s, n = 5; p = 0.0135). A two-way ANOVA revealed significance of time (F1,31 = 7.103, p = 0.0121) and treatment (F3,31 = 10.55, p = 0.0001). No statistically significant difference in effects was observed between CD38KOCC mice treated with OT or 2 and those treated with PBS at 24 h after the injection.

16


Page 17 of 54 1 2 1 3 4 5 2 6 7 8 3 9 10 4 11 12 13 14 5 15 16 6 17 18 7 19 20 21 8 22 23 9 24 25 10 26 27 28 11 29 30 12 31 32 13 33 34 35 14 36 37 15 38 39 16 40 41 17 42 43 44 18 45 46 19 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Tail suspension test. Immobility time of male CD38KOCC mice at 30 min and 24 h after a single intraperitoneal injection of PBS, OT, 2, and 5. n = 5 – 8 per group. Two-way ANOVA followed by Bonferroni’s post hoc test showed a significant effect of treatment (F3,31 = 10.55, p = 0.0001) and time (F1,31 = 7.103, p = 0.0121). * p < 0.05. Sucrose Preference. We previously reported that OT was associated with paternal behavior in the mouse.21,22 Therefore, to confirm the long-lasting effects of 2 and 5 compared with that of OT, we performed a sucrose preference test that allowed us to quantify the sensory system and anhedonia, which is an indicator of nucleus accumbens dysfunction.21 We used a 1% sucrose solution in this task in which mice were allowed to freely choose between water and sucrose solutions.21,22 Sucrose consumption was significantly lower in CD38KOCC male mice than in WT mice, similar to CD38KO mice (Figure S3). CD38KOCC male mice treated with PBS showed no sucrose preference (0.46 ± 0.04, n = 8), whereas CD38KOCC mice showed significant recovery of sucrose preference following administration of OT (0.80 ± 0.02, p = 0.0001, n = 5), 2 (0.79 ± 0.02, p = 0.0001, n = 5), and 5 (0.72 ± 0.05, p = 0.001, n = 5) at 60 min (Figure 5A). One-way ANOVA revealed significant differences between groups (F3,19 = 22.13, p = 0.0001). At 24 h after the injection, only 5 demonstrated a significant elevation in sucrose consumption (0.67 ± 0.02, n = 5, p = 0.046), with a tendency toward a long-lasting effect (Figure 5B), whereas injection of OT or 2 had no effect. One-way ANOVA revealed significant differences between groups (F3,19 = 3.26, p = 0.044).

17



A

B

**

1.0

Sucrose preference

1.0 0.8 0.6 0.4 0.2

* 0.8 0.6 0.4 0.2

5

2

O T

5

2

T O

PB S

S

0.0

0.0

PB

Sucrose preference

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 1 21 22 2 23 24 3 25 26 27 4 28 29 30 5 31 32 6 33 34 35 36 7 37 38 39 8 40 41 42 9 43 44 10 45 46 11 47 48 49 12 50 51 13 52 53 14 54 55 15 56 57 58 16 59 60

Page 18 of 54

Figure 5. Sucrose preference test. Preference of CD38KOCC males for 1% sucrose solution consumption at 1 h (A) or 24 h (B) after treatment with PBS, OT, 2, or 5 (single intraperitoneal injection), n = 5–8. One-way ANOVA followed by Bonferroni’s post hoc test was performed for 60 min (F3,19 = 22.13, p = 0.0001) and 24 hours (time F3,19 = 3.26 p = 0.044) after and showed significant differences for * p < 0.05 and ** p < 0.01.

Pharmacokinetics. To understand the pharmacological potency and duration of action, we tested the pharmacokinetics of OT, 2, and 5. Figure 6 shows the plasma concentration of OT, 2, and 5 after intravenous administration, measured by the LC-MS/MS method. The plasma concentration immediately after administration of OT, 2, and 5 were 334 ± 155 ng/mL (n = 5), 118 ± 60 ng/mL (n = 3), and 108 ± 35 ng/mL (n = 3), respectively. These three compounds rapidly disappeared from the plasma with a half-life (t1/2) of almost 10 min (Figure 6B and 6C; the t1/2 values in the fast phase for OT, 2, and 5 were 2.91, 2.84, and 3.1 min, respectively; the t1/2 values in the slow phase were 8.84, 2.86, and 4.23 min, respectively; Table 3), which suggested that 2 cleared from the blood more rapidly than did OT and 5. Within 60 minutes after i.v. administration of compounds 2 and 5, OT levels were significantly elevated to 1.21 ± 18 ACS Paragon Plus Environment

Page 19 of 54


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1

0.86 ng/mL and 0.6 ± 0.11 ng/mL, respectively. Table 3 shows the cerebrospinal fluid (CSF)

2

concentrations of 2 and 5 after intravenous administration. The CSF concentration of 2 at 30 min after the

3

injection was 100 pg/mL (93 pM). Surprisingly, 12 h after injection, the concentration of compound 2 in

4

the CSF increased to 380 pg/mL (350 pM). The presence of 5 was determined at both 30 min and 12 h,

5

but its exact concentration was not determined because the obtained values were below the detection

6

limit.

19


A Plasma concentration (ng/mL)

1000

OT OT

100 10 1 0.1 0.01

0.001

0.0001 0

15

30

45

60

Time(min)

Plasma concentration (ng/mL)

B 1000

OT OT 2 Compound 2

100 10 1 0.1 0.01

0.001

0.0001 0

15

30

45

60

Time(min)

C 1000

Plasma concentration (ng/mL)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 54

OT OT 5 Compound 5

100 10 1 0.1 0.01

0.001

0.0001 0

1

15

30

45

60

Time(min)

2

Figure 6. Plasma concentrations of OT, and 2, or 5 after intravenous administration of OT (A), 2

3

(B), and 5 (C). ICR mice were administered with OT, 2, or 5 at a dose of 3 μg/mouse via the tail 20


Page 21 of 54 1 2 1 3 4 5 2 6 7 8 3 9 10 11 12 4 13 14 15 16 17 18 19 20 21 22 23 24 25 5 26 6 27 28 7 29 30 8 31 32 33 9 34 35 10 36 37 38 11 39 40 12 41 42 13 43 44 45 46 14 47 48 49 50 15 51 52 53 16 54 55 17 56 57 58 18 59 60


vein. Blood samples were collected at the indicated times after injection. Each point represents the mean ± SE of three to five mice.

Table 3. Kinetic parameters of OT, 2, and 5 after intravenous administration. Compound OT 2 5

t1/2 (min) Plasma fast Plasma slow 2.91 8.84 (1.48–8.4) (5.83–18.2) 2.84 2.86 (2.83–2.85) (2.77–2.96) 3.1 4.23 (2.59–3.82) (3.73–4.89)

30 min

100

CSF concentration (pg/mL) 12h Not determin ed　　　　　　 380

ng/mllimit of Below lower quantification

Not determin ed

Below lower limit of quantification

Concentrations were obtained by LC-MS/MS. Compounds (3 µg/mouse) were administered via the tail vein. Number of measurements in each time point n = 3–5. The t1/2 for fast phase of decay calculated for 15 min and for the slow phase for315–60 min.

The stability of the compounds in the serum was assessed by calculating the percent of the initial concentration in the fresh sample and was considered acceptable if it was 85%–115% (Figure S4). All analyses were within the acceptable value and were stable in mouse plasma after 2 h at 37 °C. These data indicate that the disappearance of OT, 2, and 5 in the blood was not due to decomposition by enzymatic digestion, but rather by clearance or adsorption to various tissues and organs.

Kinetics of Resurrection. To calculate the kinetic parameters (Kon, Koff≠, and t1/2) of the compounds, we used the equations of Motulsky and Mahan.47 Initially the kinetic parameters of [3H]OT were determined, which were obtained through construction of a family of association kinetic curves using a range of three different [3H]OT concentrations (Figure S5, Table 4). 21



Page 22 of 54

1

Figure 7 shows kinetic competition curves for OT (A), 2 (B), and 5 (C), which were assessed at

2

three concentrations (near Ki, 5-fold Ki, or 10-fold Ki). The data indicated differences in both the Kon and

3

Koff parameters for the compounds (Table 4). Compound 2 exhibited fast kinetics with a t1/2 that was

4

approximately three times lower than that of [3H]OT and eight times lower than that of 5. Compound 5

5

demonstrated slower association and dissociation rates than [3H]OT.

6

22


A

OT

800

0 Ki 5Ki 10Ki

600 400 200 0 0

50

100

150

200

B

Specific [3H]OT binding (c.p.m.)

Time

Compound 2

800

0 Ki 5Ki 10Ki

600 400 200 0 0

50

100

150

200

Time (min)

С


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60



Page 23 of 54

Compound 5

800

0 Ki 5Ki 10Ki

600 400 200 0 0

50

100

150

200

Time

1 2

Figure 7. Competition kinetics curves for OT (A), 2 (B), and 5 (C). HEK-293 hOTR membranes were

3

incubated with 500 pM [3H]OT and varying concentrations of the competitors. Plates were incubated for

4

the indicated times, and non-specific binding levels were determined in the presence of cold OT (1 µM).

23


Journal of Medicinal Chemistry 1 2 1 3 4 2 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 3 20 21 4 22 23 5 24 6 25 26 27 28 7 29 30 8 31 32 33 9 34 35 36 10 37 38 11 39 40 12 41 42 13 43 44 45 14 46 47 48 49 15 50 51 16 52 53 54 17 55 56 57 18 58 59 60

Page 24 of 54

Table 4. Comparison of the receptor kinetic parameters of OT agonists. Compound

Ki nM

Kon M-1

Koff

min-1

min-1

min

0.3 (0.18-0.42) 0.58 (0.42-0.8)

1.737e+008

0.05433±0.007

11.85

8.065e+006

0.04222±0.009

15.23

2

0.51 (0.44-0.72)

1.05e+008

0.1003±0.048

6.38

5

1.4 (0.92-2.1)

7.473e+006

0.01746±0.007

36.65

[3H]OT OT

t1/2

Kinetic parameters were determined by radioactive binding competitive kinetics assay. Number of independent experiments, n = 2. Each experiment was performed in duplicate.

Discussion. The four newly synthesized OT analogues showed their high affinity for hOTRs in Ki range of 0.51–3.0 nM, with the lowest values of 0.51 nM for analogue 2, whereas OT had a value of 0.58 nM, which suggested that 2 is equipotent to natural OT. Furthermore, the in vitro agonist potency of different concentrations of these compounds was in a range of 10–147 pM, as calculated based on the EC50 of [Ca2+]i changes in hOTR-expressing HEK cells, with the highest EC50 of 10 pM for OT and carbetocin and 28 pM for 2. These results indicated the very potent agonistic characteristics of these compounds. Interestingly, the dose-response curves revealed that 2 had 131% of the agonist potency of natural OT (100%). Some reports have described ‘‘superagonists’’ as compounds that have efficacy in the assay greater than that of the natural full agonist for membrane receptors, such as nicotinic acetylcholine receptors or adrenergic β2-receptors.

48–53

Therefore, the above data showed that

compound 2 possesses agonistic ability superior to natural agonist OT, which indicated that it is 24


Page 25 of 54 1 2 1 3 4 5 2 6 7 8 3 9 10 4 11 12 13 5 14 15 16 17 6 18 19 7 20 21 8 22 23 9 24 25 26 10 27 28 11 29 30 12 31 32 33 13 34 35 14 36 37 15 38 39 40 16 41 42 17 43 44 18 45 46 19 47 48 49 20 50 51 52 21 53 54 22 55 56 57 23 58 59 60


a superagonist. This is the first example of a superagonist for OTR. Historically, fluorination of ligands has improved their pharmacological and pharmacokinetic properties.54,55 Therefore, the unique

transformation

from

the

proline

residue

at

position

seven

to

an

N-(p-

fluorobenzyl)glycine residue resulted in compound 2, which could be considered a superagonist. However, for a stricter conclusion about superior agonistic activities of compound 2, we should determine pharmacological parameters in calcium assays by using cell cultures expressing mouse OT receptors for explanation of actions of OT analogues in mouse behavior. Alternatively, different functional assays, such as BRET-assay, or ex-vivo assays, such as myometrial contraction in human or mouse uterus, can be used. Parental behavior was examined by evaluating the retrieval of biological pups by sires, as we reported previously.21,22,56 This is a clear defective phenotype in CD38KO sires because wild-type ICR sires typically display nurturing behavior that is essentially similar to dam’s parental behavior by retrieving pups placed outside the nest. As expected from their immediate binding to OTRs, these analogues exhibited effects on retrieval immediately, 30 min, or 1 h post injection. This immediate action (similar to OT) and long-lasting action (unlike OT) could be beneficial for the therapeutic use of these analogues. The CD38KO sires retrieved almost no pups, as evidenced by a mean latency of 600 s to start retrieval, which was the maximum (ceiling) level allowed in the trial.31 The latency decreased to approximately to 200–300 s by the administration of 2 or 5, which indicated that CD38KO sires began to nurture, and similar levels were exhibited by WT sires and CD38KO sires treated with OT or its analogues. Restoration of social/parental behavior continued for at least 16 h after intraperitoneal administration of 2 and 5 in CD38KO sires, at which time the effect by OT completely disappeared. After 24 h, significant remission was observed only in sires treated with 5, which suggested long-lasting action 25


Journal of Medicinal Chemistry 1 2 1 3 4 2 5 6 7 3 8 9 4 10 11 12 5 13 14 15 6 16 17 7 18 19 20 8 21 22 9 23 24 25 10 26 27 11 28 29 12 30 31 32 13 33 34 14 35 36 37 15 38 39 40 16 41 42 17 43 44 18 45 46 19 47 48 49 20 50 51 21 52 53 54 55 22 56 57 23 58 59 60

Page 26 of 54

by both OT analogues with slight difference in the duration of the sustained effects between 2 and 5. LOT1 having two palmitoyl chains has been shown to have no immediate effects at 30 min because of its prodrug property,30,31 but had effects lasting 24 h, whereas 2 and 5 not only had both immediate and long-lasting effects. In this respect, 2 and 5 appear to be better OT analogues. We used two additional models namely tail suspension test and sucrose preference models, to investigate that whether peptides 2 and 5 have more efficient effects in vivo than OT as OTR ligands from pharmacological and pharmacokinetic viewpoints. Thus, we used a new mouse line with Cd38 deletion,19 in which the Cd38 gene was knocked out by using the CRISP-CAS9 method46 in the ICR strain. A significant effect of 5, but not 2, was observed at 24-h in a sucrose preference test evaluating the memory of a sweet drink as well as anhedonia in CD38KOCC male mice. Restoration from hyperactive behavior at the control (WT) level by treatment with 5, but not 2, also persisted for 24 h in CD38KOCC male mice. These experiments using this knockout line (CD38KOCC) demonstrated that the long-lasting effect of 5 is not mouse strain (CD38KO)-specific. The concentration profiles of OT, 2, and 5 in the plasma after intravenous administration revealed that the levels of all three compounds decreased rapidly, with approximately the same half-life (2-4 min) of the rapid phase and slightly different half-lives for the slower phase. This difference in the half-life decay in the blood may not be sufficient evidence by itself for the long-acting effect of compounds 2 and 5. Compound 2 was detected in the CSF, however, even at 12 h after intravenous administration, which may relate to its

long-acting potency, while we could not detect 5 in the CSF in the present

experiments. The fast decay in the plasma and the low levels of compounds in the CSF are informative about the possible involvement of other mechanisms of action of OT, 2, and 5: peripheral activity of OT on the 26


Page 27 of 54 1 2 1 3 4 2 5 6 7 3 8 9 4 10 11 5 12 13 14 6 15 16 17 7 18 19 8 20 21 9 22 23 24 10 25 26 27 11 28 29 30 12 31 32 13 33 34 14 35 36 37 15 38 39 16 40 41 17 42 43 44 18 45 46 47 19 48 49 50 20 51 52 21 53 54 22 55 56 23 57 58 59 60


sympathetic nervous system,57 OT-induced endogenous OT release,58 prosocial activity of OT metabolites,59 and OT activation of V1AR.60 Because the in vivo behavioral effects of compound 5, which has almost no V1AR activity, is similar to that of OT, we consider that V1AR activation has only a small role in the current behavioral experiments. In any event, we cannot exclude V1AR antagonism and this question should be addressed in future research that includes detailed studies of blood–brain barrier permeability. The data presented in Figure 6 indicate stable elevations of plasma OT concentrations for at least 1 h after i.v. administration of 2 and 5. As reported previously, we found OT-induced OT release in the hypothalamus mediated by ADPR58, which resulted in increased OT secretion from the pituitary into the blood. Compounds 2 and 5 may activate similar mechanisms of OT-autoregulation. Here we first time used competitive kinetics assay for hOTRs, which was previously used for muscarinic receptors61 suggesting a relation between the long-lasting effects of the compound and a long residence time on the receptor as well as a small Koff.61 In our experiment, the receptor binding kinetics of [3H]OT were measured in the presence of OT, 2, and 5, and the Koff of 5 was smaller than those of OT and 2. This low kinetic parameter value seems to indicate a longer receptor residence time. The longer receptor residence time might be related to the long-acting effects of compound 5. We cannot directly compare the residence time and long-lasting effects on behavior, however, because different parameters, such as the buffers used and physiologic conditions, may affect the receptor kinetics.62 Conclusion. We developed OT analogues 2 and 5, which are very active OTR ligands both in vitro and in vivo evaluation systems. Notably, only a subtle modification of OT, i.e., replacement of Pro7 with N-substituted glycine residues, significantly changed the pharmacological effects to provide a superagonist, 2, and a very long-acting agonist, 5. The remarkable improvement in the effective duration, which overcomes the critical disadvantages of short-acting OT, suggests that these analogues could be 27



Page 28 of 54

1

superior alternatives to OT for the treatment of several diseases in which social impairments are

2

prominent. OT itself is currently being applied in clinical trials in ASD,27,28 schizophrenia,63 and

3

depression.64 Thus, OT analogues 2 and 5 have potential therapeutic merit. In addition, we are interested

4

in lipidation of 2 and 5 as described above, which is now under investigation.

28


Page 29 of 54 1 2 1 3 4 2 5 6 7 3 8 9 10 4 11 12 5 13 14 15 6 16 17 18 7 19 20 21 8 22 23 9 24 25 26 10 27 28 29 30 11 31 32 12 33 34 35 13 36 37 38 14 39 40 15 41 42 43 16 44 45 46 17 47 48 18 49 50 51 19 52 53 54 20 55 56 57 21 58 59 60


EXPERIMENTAL SECTION General Methods of Chemistry. 1H-NMR spectra were recorded in CDCl3 at ambient temperature unless otherwise noted, at 400 or 500 MHz, with TMS as an internal standard. 13C NMR spectra were recorded in CDCl3 at ambient temperature. Silica gel column chromatography was performed with silica gel 60 N (spherical, neutral, 63-210 m, Kanto Chemical Co., Inc.). Flash column chromatography was performed with silica gel 60 N (spherical, neutral, 40-50 m, Kanto Chemical Co., Inc.). Purities of final compounds were determined by HPLC: column, Kanto C18 GP, 250 × 4.6 (mm); column temperature, 30°C; flow rate, 1.0 mL/min; solvent A, water containing 0.1% TFA; solvent B, acetonitrile containing 0.1% TFA; detection, 240 nm. The purities of all final compounds exceeded 95%. General Procedure for Peptide Coupling on Resin. The peptides were assembled on Rink amide resin by Fmoc strategy. The fully protected peptide resin was synthesized manually, starting from 150 mg (0.10 mmol) of Rink Amide resin Nova Gel (200-400 mesh, Loading 0.67 mmol/g, Novabiochem®). The deprotection of Fmoc group was conducted by adding 20% piperidine solution in DMF (1 mL) for 10 min twice at room temperature, and then the resin was washed with DMF (5 × 1 mL). The standard amino acid coupling was conducted with a solution of Fmoc-Xaa-OH (3.0 equiv), DIC (3.0 equiv), and HOAt (3.0 eqiuv) in NMP (0.7 mL) at room temperature for 2 h, and then the resin was washed with DMF (5 × 1 mL). Each process was held in a shaker. To introduce the N-(p-fluorobenzyl)- or N-(3-(tert-butoxy)propyl)-glycine residue, the resin was treated with bromoacetic acid (4.0 equiv), DIC (4.0 equiv), and HOAt (4.0 equiv) in NMP (1 mL) at room temperature for 2 h, and then treated with p-fluorobenzylamine 29


Journal of Medicinal Chemistry 1 2 1 3 4 5 2 6 7 8 9 3 10 11 4 12 13 14 5 15 16 17 6 18 19 7 20 21 22 8 23 24 25 9 26 27 10 28 29 30 11 31 32 33 12 34 35 36 13 37 38 14 39 40 41 15 42 43 44 16 45 46 17 47 48 49 18 50 51 52 19 53 54 20 55 56 57 58 59 60

Page 30 of 54

(10 equiv) or 3-(tert-butoxy)propylamine (10 equiv) in DMF (1.0 M, 1 mL) at room temperature for 2 h. In the coupling just after the acylation, 4 equiv of amino acid was used. Peptides 2 and 5. The following amino acid derivatives were used for the coupling: FmocGly-OH, Fmoc-Leu-OH, Fmoc-Cys(Trt)-OH, Fmoc-Asn(Trt)-OH, Fmoc-Gln(Trt)-OH, Fmoc-IleOH, and Fmoc-Tyr(tBu)-OH. Upon completion of the solid phase synthesis, the resin was treated with TFA/TIS/H2O 96/2/2 (v/v/v) solution (10 mL) at room temperature for 1.5 h and filtered off. The filtrate was poured into diethyl ether (40 mL), and the resulting mixture was centrifuged to give the crude peptide as precipitate. After dried over in vacuo, the precipitate was dissolved in H2O/acetonitrile 1/4 (v/v, ca. 1 mg/mL). To the solution, a MeOH solution of I2 (0.1 M) was added slowly until the solution was colored yellow. After stirring the resulting mixture at room temperature for 6 h, solid sodium ascorbate was added until yellow color disappeared. The mixture was concentrated in vacuo, and then loaded onto a HPLC column and purified using H2O/acetonitrile gradient containing trifluoroacetic acid (0.1% v/v). The fractions containing the desired peptide was pooled and lyophilized. The peptide was obtained as white powder (2: 45 mg, 0.038 mmol, 38%; 5: 30 mg, 0.026 mmol, 26%, as a trifluoroacetic acid salt). 2; HPLC: Rt = 11.1 min, solvent A/B = 75/25; Purity: 97.8%; LRMS (ESI) m/z 1075.45 [(M + H)+], 1097.43 [(M + Na)+]; HRMS (ESI) calcd for C47H67FN12O12S2Na: 1097.4319 [(M + Na)+], found: 1097.4321. 5; HPLC: Rt = 5.61 min, solvent A/B = 80/20; Purity: 98.8%; LRMS (ESI) m/z 1025.45 [(M + H)+], 1047.44 [(M + Na)+]; HRMS (ESI) calcd for C43H69N12O13S2Na: 1025.4543 [(M + Na)+], found: 1025.4540.

30


Page 31 of 54


1 2 1 3 4 5 2 6 7 8 3 9 10 4 11 12 13 5 14 15 16 6 17 18 7 19 20 21 8 22 23 24 9 25 26 10 27 28 29 11 30 31 32 12 33 34 35 13 36 37 14 38 39 40 15 41 42 43 16 44 45 17 46 47 48 18 49 50 51 19 52 53 20 54 55 56 21 57 58 59 60


Peptides 3 and 6. The following amino acid derivatives were used for the coupling: FmocGly-OH, Fmoc-Leu-OH, Fmoc-Cys((CH2)2CH(NH-pNZ)CO2Allyl)-OH,43 Fmoc-Asn(Trt)-OH, Fmoc-Gln(Trt)-OH, Fmoc-Ile-OH, and Fmoc-Tyr(tBu)-OH. Upon completion of the solid phase peptide coupling, the resin was treated with Pd(PPh3)4 (347 mg, 0.3 mmol) in chloroform/Nmethyl morphorine/acetic acid 37/1/2 (v/v/v, 3 mL) solution at room temperature for 2.5 h, and then washed with DMF, 0.5% DIEA in DMF, 0.5% sodium diethyldithiocarbamate in DMF, and finally DMF. After treating with 20% piperidine in DMF, the resin was treated with PyBOP (260 mg, 0.5 mmol), HOAt (68 mg, 0.5 mmol)) and DIPEA (0.17 mL, 1.0 mmol) in DMF (1 mL). The resin was treated with cleaving cocktail, and the crude peptide was precipitated and centrifuged in diethyl ether, by the procedure described above for the coupling of 2 and 5. After dried over in vacuo, the crude peptide was treated with Pd-C (10%, 45 mg, 0.42 equiv) in EtOH/MeOH (1/1, 10 mL) under hydrogen atmosphere for 7 h. After removal of the Pd catalyst by filtration through Celite, the filtrate was concentrated in vacuo and loaded onto a HPLC column and purified using H2O/acetonitrile gradient containing trifluoroacetic acid (0.1% v/v). The fractions containing the desired peptide was pooled and lyophilized. The peptide was obtained as white powder (3: 27 mg, 0.023 mmol, 23%; 6: 12 mg, 0.011 mmol, 11%, as a trifluoroacetic acid salt). 3; HPLC, Rt = 5.4 min, solvent A/B = 70/30; purity: 97.4%; LRMS (ESI) m/z 1057.50 [(M + H)+], 1079.48 [(M + Na)+]; HRMS (ESI) calcd for C48H69FN12O12SNa: 1079.4755 [(M + Na)+], found: 1079.4773. 6; HPLC, Rt = 4.9 min, solvent A/B = 80/20; Purity: 96.1%; LRMS (ESI) m/z 1007.50 [(M + H)+], 1029.48 [(M + Na)+]; HRMS (ESI) calcd for C44H70N12O13SNa: 1029.4798 [(M + Na)+], found: 1029.4812. 31


Page 32 of 54

OTR Expression Plasmid Construction. The plasmid for hOTRs (pcDNAHOXTR) was constructed as reported previouosly. 65 AVP Receptors Plasmid Construction. Human brain total RNA (1 g; Clontech, Mountain View, CA, USA) was reverse-transcribed using a kit (Transcriptor First Strand cDNA Synthesis kit; Roche Applied Science, Penzberg, Germany) according to the manufacturer’s instruction. The resulting cDNA was subjected to nested polymerase chain reaction (PCR) using KOD FX DNA polymerase (Toyobo, Osaka, Japan) essentially as described previously.65 The primers for the initial PCR were as follows: 5′CCGAAGAGGGCCGAGTAGGA-3 ′ (sense) and 5 ′ -CTAGCTCAATTCAGCTAATGAGC-3 ′ (antisense) for HAVP1AR; and 5 ′ - TCCACTTGCATCCACACCCTC -3 ′ (sense) and 5 ′ GAGAACCTCCACTAGTCCTGG -3′ (antisense) for HAVP1BR. The aliquots (2 l) were subjected to the

secondary

PCR

as

described

above

using

another

set

of

primers:

5

′

-

CCGAAGAGGGCCGAGTAGGA-3 ′ (sense) and 5 ′ -GCAAGGCTCAAGTTGAAACAGGA-3 ′ (antisense) for HAVP1AR; and 5 ′ - CCTGCCACTCCATTTTATCCATC -3 ′ (sense) and 5 ′ CCTAAAAGATGATGGTCTCAGC -3′ (antisense) for HAVP1BR. The resulting products, carrying entire protein-coding sequences of human AVPR1AR and AVP1BR, were treated with ExTaq (Takara, Otsu, Japan) for 10 min at 72ºC and cloned into a pCR2.1-TOPO vector (Invitrogen, Carlsbad, CA, USA) to gain pCHV1AR and pCHV1BR, respectively. Then the 1.4-kb EcoRV (vector)/SpeI (vector) fragment obtained from pCHV1AR and 1.4-kb HindIII (vector)/NotI (vector) fragment from pCHV1BR were ligated to the XbaI/EcoRV-cleaved pcDNA3 (+) (Invitrogen) and NotI/HindIII-cleaved pcDNA3 (+), respectively, to yield respective expression plasmids designated pcDNAHV1AR and pcDNAHV1BR. Cell Culture and Transfection. Human embryonic kidney HEK-293 cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 37 32


Page 33 of 54


1 2 1 3 4 2 5 6 7 3 8 9 4 10 11 5 12 13 14 6 15 16 7 17 18 19 20 8 21 22 9 23 24 25 10 26 27 28 11 29 30 12 31 32 33 13 34 35 36 14 37 38 15 39 40 41 42 16 43 44 45 17 46 47 48 18 49 50 19 51 52 53 20 54 55 56 21 57 58 59 60


°C in a humidified atmosphere of 95% air and 5% CO2.31 Cells were grown in culture dishes to 80 to 90% confluence and transfected with pcDNAHV1AR or pcDNAHV1BR using GeneJuice Transfection Reagent (EMD Millipore, Temecula, CA, USA) following the manufacturer’s instruction. Cells were selected in DMEM supplemented with 5% FBS and 800 g/mL G418 (geneticin; Sigma Chemical Co., St Louis, MO, USA). The resulting transformed cells, as well as HEK-293 cells stably expressing human OXTRs31 and those transfected with pcDNA3 (+) (mock-transfected cells31) were maintained in DMEM supplemented with 10% FBS and 100 g/mL G418. Preparation of Membrane Fraction. Frozen hOTR expressed HEK cells were thawed and suspended in 20 mL of a cold lysis buffer containing 1mM EDTA, 50 mM HEPES, 10 mM MgCl2, pH 7.4, with the addition of complete cocktail of protease inhibitor (Roche Diagnostics) as described previously.66 The cells allowed to swell for 20 min and were homogenized with a teflon-glass homogenizer.67 Intact cells and nuclei pellets were removed by centrifugation at 500 x g for 10 min. at 4°C. The supernatant was then centrifugated at 19,000 rpm for 60 min at 4°C, and the pellet was resuspended in cold lysis buffer and sucrose (10%). This procedure was repeated twice. The final pellet was kept frozen at -80°C with no loss of binding. Binding affinity measurement. Binding for human OTRs was measured by filtration binding using 500 pM [3H]-OT final concentration in binding buffer (50 mM Tris, 10m M MgCl2, and 0.1% BSA (pH 7.4) containing membranes (5 µg per well). Multi-Screen-FC glass-filter containing 96-well plates (Millipore) were used. For total binding measurement 25 µl of binding buffer was added to the respective wells, for nonspecific binding, 25 µL of 12 µM cold OT was added. For compound testing 25 µL of a serial dilution of each compound in binding buffer was 33


Page 34 of 54

added. After compound addition and 1 h of incubation at room temperature, the binding was terminated by rapid filtration under vacuum through GF/C filters66 and washed 5 times with ice-cold binding buffer before counting. Non-specific binding counts were subtracted from each well and data normalized to the maximum specific binding set at 100%.66 Ki values were calculated using Cheng-Prussoff equation.68 Saturation binding experiments were performed in presence of 3H-OT in concentration range from 50 pM up to 4 nM. Non-linear regression analysis by GraphPad prism was performed to obtain Kd value. Additionally, Rosental-Scatchard plot was constructed and did not indicated positive or negative cooperativity. Saturation binding experiments indicated that a single homogenous population of binding sites was being labeled. In all experiments total binding never exceeded 10% of that added, limiting complications associated with depletion of the free radioligand concentration. Saturation and competitive binding experiments, for each compound, were performed 2 times, each experiment in duplicated. OTR kinetics. To determine the Kon, Koff and Kobs were calculated at three different concentrations of 3H-OT (200 pM, 500 pM, 1 nM). The experiment was initiated by the addition of 3H-OT to membranes in binding buffer. Free 3H-OT was separated at multiple time points to construct association kinetic curves. After incubation, bound was separated from free by rapid filtration. Washing and counting were performed as described previously. Hill equation was used to determine to determine Kon and Koff. The t1/2 was calculated by equation Koff = ln2/t1/2. For evaluation of kinetic parameters of tested compounds competitive kinetics experiments were obtained.62,68 Similliar procedure as described above was performed with addition of test

34


Page 35 of 54 1 2 1 3 4 5 2 6 7 8 9 3 10 11 4 12 13 14 5 15 16 17 6 18 19 7 20 21 22 8 23 24 25 9 26 27 10 28 29 30 11 31 32 33 12 34 35 36 13 37 38 14 39 40 41 15 42 43 44 16 45 46 17 47 48 49 18 50 51 52 53 19 54 55 20 56 57 58 59 60


compounds in three concentrations (app. Ki, 5 Ki and 10 Ki). All experiments were performed 2 times, each duplicated. [Ca2+]i Measurement. The method was previously described.69 Briefly, transfected HEK-293 cells were loaded with fura-2/AM to a final concentration of 1 µM in complete medium and incubated at 37 °C. After 30-min loading, the cells were washed three times with HEPESbuffered saline (HBS) solution (145 mM NaCl, 5 mM KCl, 1 mM MgCl2, 20 mM HEPES-NaOH, 2 mM CaCl2, 20 mM glucose, pH 7.4). The fluorescence of the cells loaded with fura-2/AM was then measured at 37 °C, at the determined sites, through a pinhole (10–20 µm in diameter). We used alternating excitation wavelengths of 340 and 380 nm in a Ca2+ microspectrofluorometric system (IX-73 Model; Olympus, Tokyo, Japan) and Metafluor software (Molecular Devices, Sunnyvale, CA). The Ca2+ emission was detected every 3 sec for 5 min after application of PBS, OT, AVP or analogues. The ratio of fluorescence at 340 nm and 380 nm (F340/F380) was used to determine [Ca2+]i. All data were normalized to the baseline fluorescence (F0) recorded 10 s before application of compounds and given as percentage from the maximum response obtained by OT for hOTRs, AVP for hV1ARs and hV1BRs. OT, AVP and analogues for experiments were diluted in 50% ethanol to a concentration of 10-3 M and then diluted in distilled water to obtain the required concentrations. Each experiment was performed 3 times, each triplicated. Animals. Male and female Slc:ICR mice (Institute of Cancer Research of the Charles River Laboratories, Inc., Wilmington, MA, USA) were obtained from Japan SLC, Inc. (Hamamatsu, 35


Journal of Medicinal Chemistry 1 2 1 3 4 5 2 6 7 8 3 9 10 4 11 12 13 5 14 15 16 6 17 18 7 19 20 21 8 22 23 24 9 25 26 10 27 28 29 11 30 31 32 12 33 34 35 13 36 37 14 38 39 40 15 41 42 43 16 44 45 17 46 47 48 18 49 50 51 19 52 53 20 54 55 56 21 57 58 59 60

Page 36 of 54

Japan) through a local distributor (Sankyo Laboratory Service Corporation, Toyama, Japan). The procedure to produce the CD38 KO mice was described previously.20 CD38KOCC were produced as follows: The candidate sgRNA was designed to target exon 2 of the Cd38 locus by using CRISPR Design. The sgRNA nucleotides were then inserted to pX330 (addgene), which is the human codon-optimized SpCas9 and chimeric gRNA expression plasmid. For RNA synthesis, the human codon-optimized SpCas946 and chimeric sgRNA were excised from pX330, then placed downstream of the T7 promoter in the pCMV TNT vector (Promega). Then, the hCas9 mRNA and chimeric sgRNA were synthesized using an in vitro RNA transcription kit (mMESSAGE mMACHINE T7 Transcription Kit), according to the manufacturer’s instructions. The synthesized mRNA and sgRNA were dissolved in Opti-MEM I at 1-2 μg/μL and introduced them into eggs using a super electroporator NEPA 21 (NEPA GENE). After DNA isolation from mouse tails in the F0 generation, we amplified the genomic regions spanning the sgRNA binding site using PCR. Then we screened more than 30 pups by using Guide-it Mutation detection Kit (TAKARA). Finally, we identified a pup which possessed a mutation with an insertion of 2 base pairs. This insertion leads to premature stop codons within the open reading frame of the Cd38 gene. The ideal end result is a loss-of-function mutation within the Cd38 gene. The offspring of wild-type, CD38KO and CD38KOCC mice were born in our laboratory colony. The pups were weaned at 21–28 days of age and housed in same-sex groups of five animals until pairing. A male and female of each genotype were paired and housed in a nursing cage in our laboratory under standard conditions (24 °C; 12 h light/dark cycle, lights on at 08:00) with food and water provided ad libitum. All animal experiments were 36


Page 37 of 54


1 2 1 3 4 5 2 6 7 8 3 9 10 4 11 12 13 5 14 15 16 17 6 18 19 7 20 21 22 8 23 24 25 9 26 27 10 28 29 30 11 31 32 33 12 34 35 36 13 37 38 14 39 40 41 15 42 43 44 16 45 46 17 47 48 49 18 50 51 52 19 53 54 20 55 56 57 21 58 59 60


performed in accordance with the Fundamental Guidelines for the Proper Conduct of Animal Experiments and Related Activities in Academic Research Institutions under the jurisdiction of the Ministry of Education, Culture, Sports, Science, and Technology of Japan and were approved by the Committee on Animal Experimentation of Kanazawa University (Ethics Approval Code AP-173824). Parental Retrieval Test. The design of the experiments for parental retrieval behavior was described previously. 21,22 Virgin males and females of identical genotypes were paired at 56–64 days. A single male and a single female were continuously housed together in a standard mouse maternity cage from the mating period to the delivery of pups and then to postnatal days 3–5. All family units consisted of a new sire and dam, and their first litter of each genotype was used. All mice were experimentally naive. Thirty minutes before starting the experiment, the cages with the families were placed in the experimental room for habituation. The sire and dam were placed in a new clean cage with new woodchip bedding for 10 min, while the pups were left in the nest in the original cage. Five pups were randomly selected from the litter and placed individually at a site remote from the nest in the original cage. The sires were returned to the original home cage in the presence of their five biological pups to assess parental behavior. Parental retrieval behavior (latency to retrieve the first pup to the nest) was measured by observing the parent behavior for 10 min following the reunion. The sire received a single intraperitoneal injection of 0.3 mL of phosphate-buffered saline (PBS) or 0.3 mL of OT (1 mL per 100 g of body weight), compounds 2 or 5 at a concentration of 100 ng/mL dissolved in PBS. Thirty minutes, 6, 12, 24 or 48 h after the injection, paternal retrieval behavior was examined 37


Page 38 of 54

only once. The behavioral tests were carried out in a randomly mixed sequence of the experimental groups. For each time-point and each compound 10 mice were used. The experiments were performed between 10:00 and 15:00. For each time-point. One-way ANOVA test was performed for comparison compound effects for 30 min. If ANOVA-test shown significance followed Bonferroni’s post-hoc test was performed. Two-way ANOVA followed by Bonferroni’s post hoc test was performed for time-course. Tail Suspension. The tail suspension test method was previously described.22 After 30 minutes of habituation in the experimental room, the WT and CD38KOCC mice were injected i.p. with 0.3 mL of PBS or OT at a concentration of 100 ng/mL dissolved in PBS. Thirty minutes after the injection, the mice were hanged by fixing their tails by tape to the suspension bar in a plastic suspension box (55 cm height X 60 cm width X 11.5 cm depth). To prevent observing or interacting with each mouse, the mouse was separated with walls but was not able contact or touch to the walls. Behavior was recorded for 6 minutes on video-source and was analyzed using ANY-Maze behavioral tracking software (Stoelting Co, USA). Total immobility time during the last 4 of the 6 minutes was used. Number of animals for test: n = 8 for compound 2, 30 min; n = 6 for compound 5, 30 min; n = 5 for all other groups. Two-way ANOVA test was performed. If ANOVA-test shown significance followed Bonferroni’s posthoc test was performed. Sucrose Preference. Experimentally naïve, young male adult mice (6–8 weeks old) of WT and CD38KOCC strains were given a two-bottle choice between distilled water and sucrose solution at a 1% concentration based on our previous results,21 which were both available ad libitum. The bottle positions remained constant. Fresh sucrose solution was prepared each day. Cumulative water and sucrose intakes during 24 hours were calculated by weighing. Food was provided ad libitum, but food intake was not 38


Page 39 of 54


1 2 1 3 4 2 5 6 7 3 8 9 10 11 4 12 13 14 5 15 16 6 17 18 19 7 20 21 22 8 23 24 9 25 26 27 10 28 29 30 31 11 32 33 12 34 35 36 13 37 38 39 14 40 41 42 15 43 44 16 45 46 47 17 48 49 50 18 51 52 19 53 54 55 20 56 57 58 59 60


recorded in this experiment. Number of animals: n = 8 for PBS-treated group; n = 5 for all other groups. One-way ANOVA test was performed for 60 minutes and 24 hours comparison independently. If ANOVA-tests showed significance, the Bonferroni’s post-hoc test was performed. Dosing and Sampling. Male ICR mice weighing 30 g were used. OT, 2 or 5 was injected intravenously at a dose of 100 ng/g of body weight. Mice were sacrificed using i.p. injection of 10% somnopenthyl (0.6 mL) immediately, at 5, 15, and 30 min after the end of the injection and blood samples were collected by cardiac puncture. CSF was collected 30 minutes or 12 hours after injection. Plasma and CSF levels of OT and compound 2 and 5 were determined by LC/MS/MS. OT level after administration of not only OT but also compound 2 and 5 was determined. Analysis of the Compounds in Plasma and CSF. 100 µL of plasma was deproteinized by adding 400 μL of acetonitrile/methanol = 1:1 (v/v) containing the internal standard [13C6, 15N]OT. The mixture was vortexed and centrifuged at 15,000 x g for 10 minutes at room temperature. The resultant supernatant was transferred to another 1.5 mL polypropylene tube and evaporated to dryness under a nitrogen gas stream at 40°C. The residue was reconstituted in 50 μL of mobile phase, and 2 μL aliquots were injected into the LC/MS/MS system. Chromatographic separation was performed using a Shimadzu Nexera high-performance liquid chromatography system (Shimadzu, Kyoto) with a CAPCELL PAK C8DD column (50 mm x 2.0 mm i.d., 5 mm; Shiseido) and the analytical column was kept at 40 °C. The mobile phase consisted of solution A (10 mM ammonium formate in water) and solution B

39


Page 40 of 54

(acetonitrile), which formed the following gradient: 15%–30% B (0–3 minutes); 30%–90% B (3–5 minutes); 90% B (5–7 minutes); and 15% B (7–12 minutes). The flow rate was 0.3 mL/min. Positive ion electrospray (ESI) tandem mass spectrometric analysis was performed using a TSQ Vantage EMR LC/MS/MS System (Thermo Scientific, Waltham, MA) at unit resolution with selected reaction monitoring. The transitions by selected reaction monitoring were m/z 1007.5→ 723.2 for OT, m/z 1075.2 → 723.2 for compound 2, m/z 1025.2 → 723.2 for compound 5, and m/z 1014.4 → 730.1 for internal standard. Data was acquired and analyzed using Xcalibur software (version 2.1; Thermo Scientific). The calibration curves were constructed by spiking the ten different concentrations of analytes with the mouse plasma pool. The calibration curves for OT and compound 5; compound 2; were all linear in the ranges 0.005–150 ng/mL; 0.015–150 ng/mL, respectively. The calibration curves were obtained by linear regression for all analytes with a weighting factor of 1/x and linearity (R) of the method in surrogate is greater than 0.998. The detection limits of OT, compound 2, and compound 5 were 0.05, 0.15, and 0.05 pg/mL, respectively. Stability Assay. One hundred μL of pooled mouse plasma containing OT, compound 2, or compound 5 (final concentration: 50 ng/mL) was incubated for 1, 5, 15, 30, 60, 120 min at 37 °C. After designated time, 400 μL of acetonitrile/methanol = 1:1 (v/v) containing the internal standard was added and analyzed by LC/MS/MS.

ASSOCIATED CONTENT Supporting Information 40


Page 41 of 54


1 2 1 3 4 5 2 6 7 8 3 9 10 4 11 12 13 14 5 15 16 17 6 18 19 7 20 21 22 8 23 24 25 9 26 27 28 10 29 30 31 32 11 33 34 35 12 36 37 13 38 39 40 41 14 42 43 44 15 45 16 46 47 48 17 49 18 50 51 52 19 53 54 55 56 20 57 58 59 60


The Supporting Information is available free of charge on the ACS Publications website. Data on [3H]OT binding to membranes from hOTR-expressing HEK293 cells, comparison of wild type, CD38KO and CD38KOCC mice in tail suspended and sucrose preference tests, and characterization of the kinetic parameters of [3H]OT. (PDF) Molecular formula strings (CSV)

AUTHOR INFORMATION Corresponding Author Phone & Fax: +81-76-234-4213 (H.H.); +81-11-706-3769 (S.S.). E-mail: [email protected], [email protected] Present Addresses †W.I. moved to Graduate School of Pharmaceutical Sciences, Tohoku University, Aramakiaza Aoba 6-3, Aoba-ku, Sendai 980-8578, Japan Author Contributions I. and S. M. C. contributed equally to this work. The manuscript was written with contributions of all authors. All authors gave approval to the final version of the manuscript. #W.

Notes The authors declare no competing financial interest. ACKNOWLEDGMENTS 41


Page 42 of 54

This work was supported by the Industry-Academia Collaborative R & D Programs (COI) from the Ministry of Education, Culture, Sports, Science, and Technology of Japan and partly by Platform Project for Supporting Drug Discovery and Life Science Research (BINDS) from AMED under Grant Number JP18am0101093. W.I. acknowledged the support of JSPS program (15J02083). ABBREVIATIONS USED ANOVA, analysis of variance; ASD, autism spectrum disorder; CD, cluster of differentiation; CRISPR, clustered regularly interspaced short palindromic repeats; CSF, cerebrospinal fluid; DIC, diisopropylcarbodiimide; HEK, human embryonic kidney; HOAt, 1-hydroxy-7azabenzotriazole; 5-HT3, 5-hydroxytryptamine type 3 receptor; KO, knock out; LOT, lipooxytocin; OT, oxytocin; OTR, oxytocin receptor; pNz, para-nitrobenzyloxycarbonyl; PyBOP, benzotriazol-1-yl-oxytripyrrolidinophosphosphate hexafluorophosphate; RP-HPLC, reverse phase high-performance liquid chromatography; TIS, triisopropylsilane; Trt, trityl; VR, vasopressin receptor; V1aR, vasopressin type 1a receptor; V1bR, vasopressin type 1b receptor; V2R, vasopressin type 2 receptor; WT, wild type.

REFERENCES (1) Kirsch, P. Oxytocin in the socioemotional brain: implications for psychiatric disorders. Dialogues Clin. Neurosci. 2015, 17, 463–476.

42


Page 43 of 54 1 2 1 3 4 2 5 6 7 3 8 9 4 10 11 5 12 13 14 6 15 16 7 17 18 8 19 20 21 9 22 23 24 10 25 26 27 11 28 29 12 30 31 32 33 13 34 35 14 36 37 38 15 39 40 41 42 16 43 44 17 45 46 47 18 48 49 19 50 51 52 20 53 54 55 21 56 57 22 58 59 60


(2) Bealer, S.L.; Armstrong, W.E.; Crowley, W.R. Oxytocin release in magnocellular nuclei: neurochemical mediators and functional significance during gestation. Am. J. Physio.l Regul. Integr. Comp. Physio.l 2010, 299, R452-R458. (3) Rilling, J.K.; Young, L.J. The biology of mammalian parenting and its effect on offspring social development. Science 2014, 345, 771-776 (4) Marlin, B.J.; Froemke, R.C. Oxytocin modulation of neural circuits for social behavior. Dev. Neurobiol. 2017,77,169-189. (5) Lai, M.-C.; Lombardo, M. V.; Baron-Cohen, S. Autism. Lancet 2014, 383, 896–910. (6) Peñagarikano, O. New therapeutic options for autism spectrum disorder: experimental evidences. Exp. Neurobiol. 2015, 24, 301–311. (7) Lacivita, E.; Perrone, R.; Margari, L.; Leopoldo, M. Targets for drug therapy for autism spectrum disorder: challenges and future directions. J. Med. Chem. 2017, 60, 9114–9141. (8) James, B. J.; Gales, M. A.; Gales, B. J. Bumetanide for autism spectrum disorder in children: A review of randomized controlled trial Ann. Pharmacother. 2018, 52, in press, doi: 10.1177/1060028018817304 (9) Tsoory, S.; Young, L. J. Understanding the oxytocin system and its relevance to psychiatry. Biol. Psychiatry 2016, 79, 150-152. (10)

Alabdali, A., A.;-Ayadhi, L., E.;-Ansary, A. Association of social and cognitive impairment and

biomarkers in autism spectrum disorders. J. Neuroinflammation. 2014, 11: 4. (11)

Feldman, R.; Zagoory-Sharon, O.; Weisman, O.; Schneiderman, I.; Gordon, I.; Maoz, R.; Shalev,

I.; Ebstein, R. P. Sensitive parenting is associated with plasma oxytocin and polymorphisms in the OXTR and CD38 genes. Biol. Psychiatry 2012, 72, 175-181. 43



(12)

Page 44 of 54

LoParo, D.; Waldman, I. D. The oxytocin receptor gene (OXTR) is associated with autism

spectrum disorder: a meta-analysis. Mol. Psychiatry 2015, 20, 640–646. (13)

Jin, D.; Liu, H.-X.; Hirai, H.; Torashima, T.; Nagai, T.; Lopatina, O.; Shnayder, N. A.; Yamada,

K.; Noda, M.; Seike, T.; Fujita, K.; Takasawa, S.; Yokoyama, S.; Koizumi, K.; Shiraishi, Y.; Tanaka, S.; Hashii, M.; Yoshihara, T.; Higashida, K.; Islam, M. S.; Yamada, N.; Hayashi, K.; Noguchi, N.; Kato, I.; Okamoto, H.; Matsushima, A.; Salmina, A.; Munesue, T.; Shimizu, N.; Mochida, S.; Asano, M.; Higashida, H. CD38 is critical for social behaviour by regulating oxytocin secretion. Nature 2007, 446, 41–45. (14)

Lopatina, O.; Yoshihara, T.; Nishimura, T.; Zhong, J.; Akther, S.; Fakhrul, A. A.; Liang, M.;

Higashida, C.; Sumi, K.; Furuhara, K.; Inahata, Y.; Huang, J. J.; Koizumi, K.; Yokoyama, S.; Tsuji, T.; Petugina, Y.; Sumarokov, A.; Salmina, A.B.; Hashida, K.; Kitao, Y.; Hori, O.; Asano, M.; Kitamura, Y.; Kozaka, T.; Shiba, K.; Zhong, F.; Xie, M. J.; Sato, M.; Ishihara, K.; Higashida, H. Anxiety- and depression-like behavior in mice lacking the CD157/BST1 gene, a risk factor for Parkinson's disease. Front. Behav. Neurosci. 2014, 8, Article 133.

(15)

Higashida, H.; Yuhi, T.; Akther, S.; Amina, S.; Zhong, J.; Liang, M.; Nishimura, T.; Liu, H.-X.;

Lopatina, O. Oxytocin release via activation of TRPM2 and CD38 in the hypothalamus during hyperthermia in mice: implication for autism spectrum disorder. Neurochem. Int. 2017, 113, 42–48. (16)

Higashida, H.; Liang, M.; Yoshihara, T.; Akther, S.; Fakhrul, A.; Cherepanov, S.; Nam, T.S.;

Kim, U.H.; Kasai, S.; Nishimura, T.; Mahmuda, N.; Yokoyama, S.; Ishihara, K.; Gerasimenko, M.; Salmina, A.; Zhong, J.; Tsuji, T.; Tsuji, C.; Lopatina, O. An immunohistochemical, enzymatic, and behavioral study of CD157/BST-1 as a neuroregulator. BMC Neurosci. 2017, 18:35.

44


Page 45 of 54 1 2 1 3 4 2 5 6 7 3 8 9 4 10 11 5 12 13 14 6 15 16 7 17 18 8 19 20 9 21 22 23 10 24 25 11 26 27 12 28 29 30 31 13 32 33 14 34 35 36 15 37 38 39 40 16 41 42 17 43 44 18 45 46 47 48 19 49 50 20 51 52 21 53 54 55 22 56 57 58 59 60


(17)

Munesue, T.; Yokoyama, S.; Nakamura, K.; Anitha, A.; Yamada, K.; Hayashi, K.; Asaka, T.; Liu,

H. X.; Jin, D.; Koizumi, K.; Islam, M. S.; Huang, J. J.; Ma, W. J.; Kim, U.H.; Kim, S. J.; Park, K.; Kim, D.; Kikuchi, M.; Ono, Y.; Nakatani, H.; Suda, S.; Miyachi, T.; Hirai, H.; Salmina, A.; Pichugina, Y. A.; Soumarokov, A. A.; Takei, N.; Mori, N.; Tsuji, M.; Sugiyama, T.; Yagi, K.; Yamagishi, M.; Sasaki, T.; Yamasue, H.; Kato, N.; Hashimoto, R.; Taniike, M.; Hayashi, Y.; Hamada, J.; Suzuki, S.; Ooi, A.; Noda, M.; Kamiyama, Y.; Kido, M. A.; Lopatina, O.; Hashii, M.; Amina, S.; Malavasi, F.; Huang, E. J.; Zhang, J.; Shimizu, N.; Yoshikawa, T.; Matsushima, A.; Minabe, Y.; Higashida, H.; Two genetic variants of CD38 in subjects with autism spectrum disorder and controls. Neurosci. Res. 2010, 67, 181-191. (18)

Yokoyama, S.; Al Mahmuda, N.; Munesue, T.; Hayashi, K.; Yagi, K.; Yamagishi, M.; Higashida,

H. Association study between the CD157/BST1 gene and autism spectrum disorders in a Japanese population. Brain Sci. 2015, 5, 188-200. (19)

Kato, I.; Yamamoto, Y.; Fujiwara, M.; Noguchi, N.; Takasawa, S.; Okamoto, H. CD38

disruption impairs glucose-induced increases in cyclic ADP-ribose, [Ca2+], and insulin secretion. J. Biol. Chem. 1999, 274, 1869-1872. (20)

Higashida, H.; Yokoyama, S.; Munesue, T.; Kikuchi, M.; Minabe, Y.; Lopatina, O. CD38 gene

knockout juvenile mice: a model of oxytocin signal defects in autism. Biol. Pharm. Bull. 2011, 34, 1369–1372. (21)

Akther, S.; Korshnova, N.; Zhong, J.; Liang, M.; Cherepanov, S. M.; Lopatina, O.; Komleva, Y.

K.; Salmina, A. B.; Nishimura, T.; Fakhrul, A. A.; Hirai, H.; Kato, I.; Yamamoto, Y.; Takasawa, S.; Okamoto, H.; Higashida, H. CD38 in the nucleus accumbens and oxytocin are related to paternal behavior in mice. Mol. Brain. 2013, 6, 41.

45


Journal of Medicinal Chemistry 1 2 1 3 4 2 5 6 7 3 8 9 10 4 11 12 5 13 14 15 6 16 17 7 18 19 8 20 21 9 22 23 24 10 25 26 11 27 28 12 29 30 31 13 32 33 14 34 35 15 36 37 38 16 39 40 17 41 42 18 43 44 19 45 46 47 20 48 49 21 50 51 22 52 53 54 23 55 56 24 57 58 59 60

(22)

Page 46 of 54

Cherepanov, S. M.; Akther, S.; Nishimura T.; Shabalova, A. A.; Mizuno, A.; Ichinose, W.; Shuto

S.; Yamamoto, Y.; Yokoyama, S.; Higashida, H. Effects of three lipidated oxytocin analogs on behavioral deficits in CD38 knockout mice. Brain Sci. 2017, 7, 132. (23)

Domes, G.; Heinrichs, M.; Kumbier, E.; Grossmann, A.; Hauenstein, K.; Herpertz, S. C. Effects

of intranasal oxytocin on the neural basis of face processing in autism spectrum disorder. Biol. Psychiatry 2013. 74, 164-171

(24)

Auyeung, B.; Lombardo, M. V.; Heinrichs, M.; Chakrabarti, B.; Sule, A.; Deakin, J. B. Oxytocin

increases eye contact during a real-time, naturalistic social interaction in males with and without autism. Transl. Psychiatry, 2015. 5, e507.

(25)

Dadds, M. R.; MacDonald, E.; Cauchi, A.; Williams, K.; Levy, F.; Brennan, J. Nasal oxytocin for

social deficits in childhood autism: a randomized controlled trial. J. Autism Dev. Disord. 2014, 44, 521-531 (26)

Guastella, A. J.; Gray, K. M.; Rinehart, N. J.; Alvares, G. A.; Tonge, B. J.; Hickie, I. B.; Keating,

C. M.; Cacciotti-Saija, C.; Einfeld, S. L. The effects of a course of intranasal oxytocin on social behaviors in youth diagnosed with autism spectrum disorders: a randomized controlled trial. J. Child Psychol. Psychiatry 2015, 56, 444-452. (27)

Munesue, T.; Nakamura, H.; Kikuchi, M.; Miura, Y.; Takeuchi, N.; Anme, T.; Nanba, E.; Adachi,

K.; Tsubouchi, K.; Sai, Y.; Miyamoto, K.; Horike, S.; Yokoyama, S.; Nakatani, H.; Niida, Y.; Kosaka, H.; Minabe, Y.; Higashida, H. Oxytocin for male subjects with autism spectrum disorder and comorbid intellectual disabilities: a randomized pilot study. Front. Psychiatry 2016, 7, article 2. (28)

Parker, K. J.; Oztan, O.; Libove, R. A.; Sumiyoshi, R. D.; Jackson, L.P.; Karhson, D. S.; Summers,

J. E.; Hinman, K. E.; Motonaga, K. S.; Phillips, J. M.; Carson, D. S.; Garner, J. P.; Hardan, A. Y. 46


Page 47 of 54 1 2 1 3 4 2 5 6 7 3 8 9 4 10 11 5 12 13 14 6 15 16 7 17 18 8 19 20 9 21 22 23 24 10 25 26 11 27 28 12 29 30 31 13 32 33 34 14 35 36 15 37 38 39 16 40 41 17 42 43 18 44 45 19 46 47 48 49 20 50 51 52 21 53 54 22 55 56 57 58 59 60


Intranasal oxytocin treatment for social deficits and biomarkers of response in children with autism. Proc. Natl. Aca. Sci. USA, 2017, 114, 8119-8124. (29)

Yatawara, C. J.; Einfeld, S. L.; Hickie, I. B.; Davenport, T. A.; Guastella, A. J. The effect of

oxytocin nasal spray on social interaction deficits observed in young children with autism: a randomized clinical crossover trial. Mol. Psychiatry, 2016, 21, 1225-1231. (30)

Mizuno, A.; Cherepanov, S. M.; Kikuchi, Y.; Fahrul, A. AKM; Akther, S.; Deguchi, K.;

Yoshihara, T.; Ishihara, K.; Shuto, S.; Higashida, H. Lipo-oxytocin-1, a novel oxytocin Analog conjugated with two palmitoyl groups, has long-lasting effects on anxiety-related behavior and social avoidance in CD157 knockout mice. Brain Sci. 2015, 5, 3–13. (31)

Cherepanov, S. M.; Yokoyama, S.; Mizuno, A.; Ichinose, W.; Lopatina, O.; Shabalova, A. A.;

Salmina, A. B.; Yamamoto, Y.; Okamoto, H.; Shuto, S.; Higashida, H. Structure-specific effects of lipidated oxytocin analogs on intracellular calcium levels, parental behavior, and oxytocin concentrations in the plasma and cerebrospinal fluid in mice. Pharm. Res. Per. 2017, 5, e00290. (32)

Widmer, M.; Piaggio, G.; Nguyen, T. M. H.; Osoti, A.; Owa, O. O.; Misra, S.; Coomarasamy, A.;

Abdel-Aleem, H.; Mallapur, A. A.; Qureshi, Z.; Lumbiganon, P.; Patel, A. B.; Carroli, G.; Fawole, B.; Goudar, S. S.; Pujar, Y. V.; Neilson, J.; Hofmeyr, G. J.; Su, L. L.; Ferreira de Carvalho, J.; Pandey, U.; Mugerwa, K.; Shiragur, S. S.; Byamugisha, J. Giordano, D.; Gülmezoglu, A. M.; WHO CHAMPION Trial Group. Heat-stable carbetocin versus oxytocin to prevent hemorrhage after vaginal birth. N. Engl. J. Med. 2018, 379, 743-752.

(33)

Adachi, Y.; Sakimura, K.; Shimizu, Y.; Nakayama, M.; Terao, Y.; Yano, T.; Asami, T. Potent

and selective oxytocin receptor agonists without disulfide bridges. Bioorg. Med. Chem. Lett. 2017, 27, 2331–2335.

47



(34)

Page 48 of 54

Muttenthaler has reported that the transformation at the disulfide linker was also important for

modulating the OT potency and deamination at Cys1 residue to earn the chemical stability and hydrophobicity: see ref. 35. (35)

Muttenthaler, M.; Andersson, A.; De Araujo, A. D.; Dekan, Z.; Lewis, R. J.; Alewood, P. F.

Modulating oxytocin activity and plasma stability by disulfide bond engineering. J. Med. Chem. 2010, 53, 8585–8596. (36)

De Araujo, A. D.; Mobli, M.; Castro, J.; Harrington, A. M.; Vetter, I.; Dekan, Z.; Muttenthaler,

M.; Wan, J.; Lewis, R. J.; King, G. F.; Brierley, S. M.; Alewood, P. F. Selenoether oxytocin analogues have analgesic properties in a mouse model of chronic abdominal pain. Nat. Commun. 2014, 5, 3165. (37)

Muttenthaler, M.; Andersson, A.; Vetter, I.; Menon, R.; Busnelli, M.; Ragnarsson, L.; Bergmayr,

C.; Arrowsmith, S.; Deuis, J. R.; Chiu, H. S.; Palpant, N. J.; O’Brien, M.; Smith, T. J.; Wray, S.; Neumann I. D.; Gruber, C. W.; Lewis, R. J.; Alewood, P. F. Subtle modifications to oxytocin produce ligands that retain potency and improved selectivity across species. Sci. Signal. 2017, 10, eaan3398. (38)

Scibola, S.; Goetz, G. H.; Bai, G.; Rogers, B. N.; Gray, D. L.; Duplantier, A.; Fonseca, K. R.;

Vanase-Frawley, M. A.; Kablaoui, N. M. Systematic N-methylation of oxytocin: Impact on pharmacology and intramolecular hydrogen bonding network. Bioorg. Med. Chem. 2016, 24, 3513– 3520. (39)

Modi, M. E.; Majchrzak, M. J.; Fonseca, K. R.; Doran. A.; Osgood, S.; Vanase-Frawley, M.;

Feyfant, E.; Mclnnes, H.; Darvari, R.; Buhl, D. L.; Kablaoui, N. M. Peripheral administration of a long-acting peptide oxytocin receptor agonist inhibits fear-induced freezing. J. Pharmcol. Exp. Ther. 2016, 358, 164–172. 48


Page 49 of 54 1 2 1 3 4 2 5 6 7 3 8 9 4 10 11 12 5 13 14 15 6 16 17 7 18 19 20 8 21 22 9 23 24 25 26 10 27 28 11 29 30 12 31 32 33 34 13 35 36 14 37 38 15 39 40 41 42 16 43 44 45 17 46 47 48 18 49 50 19 51 52 53 54 20 55 56 21 57 58 59 60


(40)

Ring, R. H.; Schechter, L. E.; Leonard, S. K.; Dwyer, J. M.; Platt, B. J.; Graf, R.; Grauer, S.;

Pulicicchio, C.; Resnick, L.; Rahman, Z.; Sukoff Rizzo, S. J.; Luo, B.; Beyer, C. E.; Logue, S. F.; Marquis, K. L.; Hughes, Z. A.; Rosenzweig-Lipson, S. Receptor and behavioral pharmacology of WAY-267464, a non-peptide oxytocin receptor agonist. Neuropharmacol. 2010, 58, 69–77. (41)

Engstøm, T.; Barth T.; Melin. P.; Vilhardt, H. Oxytocin receptor binding and uterotonic activity of

carbetocin and its metabolites following enzymatic degradation. Eur. J. Pharmcol. 1998, 355, 203– 210. (42)

Rath, W. Revention of postpartum haemorrhage with the oxytocin analogue carbetocin. Eur. J.

Obstet. Gyne. Reprod. Biol. 2009, 147, 15–20. (43)

Wiśniewski, K.; Alagarsamy, S.; Galyean, R.; Tariga, H.; Thompson, D.; Ly, B.; Wiśniewski, H.;

Qi, S.; Croston, G.; Laporte, R.; Rivière, P. J.-M.; Schteingart, C. D. New, potent, and selective peptidic oxytocin receptor agonists. J. Med. Chem. 2014, 57, 5306–5317. (44)

ClinicalTrials.gov, NIH,

https://www.clinicaltrials.gov/ct2/show/NCT02545127?lead=ferring&gndr=Female&phase=01&rank =5 (45)

Wellings, D. A; Atherton, E. A. Standard Fmoc protocol. Methods Enzymol. 1997, 289. 44-67.

(46)

Hsu, P. D.; Scott, D. A.; Weinstein, J. A.; Ran, F. A.; Konermann, S.; Agarwala, V.; Li, Y.; Fine,

E. J.; Wu, X.; Shalem, O.; Cradick, T. J.; Marraffini, L. A.; Bao, G.; Zhang, F. DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechnol. 2013, 31, 827–832

(47)

Motulsky, H. J.; Mahan, L. C. The kinetics of competitive radioligand binding predicted by the

law of mass action. Mol. Pharmacol. 1984, 25, 1-9. 49



(48)

Page 50 of 54

Ihara, M.; Matsuda, K.; Shimomura, M.; Sattelle, D. B.; Komai, K. Super agonist actions of

clothianidin and related compounds on the SAD2 nicotinic acetylcholine receptor expressed in Xenopus laevis oocytes. Biosci. Biotechnol. Biochem. 2004, 68, 761–763. (49)

Brown, L. A.; Ihara, M.; Buckingham, S. D.; Matsuda, K.; Sattelle, D. B. Neonicotinoid

insecticides display partial and super agonist actions on native insect nicotinic acetylcholine receptors. J. Neurochem. 2006, 99, 608–615. (50)

Engel, S.; Neumann, S.; Kaur, N.; Monga, V.; Jain, R.; Northup, J.; Gershengorn, M. C.

Thyrotropin-releasing hormone receptors: J. Biol. Chem. 2006, 281, 13103–13109. (51)

Langmead, C. J.; Christopoulos, A. Supra-physiological efficacy at GPCRs: superstition or super

agonists? Br. J. Pharmacol. 2013, 169, 353–356. (52)

Alix, K.; Khatri, S.; Mosier, P. D.; Casterlow, S.; Yan, D.; Nyce, H. L.; White, M. M.; Schulte,

M. K.; Dukat, M. Superagonist, full agonist, partial agonist, and antagonist actions of arylguanidines at 5-hydroxytryptamine-3 (5-HT3) subunit A receptors. ACS Chem. Neurosci. 2016, 7, 1565–1574. (53)

Rosethorne, E. M.; Bradley, M. E.; Gherbi, K.; Sykes, D. A.; Sattikar, A.; Wright, J. D.; Renard,

E.; Trifilieff, A.; Fairhurst, R. A.; Charlton, S. J. Long receptor residence time of C26 contributes to super agonist activity at the human β2-receptor. Mol. Pharmacol. 2016, 89, 467–475. (54)

Müller, K.; Faeh, C.; Diederich, F. Fluorine in pharmaceuticals: looking beyond intuition. Science

2007, 317, 1881–1886. (55)

Vulpetti, A.; Dalvit, C. Fluorine local environment: from screening to drug design. Drug Discov.

Today 2012, 17, 890–897. (56)

Liu, H. X.; Lopatina, O.; Higashida, C.; Fujimoto, H.; Akther, S.; Inzhutova, A.; Liang, M.; 50


Page 51 of 54 1 2 1 3 4 2 5 6 7 3 8 9 4 10 11 5 12 13 14 15 6 16 17 7 18 19 20 21 8 22 23 9 24 25 10 26 27 28 11 29 30 31 12 32 33 13 34 35 14 36 37 38 15 39 40 41 16 42 43 17 44 45 46 47 18 48 49 19 50 51 20 52 53 54 55 21 56 57 22 58 59 60


Zhong, J.; Tsuji, T.; Yoshihara, T.; Sumi, K.; Ishiyama, M.; Ma, W. J.; Ozaki, M.; Yagitani, S.; Yokoyama, S.; Mukaida, N.; Sakurai, T.; Hori, O.; Yoshioka, K.; Hirao, A.; Kato, Y.; Ishihara, K.; Kato, I.; Okamoto, H.; Cherepanov, S. M.; Salmina, A. B.; Hirai, H.; Asano, M.; Brown, D. A.; Nagano, I.; Higashida, H. Displays of paternal mouse pup retrieval following communicative interaction with maternal mates. Nat. Commun. 2013, 4, 1346.

(57)

Gutkowska, J.; Jankowski, M. Oxytocin revisited: its role in cardiovascular regulation. J.

Neuroendocrinol. 2012, 24, 599-608. (58)

Lopatina, O.; Liu, H.X.; Amina, S.; Hashii, M.; Higashida, H. Oxytocin-induced elevation of

ADP-ribosyl cyclase activity, cyclic ADP-ribose or Ca(2+) concentrations is involved in autoregulation of oxytocin secretion in the hypothalamus and posterior pituitary in male mice. Neuropharmacology 2010, 58, 50-55. (59)

Moy, S.S.; Teng, B.L.; Nikolova, V.D.; Riddick, N.V.; Simpson, C.D.; Van Deusen, A.; Janzen,

W.P.; Sassano, M.F.; Pedersen, C.A.; Jarstfer, M.B. Prosocial effects of an oxytocin metabolite, but not synthetic oxytocin receptor agonists, in a mouse model of autism. Neuropharmacology 2019, 144, 301-311. (60)

Grinevich, V.; Knobloch-Bollmann, H.S.; Eliava, M.; Busnelli, M.; Chini, B. Assembling the

puzzle: Pathways of oxytocin signaling in the brain. Biol. Psychiatry. 2016, 79, 155-164. (61)

Dowling, M. R.; Charl Dowling, M. R.; Charlton, S.J. Quantifying the association and

dissociation rates of unlabelled antagonists at the muscarinic M3 receptor. Br. J. Pharmacol. 2006, 148, 927-937.

(62)

Sykes, D. A.; Dowling, M. R.; Leighton-Davies, J.; Kent, T. C.; Fawcett, L.; Renard, E.; Trifilieff,

A.; Charlton, S. J. The influence of receptor kinetics on the onset and duration of action and the 51



Page 52 of 54

therapeutic index of NVA237 and tiotropium. J. Pharmacol. Exp. Ther. 2012, 343, 520-528.

(63)

Dagani, J.; Sisti, D.; Abelli, M.; Di Paolo, L.; Pini, S.; Raimondi, S.; Rocchi, M.B.; Saviotti, F.M.;

Scocco, P.; Totaro, S.; Balestrieri, M.; de Girolamo, G. Do we need oxytocin to treat schizophrenia? A randomized clinical trial. Schizophr Res. 2016, 172, 158-164. (64)

Scantamburlo, G.; Hansenne, M.; Geenen, V.; Legros, J.J.; Ansseau, M. Additional intranasal

oxytocin to escitalopram improves depressive symptoms in resistant depression: an open trial. Eur Psychiatry. 2015, 30, 65-68. (65)

Amina, S.; Hashii, M.; Ma, W. J.; Yokoyama, S.; Lopatina, O.; Liu, H. X.; Islam, M. S.;

Higashida, H. Intracellular calcium elevation induced by extracellular application of cyclic-ADPribose or oxytocin is temperature-sensitive in rodent NG108-15 neuronal cells with or without exogenous expression of human oxytocin receptors. J. Neuroendocrinol. 2010, 22, 460–466. (66)

Beard, R.; Stucki, A.; Schmitt, M.; Py, G.; Grundschober, C.; Gee, A. D.; Tate, E.W. Building

bridges for highly selective, potent and stable oxytocin and vasopressin analogs. Bioorg. Med. Chem. 2018, 26, 3039-3045 (67)

Nakagawa, Y.; Higashida, H.; Miki, N. A single class of neurotensin receptors with high affinity

in neuroblastoma X glioma NG108-15 hybrid cells that mediate facilitation of synaptic transmission. J. Neurosci. 1984, 6, 1653-1661.

(68)

Cheng, Y.; Prusoff, W. H. Relationship between the inhibition constant (Ki) and the concentration

of inhibitor which causes 50 per cent inhibition (I50) of an enzymatic reaction. Biochem. Pharmacol. 1973, 22, 3099-3108.

(69)

Ma, W. J.; Hashii, M.; Munesue, T.; Hayashi, K.; Yagi, K.; Yamagishi, M.; Higashida, H.; 52


Page 53 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1

Yokoyama, S. Non-synonymous single-nucleotide variations of the human oxytocin receptor gene

2

and autism spectrum disorders: a case-control study in a Japanese population and functional analysis.

3

Mol. Autism. 2013, 4, 22.

4

53



1 2

Table of Contents Graphic

3

4

54


Page 54 of 54

Development of a Highly Potent Analogue and a Long-Acting

Recommend Documents