Development of Bacteriostatic DNA Aptamers for Salmonella

Article pubs.acs.org/jmc

Development of Bacteriostatic DNA Aptamers for Salmonella Olga S. Kolovskaya,†,‡ Anna G. Savitskaya,†,‡ Tatiana N. Zamay,§ Irina T. Reshetneva,∥ Galina S. Zamay,§ Evgeny N. Erkaev,† Xiaoyan Wang,⊥ Mohamed Wehbe,⊥ Alla B. Salmina,§ Olga V. Perianova,∥ Olga A. Zubkova,† Ekaterina A. Spivak,† Vasily S. Mezko,† Yury E. Glazyrin,† Nadezhda M. Titova,# Maxim V. Berezovski,⊥ and Anna S. Zamay*,§ †

Research Institute of Molecular Medicine and Pathobiochemistry, §Department of Biological Chemistry, and ∥Department of Microbiology, Krasnoyarsk State Medical University, 1 Partizana Zheleznyaka str., Krasnoyarsk 660022, Russia ⊥ Department of Chemistry, University of Ottawa, 10 Marie Curie, Ottawa, Ontario K1N 6N5, Canada # Department of Medical Biology, Siberian Federal University, 79 Svobodny, Krasnoyarsk 660041, Russia S Supporting Information *

ABSTRACT: Salmonella is one of the most dangerous and common food-borne pathogens. The overuse of antibiotics for disease prevention has led to the development of multidrug resistant Salmonella. Now, more than ever, there is a need for new antimicrobial drugs to combat these resistant bacteria. Aptamers have grown in popularity since their discovery, and their properties make them attractive candidates for therapeutic use. In this work, we describe the selection of highly specific DNA aptamers to S. enteritidis and S. typhimurium. To evolve species-specific aptamers, twelve rounds of selection to live S. enteritidis and S. typhimurium were performed, alternating with a negative selection against a mixture of related pathogens. Studies have shown that synthetic pools combined from individual aptamers have the capacity to inhibit growth of S. enteritidis and S. typhimurium in bacterial cultures; this was the result of a decrease in their membrane potential.

■

INTRODUCTION Salmonella are a leading cause of food-borne illnesses and are considered to be one of the most dangerous pathogens to humans. Ingestion causes intoxication through an infectious process that often ends with typhoid fever, paratyphoid fever, gastroenteritis, liver cirrhosis, septic arthritis, meningitis, osteomyelitis, and pneumonia.1,2 Currently, the most widespread Salmonella serovars belong to the S. enterica subspecies, specifically S. typhimurium and S. enteritidis. In humans, S. typhimurium causes diarrhea, abdominal cramps, vomiting, and nausea, which generally last up to 7 days. In the last 20 years, S. enteritidis has become the single most common cause of food poisoning. S. enteritidis is particularly adept at infecting chicken flocks without causing visible disease and spreading from hen to hen rapidly. Unfortunately, in immunocompromised persons, that is the elderly, young, or people with depressed immune systems, Salmonella infections are often fatal if not treated with antibiotics. In recent years, increasing antimicrobial resistance in Salmonella enterica has become a serious clinical problem worldwide. The majority of the Salmonella species have acquired multidrug resistance (MDR) to ampicillin, chloramphenicol, streptomycin, sulphonamides, and tetracyclines.3 Therefore, the search for new antibiotics is of utmost importance as MDR strains continue to appear. © XXXX American Chemical Society

Aptamers alone or coupled with antibiotics show prominent neutralizing properties to pathogenic bacteria such as Bacillus cereus,4 Bacillus anthracis,5 Mycobacterium spp.,6 and multidrug resistant Enterococcus spp.7 Aptamers are single-stranded DNA or RNA oligonucleotides selected from large random-sequence nucleic acid libraries for their selective affinity to different molecular targets. These molecules (5−25 kDa) have an identified primary sequence, and they can be synthesized by chemical or enzymatic procedures. They fold into well-defined three-dimensional structures8,9 and show high affinity and specificity for their targets. Aptamers are often viewed as synthetic affinity probes with applications ranging from target detection to drug discovery and delivery. They can be chemically synthesized in high purity at low cost and are easily modified with different dyes and labels. Aptamers are thermostable and can be raised against toxic substances and single or multiple targets in complex mixtures (live cells,10,11 cell lysates,12 and viruses13−15). Lastly, aptamers are nonimmunogenic and nontoxic, thereby allowing for their application as drugs.16 This is of considerable importance when discussing their potential use as antibiotic drugs. Indeed, one RNA aptamer (Macugen) directed against Received: September 22, 2012

A

dx.doi.org/10.1021/jm301856j | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

vascular endothelial growth factor was approved by the FDA,17 and eight new aptamers are in clinical trials.18 Few aptamers have been selected against different bacterial pathogens,19,20 including Salmonella.21,22 In the study performed by the R. Joshi research group,21 aptamers for the outer membrane proteins isolated from S. typhimurium lysate were bound to magnetic beads and used to capture S. typhimurium in whole carcass chicken rinse samples, followed by detection using quantitative real-time RT-PCR. In this study, we describe the selection of aptamers with high affinity and specificity for two types of live Salmonella serovars: S. enteritidis and S. typhimurium with different resistance to antibiotics. S. typhimurium was resistant to ampicillin, streptomycin, chloramphenicol, and amikacin, and S. enteritidis was resistant to tetracycline. Some of the selected aptamer clones showed a bacteriostatic effect against these Salmonella serotypes.

enteritidis and S. typhimurium, live Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, and Citrobacter f reundi; (2) centrifugation and collection of a supernatant with the unbound DNA; (3) incubation of the supernatant with “positive” S. enteritidis cells; (4) washing of unbound ssDNA; (5) extraction of bound ssDNA; and (6) DNA amplification by symmetric and asymmetric PCR. The incorporation of S. typhimurium and other bacterial cells to the negative step of the selection ensured high specificity of aptamers to S. enteritidis serovar only. We also added salmon sperm DNA (0.1 mg L−1) as masking DNA in the positive selection step starting from the sixth round to eliminate nonspecific DNA binding and increase the stringency of aptamer selection. Aptamers to live S. typhimurium were selected similarly as described above. However, we used S. typhimurium in the positive steps and S. enteritidis in the negative steps. To analyze aptamer binding, fluorescently labeled aptamer pools were incubated with Salmonella and analyzed by flow cytometry. Intact bacteria were gated from cell debris and Dulbecco phosphate buffer saline (DPBS) particles as shown in Figure 2. Relative binding analysis of DNA pools revealed that the affinity to bacteria started to increase after the fourth round and reached a maximum in the seventh round (Figure 3). It is interesting to note that the best aptamer pools, SE7 and ST7, demonstrate their maximum binding affinity to S. enteritidis and S. typhimurium cells, respectively, right after the introduction of masking DNA in the selection protocol. Dissociation constants (Kd) of SE7 and ST7 pools were measured in titration experiments using different concentrations of Alexa-488 labeled pools with a fixed amount of 50 × 103 colony forming units (CFU) of live Salmonella (Supporting Information Figure S1). Apparent Kd’s of 7 nM and 25 nM were calculated for SE7 and ST7 pools, respectively, and they show high selectivity and good specificity. They did not bind to heat denatured Salmonella (95 °C for 15 min), intact S. aureus, E. coli, P. aeruginosa, and C. f reundi (Figure 3). The original ssDNA library did not show any significant binding to Salmonella. The aptamer pools SE7 and ST7 were cloned in E. coli and sequenced. A total of 23 unique DNA sequences for S. enteritidis and 22 for S. typhimurium (25 nM each) were evaluated by flow cytometry for their affinity to Salmonella (5 × 104 CFU). Ten full or truncated (without one or both primer binding sites that did not significantly influence estimated secondary structure and stability) aptamer clones for S. enteritidis and nine aptamer clones (full or truncated) for S. typhimurium were selected because of their high affinities. They were chemically synthesized and chosen for further antibacterial experiments. Sequences of these clones and the estimated secondary structures are presented in Table 1. All truncated aptamers show better binding abilities to salmonella cells, indicating that primer sites do not participate in binding recognition. This is likely the result of decreased negative charges and steric hindrance of the aptamer caused by the removal of the primer binding portion. Antibacterial Effect of Aptamers. To evaluate the bactericidal properties of aptamers, we used the method proposed by A. Miles, S. Misra, and J. Irwin24 (also called “surface viable counting”) and determined the number of CFUs in the Salmonella suspension. The antibacterial effect of aptamers was estimated by the number of Salmonella colonies grown in Petri dishes after a 30-min incubation of the bacteria in DPBS with 1 μM of aptamer clones, pools, or ssDNA library and compared with the bacteria in DPBS (Figure 4). All experiments were done in triplicate. The results demonstrate the bacteria growth-suppressive effect of aptamer clones and pools. Apparent

■

RESULTS Selection of Aptamers to Live S. enteritidis and S. typhimurium. Aptamers for live Salmonella were selected based on a cell-SELEX (systematic evolution of ligands by exponential enrichment) scheme: an in vitro selection technique of nucleic acid binders to live cells, bacteria, and viruses from a random ssDNA library.13,14,23 A total of twelve rounds of selection against S. enteritidis were performed at 19−24 °C using the protocol schematically presented in Figure 1. The first round was positive

Figure 1. Aptamer selection scheme for S. enteritidis and S. typhimurium. The first round included positive selection to S. enteritidis or S. typhimurium. The second and each subsequent round were started from negative selection and consisted of the following steps: incubation with bacteria mixture, S. typhimurium or S. enteritidis, heat treated Salmonellas, S. aureus, E. coli, P. aeruginosa, and C. f reundi; collection of unbound sequences; incubation of collected ssDNA with S. enteritidis or S. typhimurium; washing of unbound ssDNA from Salmonella; extraction of bound ssDNA sequences; and ssDNA amplification by symmetric and asymmetric PCR.

selection to S. enteritidis involving 4 steps: (1) incubation of S. enteritidis with the ssDNA library or an enriched pool, (2) washing of unbound ssDNA, (3) extraction of bound ssDNA by heat denaturation, and (4) amplification by symmetric and asymmetric PCR to produce the enriched ssDNA aptamer pool. The second and each subsequent round were started from negative selection and consisted of 6 major steps: (1) incubation with a “negative” bacteria mixture: S. typhimurium, heat treated S. B



Article

Figure 2. Flow cytometry binding analysis of the Alexa-488 labeled ssDNA to salmonellas. (A) Two-dimensional plot of side and forward scattering of buffer particles. (B) Gating for salmonella. (C, D) Histograms of ssDNA library and 7th pool binding to S. enteritidis and S. typhimurium for intact bacteria (red), ssDNA library with salmonella (green), and the pool with highest affinity (blue). #1 is the gate for Alexa-488 positive bacteria, and #2 is the gate for Alexa-488 negative bacteria.

Kd’s are presented in Figure 5. The inhibition caused was 43 ± 4% (SE-20, 60nt), and 62 ± 12% (ST-12, 60nt) in S. enteritidis and S. typhimurium, respectively. A pool of all synthetic clones inhibits growth of bacteria with highest efficacy: up to 73 ± 15% and 75 ± 15% for S. enteritidis and S. typhimurium, respectively. The ssDNA library did not significantly influence the colony growth. Interestingly, a few aptamer clones and a synthetic 80 nt oligonucleotide with a scrambled sequence slightly increased the growth of Salmonella colonies compared with the control experiment. Dose−response curves for the aptamers with bacteriostatic effect are presented in the Supporting Information (Figure S2). In addition, we tested Salmonella viability after aptamer treatment using Rhodamine 123 (Rh123) staining. Rh123 was used for the indication of the metabolic or vital state of the S. typhimurium cell population.25 The dye enters the cells in a membrane potential-dependent fashionthe higher the membrane potential, the higher Rh123 staining. The popular bacterial viability dyes propidium iodide (PI) and SYTO26 do not work well in the presence of aptamers due to nonspecific binding. The majority of aptamer clones and pools caused strong depolarization of bacterial cell wall after a 30-min incubation at 19−24 °C (Figures 5 and 6). The ssDNA library and scrambled 80 nt sequence did not influence the bacterial cell wall potential. Incubation for an additional 18 h of S. enteritidis with aptamers SE-3, SE-11, SE-20, and SE-22 and SE pool resulted in irreversible cell wall depolarization. The same occurred in a case of 18-h incubation of ST-12, ST-33, and pool ST with S.

typhimurium. For the clones ST-1 and ST-20, the membrane potential of S. typhimurium was recovered after an 18-h incubation (Figure 5).

■

DISCUSSION AND CONCLUSIONS In this work we describe the selection of highly specific DNA aptamers to S. enteritidis and S. typhimurium via Cell-SELEX technique. To evolve the species-specific aptamers, twelve rounds of selection to live S. enteritidis and S. typhimurium alternating with the negative selection against a mixture of related pathogens and heat denatured Salmonella, were performed. The incorporation of S. typhimurium or S. enteritidis to the negative step of selection is crucial for evolving highly selective aptamers to specific S. enteritidis or S. typhimurium serovars. To eliminate nonspecific DNA binding and increase the stringency of the aptamer selection, masking DNA was used in the positive selection. Incorporating different controls to increase selection strigency resulted with aptamers that showed strong affinity, with dissociation constants in the nanomolar range and high specificity to their respective salmonella serovar. A few truncated aptamers show better binding abilities after the removal of the primer sites, which are not expected to participate in binding recognition. Truncated 60 nt aptamer clones SE-20 and ST-12 had dissociation constants in the nanomolar range. Shorter ssDNA has less negative charge than the longer sequence. The cell wall of salmonella species is also negatively charged. We hypothesize that the truncation of primer binding sites that is not involved in binding makes aptamers less negative and improves C



Article

Figure 3. Flow cytometry analysis of selected aptamer pools’ affinity to S. enteritidis (A) and S. typhimurium (B). 50 × 103 CFU was preincubated with 0.1 mg mL−1 of salmon sperm DNA for 15 min at 19−24 °C. Afterward, bacteria were incubated with the 100 nM Alexa-488-labeled aptamer pool in 500 μL DPBS buffer for 15 min at 25 °C. The percentage of bacteria cells with bound ssDNA was analyzed on a flow cytometer.

and pool ST with S. typhimurium. For clones ST-1 and ST-20, the membrane potential of S. typhimurium was recovered after an 18h incubation. This could happen because MDR S. typhimurium is less sensitive than S. enteritidis. Thus, clones SE-6, SE-20, and SE22 and pool SE, as well as clones ST-2, ST-12, ST-20, ST-33, and pool ST, have strong bacteriostatic effects on S. enteritidis and S. typhimurium, respectively. They cause the bacterial membrane depolarization and suppress the formation of colonies on agar plates. Molecular mechanisms of aptamer-induced bacteria membrane depolarization remain to be determined. In summary, clones SE-6 and SE-20 and aptamer pool SE (the correspondent EC50s are 500, 400, and 650 nM), ST-12, ST-33, and pool ST (the correspondent EC50s are 250, 800, and 750 nM) have good antibacterial potential against S. enteritidis and S. typhimurium, respectively (Supporting Information Figure S2), due to induction of cell membrane depolarization. Clones SE-3, SE-11, SE-34, ST-1, and ST-6, which did not show antibacterial properties, can still be used as affinity probes in flow cytometry or biosensors.

their binding. Here we show a new functionality of aptamers where they behave as antibiotics against MDR S. enteritidis and S. typhimurium, as seen with clones SE-20 and ST-12, which have promising results for aptamer based antibiotics. They have inhibited growth of bacteria. However, the pool of all synthetic clones had the highest bacterial growth suppression. Certain aptamer clones and a scrambled sequence (80 nt) slightly stimulated the growth of Salmonella colonies compared to the control experiment. No correlation was found between the affinity and the biological effect of aptamers. Therefore, it could be assumed that aptamers with opposite bacterial effects have different binding sites. The competition experiments proved this for clones SE-3 and SE-6, SE-3 and SE-20, ST-6 and ST-12, revealing that aptamers with different biological effects did not replace each other from the bacterial cell wall (Supporting Information Figure S3). But also, it appeared that aptamers ST-6 and ST-33, with opposite effects on bacteria, could share the same binding site, because the first one was displaced by the second one from the S. typhimurium surface. Sequences of aptamers with similar effects did not have any consensus motives (compared using Program BLASTN 2.2.27+). Meaningful nucleotide motifs, relevant aptamer targets, and molecular mechanisms of their interaction remain to be determined. The majority of aptamer clones and pools with bacteriostatic properties also caused strong depolarization of bacterial cell wall after a 30-min incubation at 19−24 °C. The ssDNA library and scrambled 80 nt sequence did not influence the bacterial cell wall potential. An additional 18-h incubation of S. enteritidis with aptamers SE-3, SE-11, SE-20, and SE-22 and the pool SE resulted in irreversible cell wall depolarization. A similar effect was observed with the 18-h incubation of aptamers ST-12 and ST-33

■

MATERIALS AND METHODS

Selection of aptamers was performed using a modified cell-SELEX technology by alternating positive and negative rounds of selection.18−21 Aptamers were selected against clinical strains of S. enteritidis and MDR S. typhimurium isolated in the Krasnoyarsk region (kindly provided by the Federal State Institution of Health “Center for Hygiene and Epidemiology of the Krasnoyarsk Territory”). For negative rounds of selection against S. enteritidis, the bacterial mixture contained S. typhimurium, Staphylococcus aureus (The American Type Culture Collection (ATCC) 25923), Escherichia coli (ATCC 25922), Pseudomonas aeruginosa (ATCC 27853), and the clinical strain of Citrobacter f reundi (kindly provided by the Federal State Institution of D



Article

Table 1. Some of the Best Sequences of Clones Isolated from the Seventh Pool for S. enteritidis and the Seventh Pool for S. typhimuriuma

a

Clone name and estimated secondary structure are given as found by using OligoAnalyzer 3.1.

Health “Center for Hygiene and Epidemiology of the Krasnoyarsk Territory”).

The selection was started with a naı̈ve ssDNA library (Integrated DNA Technologies, USA) which consisted of a randomized region of 40 E



Article

Figure 4. Effect of aptamer pools on colony formation on Petri dishes with LB agar. (A) Bacterial culturability test after incubation of salmonella with aptamers. Aptamer pools, clones, or ssDNA library (1 μM) in DPBS were incubated with S. typhimurium or S. enteritidis for 30 min. Bacteria were diluted, plated on Petri dishes with LB agar, and incubated for 18 h at 37 °C in a dry incubator (repeated in triplicate). The effect was estimated by counting the number of colonies. (B) Intact S. typhimurium; (C) S. typhimurium plated after a 30-min incubation with 1 μM of synthetic aptamer ST-12; (D) Intact S. enteritidis; (E) S. enteritidis plated after a 30-min incubation with 1 μM of synthetic aptamer SE-20. In order to get the same number of bacteria in the beginning of incubation, B and C, and D and E, were initially diluted from the same aliquot of S. enteritidis or S. typhimurium, respectively. nucleotides (N40) flanked by two constant primer-hybridization sites, 5′-CTC CTC TGA CTG TAA CCA CG N40 GC ATA GGT AGT CCA GAA GCC-3′. Before each round of selection and binding experiments, the ssDNA library and aptamer pools were denatured by heating for 5 min at 95 °C in Dulbecco’s phosphate buffered saline (DPBS, Sigma-Aldrich, USA) and then renatured on ice for 10 min. For each round of positive selection, 3 × 106 CFU of the target salmonella was washed and resuspended in DPBS prior to use. The aptamer selection scheme for S. enteritidis and S. typhimurium is presented in Figure 1. For the first round of selection, negative selection steps were omitted and thus ST or SE were incubated (separately) with 500 μL of DPBS containing 1 μM (0.1 nmol or 6 × 1013 sequences) ssDNA library for 30 min at 25 °C and then centrifuged at 3500g for 10 min at 25 °C, to remove unbound aptamers, followed by rinsing twice with DPBS; the pellet was resuspended in 95 μL of 10 mM Tris-HCl buffer containing 10 mM EDTA, pH 7.4 (TE) (Sigma-Aldrich, USA), and heated for 10 min at 95 °C to release the aptamers bound to the bacteria. After the denaturing step, bacterial debris was removed by centrifugation at 14000g for 15 min at 4 °C and the supernatant (containing the aptamers) was collected and stored at −20 °C. Subsequently, salmonella binding aptamers were amplified using symmetric and asymmetric PCR. For the symmetric PCR, 5 μL of the aptamer pool in TE was mixed with 45 μL of symmetric PCR Master Mix, containing the following: 1X PCR buffer, 2.5 mM MgCl2, 0.025 U μL−1 KAPA2G HotStart Robust polymerase (KAPABiosystems, USA), 220 μM dNTPs, 300 nM forward primer (5′- CTC CTC TGA CTG TAA CCA CG-3′), and 300 nM reverse primer (5′- GGC TTC TGG ACT ACC TAT GC-3′) (Syntol, Russia). Afterward, asymmetric PCR was performed where 5 μL of the symmetric PCR product in TE buffer was mixed with 45 μL of the asymmetric PCR Master Mix containing the following: 1X PCR buffer, 2.5 mM MgCl2, 0.025 U μL−1 KAPA2G HotStart Robust polymerase, 220 μM dNTPs, 1 μM forward Alexa-488 primer (5′-Alexa488- CTC CTC TGA CTG TAA CCA CG-3′), and 50 nM reverse primer (5′GGC TTC TGG ACT ACC TAT GC-3′). Amplification was performed using the following PCR program: preheating for 2 min at 95 °C, 15 cycles of 30 s at 95 °C, 15 s at 56.3 °C, and 15 s at 72 °C. The concentration of the PCR product was estimated using 3% agar electrophoresis. Fluorescence ssDNA labeled with Alexa-488 was analyzed in the gel-documenting system GBOX/EF2-E. Evolved aptamer pools product was stored at −20 °C. For the subsequent rounds of selection, 100 nM of fluorescently labeled ssDNA aptamers was used for the negative selection, where 3 × 106 CFU of bacteria mixture containing Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, and a clinical stain of Citrobacter f reundi in DPBS was used along with the opposite Salmonella serovar that we were selecting for.

The bacteria mixture was incubated for 30 min at 25 °C in 500 μL of DPBS with 100 nM ssDNA aptamer candidates evolved from the previous round and then centrifuged at 3500g for 10 min at 25 °C to collect unbound sequences. Extracted aptamers were used for the next step of the positive selection (described above). The evolved aptamer pool was stored at −20 °C and used for the next round of selection following the aforementioned procedure, starting from the negative step. To remove nonspecific binding aptamers from the pool, another additional step was applied: starting from round 6 during positive selection, salmonella species were preincubated with masking DNA from salmon sperm. Cloning and Sequencing of the Aptamer Pool. Evolved aptamer pools were cloned to obtain unique aptamer sequences. The dsDNA pool was extracted from gel using the DNA gel extraction kit Axy prep (AxyGen Biosystems, USA) in order to purify the DNA from the PCR mixture. Cloning was performed according to the supplied protocol using a M13mp18 Perfectly Blunt Cloning Kit (Novagen, Germany). White colonies were collected into separate tubes, left to grow overnight in 1 mL of SOC medium (Cellgro, USA) at 37 °C, and then analyzed by PCR and agarose gel electrophoresis to ensure that the clones have the insert in the plasmid. For each PCR reaction, 2 μL of the cell suspension was mixed with 18 μL of the PCR Master Mix containing the following: 1X PCR buffer B, 2.5 mM MgCl2 (Mallinckrodt Baker, Inc., USA), 0.025 U μL−1 KAPA 2G Robust Hot Start DNA polymerase (Kapa Biosystems, USA), 220 μM dNTPs, 300 nM forward FAM primer, and 300 nM reverse primer. Amplification was performed using a PCR program (preheating for 5 min at 95 °C, 25−30 cycles of 30 s at 95 °C, 15 s at 56.3 °C, and 15 s at 72 °C). Plasmids were isolated using a GeneJET plasmid miniprep kit (Fermentas, USA), according to the supplied protocol. The part of the plasmid with the insert was amplified using M13 forward primer (5′-GTA AAA CGA CGG CCA GT-3′) and M13r everse primer (5′- AGC GGA TAA CAA TTT CAC ACA GG-3′), according to the following protocol. For each PCR reaction, 5 μL of the plasmid (∼10 ng μL−1) diluted in water was mixed with 45 μL of PCR Master Mix containing the following: 1X PCR buffer A, 2.5 mM MgCl2, 0.025 U μL−1 KAPA 2G Robust Hot Start DNA polymerase, 220 μM dNTPs, 300 nM forward M13 primer, and 300 nM reverse M13 primer. Amplification was performed using a PCR program (preheating for 2 min at 95 °C, 25 cycles of 30 s at 95 °C, 15 s at 60 °C, and 15 s at 72 °C). Finally, the unpurified PCR product was sequenced at McGill University and Génome Québec Innovation Centre, Canada. Synthetic aptamer clones with and without a FAM label were purchased at Integrated DNA Technologies, USA. Flow Cytometric Binding Analysis of Pools and Clones. The affinities of the evolved aptamer pools against S. enteritidis and S. F



Article

Figure 5. Antibacterial effect of aptamers on S. enteritidis (A) and S. typhimurium (B) showed by culturability and viability Rhodamine 123 tests. The symbols in the figure indicate the following: *, Pool SE combined from clones SE-6, SE-20, and SE-22; **, Random sequence: CTCCTCTGACTGTAACCACGGATTGTCAGCGCGCCGCCGGATCAAGCATTTCGACAATTCGCATAGGTAGTCCAGAAGCC; ***, Pool ST combined from clones ST-2, ST-12, ST-20, and ST-33; 1Growth suppression. 1 μM of ssDNA samples in DPBS were incubated with 103 CFU mL−1 of S. typhimurium or S. enteritidis for 30 min. Afterward, the mixture was diluted and plated on Petri dishes with LB Agar and incubated for 18 h at 37 °C in a dry incubator (done in triplicate). The effect was estimated by counting the number of colonies (N). The number of colonies (Nc) in control plates with intact S. enteritidis or S. typhimurium (incubated in DPBS without ssDNA) was considered as 100%. Growth suppression was calculated as 100 − (N × 100/Nc). 2Cell wall electrochemical gradient decrease. Samples of 1 μM ssDNA in DPBS were incubated with 5 × 103 CFU mL−1 S. typhimurium or S. enteritidis for 30 min and 18 h. EGTA at the final concentration 1 mM was added to samples to permeabilize the bacterial outer membrane; bacteria were then loaded with Rh123 and analyzed on a flow cytometer. The samples were loaded with Rh123 (2 μg/mL final concentration) for 15 min at 19−24 °C and analyzed. The median of the histogram was taken as a relative value of electrochemical gradient (EG). Samples with intact S. typhimurium or S. enteritidis incubated in DPBS without ssDNA and loaded with Rh123 (EGc) were considered as positive controls (100% viability). The electrochemical gradient decrease was calculated as EGc − EG. For example, EG for S. typhimurium was 28.9 relative units, and EG for heat treated S. typhimurium was 15.9 relative units; therefore, the EG decrease (EGc − EG) was 13 relative units. aptamer pool in 500 μL of DPBS buffer for 30 min at 25 °C. Control experiments were performed using the fluorescently labeled ssDNA library in DPBS. Subsequently, each sample was washed once to remove unbound DNA and then resuspended in 0.5 mL of DPBS and measured using flow cytometry for 30 000 events. The gate for intact S. enteritidis and S. typhimurium in DPBS was taken as background fluorescence. The

typhimurium were determined using an FC-500 flow cytometer (Beckman Coulter Inc., USA). Before incubating with aptamers, each sample contained 50 × 103 CFU S. enteritidis or S. typhimurium and was preincubated with 0.1 mg mL−1 of salmon sperm DNA as a masking nucleic acid to suppress nonspecific binding for 15 min at 19−24 °C. Afterward, bacteria were incubated with 100 nM Alexa-488-labeled G



■

Article

ASSOCIATED CONTENT

S Supporting Information *

Dose−response curves for the aptamers with bacteriostatic effect; example of Kd determination; competition experiments between aptamer clones. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected], [email protected]. Phone: +7-903-923-84-02. Author Contributions

Figure 6. Bacteria viability test based on Rhodamine 123 uptake. Samples of 1 μM ssDNA in DPBS were incubated with 5 × 103 CFU mL−1 of S. typhimurium or S. enteritidis for 30 min and 18 h. EGTA was added to samples in order to permeabilize the bacterial outer membrane; samples were then loaded with Rh123 for 15 min at 19−24 °C and measured on a flow cytometer. Samples with live intact bacteria and heat treated salmonella (10 min at 95 °C) in DPBS loaded with Rh123 were taken as a positive and a negative control. Flow cytometric analysis of Rh123 uptake by S. enteritidis (A) and S. typhimurium (D): intact salmonella (blue), unstained bacteria (red), heat treated bacteria (green), initial ssDNA library (purple), S. enteritidis (black) or S. typhimurium (orange) incubated for 30 min accordingly with pool SE or pool ST and aptamer clones SE-20 or ST-12.

‡

Olga S. Kolovskaya and Anna G. Savitskaya contributed equally to this work. The manuscript was written with contributions from all authors. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the Ministry Healthcare of the Russian Federation. The authors thank Professor Ivan P. Artyukhov, Dr. Maria Trusova, and Professor Andrey A. Savchenko for supporting the work, as well as Ms. Darija Muharemagic and Ms. Ana Gargaun for editing. Bacteria isolates were kindly provided by the Federal State Institution of Health “Center for Hygiene and Epidemiology of the Krasnoyarsk Territory”.

fluorescence above the background was gated and considered to be the real fluorescence of the Alexa-488 labeled aptamers bound with bacteria (Figure 2). Data analysis was performed using Kaluza 1.1 software. Evaluation of the Antibacterial Effect of Aptamers on S. enteritidis and S. typhimurium by Colony Forming Unit Assay and Culturability Test. A bacterial culture in LB nutrient broth (Sigma-Aldrich, USA) of S. enteritidis and S. typhimurium (103 CFU mL−1) was incubated with aptamer pools, clones, or the ssDNA library to a final concentration of 1 μM. In order to get the same number of bacteria in all samples, incubation samples were diluted from the same aliquot S. enteritidis or S. typhimurium, respectively. Control samples contained intact S. enteritidis or S. typhimurium incubated in DPBS without ssDNA. All samples were incubated for 30 min at 19−24 °C and then diluted and plated on Petri dishes with LB Agar (Sigma-Aldrich, USA) in triplicate; this was followed by a 24-h incubation at 37 °C to allow bacterial growth. The colonies were then counted to compare their growth. The number of colonies (Nc) in control plates was considered as 100%. Growth suppression was calculated as 100 − (N × 100/Nc). Bacteria Viability Estimated by Rhodamine 123. In addition, the antibacterial effect of aptamers was also evaluated by Rhodamine 123 (Sigma-Aldrich, USA) penetration into bacteria, which allows for predicting the viability of bacteria because of their ability to accumulate this dye as a function of membrane potential. In live bacteria the membrane potential allows Rh123 to enter the cell, resulting in bacteria fluorescence in the green spectral region. Cell death leads to a decrease in membrane potential and reduction of input dye, thereby reducing the fluorescence intensity of bacteria. The fluorescent intensity of bacteria loaded with Rh123 was evaluated by flow cytometry (Figures 5 and 6). Samples of ssDNA (1 μM each) in DPBS were incubated with 5 × 103 CFU mL−1 S. enteritidis or S. typhimurium for 30 min and 18 h. Afterward, ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA) (Sigma-Aldrich, USA) was added to samples to a final concentration of 1 mM before addition of dyes in order to permeabilize the bacterial outer membrane. Samples were loaded with Rh123 (2 μg mL−1 final concentration) for 15 min at 19−24 °C and measured on a flow cytometer.30 The resulting histogram was analyzed, and the median was used as a relative value of electrochemical gradient (EG). Samples with intact S. enteritidis or S. typhimurium were incubated in DPBS without ssDNA and loaded with Rh123 (EGc) as a positive control (100% viability). The electrochemical gradient of heat treated Salmonella (10 min at 95 °C) was taken as negative control. The electrochemical gradient decrease was calculated as EGc − EG.

■

ABBREVIATIONS USED SELEX, systematic evolution of ligands by exponential enrichment; DPBS, Dulbecco phosphate buffer saline; CFU, colony forming units; Rh123, Rhodamine 123; PI, propidium iodide; MDR, multidrug resistance; ATCC, American Type Culture Collection; EG, electrochemical gradient

■

REFERENCES

(1) Pegues, D. A.; Ohl, M. E.; Miller, S. I. Salmonella species, including Salmonella typhi. In Principles and Practice of Infectious Diseases, 6th ed.; Mandell, G. L., Bennet, J. E., Dolin, R., Eds.; Churchill Livingstone: Elsevier: New York, 2005; pp 2636−2654. (2) Helms, M.; Ethelberg, S.; Molbak, K. International Salmonella typhimurium DT104 infections, 1992−2001. Emerging Infect. Dis. 2005, 11, 859−867. (3) Pui, C. F.; Wong, W. C.; Chai, L. C.; Tunung, R.; Jeyaletchumi, P.; Noor Hidayah, M. S.; Ubong, A.; Farinazleen, M. G.; Cheah, Y. K.; Son, R. Salmonella: A foodborne pathogen. Int. Food Res. J. 2011, 18, 465− 473. (4) Schlesinger, S. R.; Lahousse, M. J.; Foster, T. O.; Kim, S.-K. Metallo-β-lactamases and aptamer-based inhibition. Pharmaceuticals 2011, 4, 419−428. (5) Vivekananda, J.; Keil, J. L. US20036569630, 2003. (6) Xiaolian, Z.; Fan, C. CN101109013, 2008. (7) Morrissey, D.; Haeberli, P. WO03106476, 2003. (8) Ellington, A.; Szostak, J. In vitro selection of RNA molecules that bind specific ligands. Nature 1990, 346, 818−822. (9) Tuerk, C.; Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 1990, 249, 505−510. (10) Berezovski, M. V.; Lechmann, M.; Musheev, M. U.; Mak, T. W.; Krylov, S. N. Aptamer-facilitated biomarker discovery (AptaBiD). J. Am. Chem. Soc. 2008, 130, 9137−9143. (11) Shangguan, D.; Meng, L.; Cao, Z. C.; Xiao, Z.; Fang, X.; Li, Y.; Cardona, D.; Witek, R. P.; Liu, C.; Tan, W. Identification of liver cancerspecific aptamers using whole live cells. Anal. Chem. 2008, 80, 721−728. H



Article

(12) Javaherian, S.; Musheev, M. U.; Kanoatov, M.; Berezovski, M. V.; Krylov, S. N. Selection of aptamers for a protein target in cell lysate and their application to protein purification. Nucleic Acids Res. 2009, 37 (8), e62. (13) Labib, M.; Zamay, A. S.; Muharemagic, D.; Chechik, A.; Bell, J. C.; Berezovski, M. V. electrochemical sensing of aptamer-facilitated virus immunoshielding. Anal. Chem. 2012, 84, 1677−1686. (14) Labib, M.; Zamay, A. S.; Muharemagic, D.; Chechik, A.; Bell, J. C.; Berezovski, M. V. Aptamer-based viability impedimetric sensor for viruses. Anal. Chem. 2012, 84, 1813−1816. (15) Labib, M.; Zamay, A. S.; Muharemagic, D.; Chechik, A.; Bell, J. C.; Berezovski, M. V. Electrochemical differentiation of epitope-specific aptamers. Anal. Chem. 2012, 84, 2548−2556. (16) Ulrich, H. RNA aptamers: from basic science towards therapy. Handb. Exp. Pharmacol. 2006, 173, 305−326. (17) Vavvas, D.; D’Amico, D. J. Pegaptanib (Macugen): treating neovascular age-related macular degeneration and current role in clinical practice. Ophthalmol. Clin. North. Am. 2006, 19, 353−360. (18) Keefe, A. D.; Pai, S.; Ellington, A. Aptamers as therapeutics. Nat. Rev. Drug Discovery 2012, 9, 538−550. (19) Hamula, C. L. A.; Zhang, H.; Guan, L. L.; Li, X.-F.; Le, X. C. Selection of aptamers against live bacterial cells. Anal. Chem. 2008, 80 (20), 7812−7819. (20) Hamula, C. L. A.; Le, X. C.; Li, X.-F. DNA Aptamers binding to multiple prevalent M-types of streptococcus pyogenes. Anal. Chem. 2011, 83 (10), 3640−3647. (21) Joshi, R.; Janagama, H.; Dwivedi, H. P.; Kumar, S. T. M. A.; Jaykus, L.-A.; Schefers, J.; Sreevatsan, S. Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars. Mol. Cell. Probes 2009, 23, 20−28. (22) Fubin, Wang; Ming-Sheng, Zhang; Jian-Ming, Hu; Bing Xia Qin, Pan; Xiao-Lian, Zhang; Hong-Yan, Wu; Pan-Wen, He; Jianguo, Wu. Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi. Antimicrob. Agents Chemother. 2005, 49 (10), 4052−4060. (23) Sefah, K.; Shangguan, D.; Xiong, X.; O’Donoghue, M. B.; Tan, W. Development of DNA aptamers using Cell-SELEX. Nat. Protoc. 2010, 5, 1169−1185. (24) Miles, A. A.; Misra, S. S.; Irwin, J. O. The estimation of the bactericidal power of the blood. J. Hyg. 1938, 38 (6), 732−749. (25) Lopez-Amoros, R.; Comas, J.; Vives-Rego, J. Flow cytometric assessment of Escherichia coli and Salmonella typhimurium starvationsurvival in seawater using rhodamine 123, propidium iodide, and oxonol. Appl. Environ. Microbiol. 1995, 61 (7), 2521−2526. (26) Kennedy, D.; Cronin, U. P.; Wilkinson, M. G. Responses of Escherichia coli, Listeria monocytogenes, and Staphylococcus aureus to simulated food processing treatments, determined using FluorescenceActivated Cell Sorting and plate counting. Appl. Environ. Microbiol. 2011, 77 (13), 4657−4668.

I


Development of Bacteriostatic DNA Aptamers for Salmonella

Recommend Documents