ARTICLE pubs.acs.org/Biomac
Development of Poly(3-hydroxybutyrate-co-3-hydroxyvalerate) Fibers for Skin Tissue Engineering: Effects of Topography, Mechanical, and Chemical Stimuli Purushothaman Kuppan, Kirthanashri S. Vasanthan, Dhakshinamoorthy Sundaramurthi, Uma Maheswari Krishnan, and Swaminathan Sethuraman* Centre for Nanotechnology & Advanced Biomaterials, SASTRA University, Thanjavur, Tamil Nadu, India ABSTRACT: Poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV), a biodegradable polyester, was electrospun to form defect-free fibers with high surface-area-to-volume ratio for skin regeneration. Several parameters such as solvent ratio, polymer concentration, applied voltage, flow rate, and tip-to-target distance were optimized to achieve defect-free morphology. The average diameter of the PHBV fibers was 724 ( 91 nm. PHBV was also solvent-cast to form 2-D films, and its mechanical properties, porosity, and degradation rates were compared with PHBV fibers. Our results demonstrate that PHBV fibers exhibited higher porosity, increased ductility, and faster degradation rate when compared with PHBV 2-D films (p < 0.05). In vitro studies with PHBV fibers and 2-D films were carried out to evaluate the adhesion, viability, proliferation, and gene expression of human skin fibroblasts. Cells adhered and proliferated on both PHBV fibers and 2-D films. However, the proliferation of cells on the surface of PHBV fibers was comparable to tissue culture polystyrene (TCPS, control) (p > 0.05). The gene expression of collagen I and elastin was significantly up-regulated when compared with TCPS control, whereas collagen III was down-regulated on PHBV fibers and 2-D film after 14 days in culture. The less ductile PHBV 2-D films showed higher levels of elastin expression. Furthermore, the PHBV fibers in the presence and absence of an angiogenesis factor (R-Spondin 1) were evaluated for their wound healing capacity in a rat model. The wound contracture in R-Spondin-1-loaded PHBV fibers was found to be significantly higher when compared with PHBV fibers alone after 7 days (p < 0.05). Furthermore, the presence of fibers promoted an increase in collagen and aided re-epithelialization. Thus our results demonstrate that the topography and mechanical and chemical stimuli have a pronounced influence on the cell proliferation, gene expression, and wound healing.
1. INTRODUCTION Skin is the largest and third most proliferating organ in humans and serves as a barrier between human body and surrounding environment by protecting the underlying organs against the invading pathogens.1 The self-healing process of skin is impaired during severe burns, lacerations, and diabetic wounds.2 Annually, $7.5 billion is spent to treat burn wounds and associated infections.3 Large skin defects require immediate dressing to protect the wound from infections. Conventionally, autografts and allografts have been used to treat burns and other full thickness wounds.4 Autografts hold good promise for dermal wound healing because they do not suffer from immune rejection, but because of their limited availability and risk of donor site morbidity, they are not popular. Although allografts are readily available, they have the risk of disease transmission and immune rejection. Hence, there exists a need to develop alternate strategies to regenerate skin. Tissue engineering, which involves the use of scaffolds, cells, and signaling molecules independently or in combination, has emerged as a promising alternative. Different types of wound dressing materials in the form of films, sponges, micro- and nanofibers have been developed using natural and synthetic polymers.57 However, the success of these dressing materials is r 2011 American Chemical Society
dependent on the choice of the polymer, physicochemical properties, and surface topography.812 Various strategies have been employed to develop skin substitutes that mimic the native skin, prevent the loss of nutrients, inhibit infection, and help to remove the exudates.13,14 Nanofibers have received a great deal of attention as scaffolds for skin regeneration because of their structural similarity to the extracellular matrix (ECM), very large surface-area-to-volume ratio, superior mechanical properties, and high porosity.15,16 Natural polymers such as chitosan, gelatin, collagen, and synthetic polymers such as polyesters and polyphosphazenes have been electrospun to micro- and nanofibers for their use as scaffolds for skin regeneration.7,1719 Electrospinning of PHBV fibers has been previously reported using solvents like hexafluoroisopropanol (HFIP),20 trifluoroethanol (TFE),21,22 chloroform,23 and chloroform with DMF.24 Many studies have reported PHBV fiber diameters between 1 and 4 μm23 using chloroform as solvent. Electrospun PHBV nanofibers have been previously investigated for wound dressings using a coculture of dermal Received: May 5, 2011 Revised: June 22, 2011 Published: July 29, 2011 3156
dx.doi.org/10.1021/bm200618w | Biomacromolecules 2011, 12, 3156–3165
Biomacromolecules and hair follicular epithelial cells.18 Scaffolds provide structural support to the proliferating cells on the wound surface and control the cell fate processes such as cell adhesion, migration, proliferation, and differentiation.25 However, wound healing is a complex process, which involves coordinated interactions among dermal cells, epidermal cells, and ECM and the formation of new blood vessels. These cellular events are highly controlled and regulated by various cytokines and signaling molecules.26 Hence, it is desirable to develop a growth-factor-loaded scaffold, which would regulate the cell fate processes resulting in accelerated wound healing. The major challenge is to find out growth factors and cytokines expressed during regeneration and incorporate them in a matrix for use in a skin equivalent.27 Many studies have revealed a beneficial effect of many of these growth factors such as plateletderived growth factor (PDGF), fibroblast growth factor (FGF), and granulocyte-macrophage colony-stimulating growth factor (GMCSGF) on the healing processes both in animal and in human model.28 Growth factors such as transforming growth factor (TGF-β), FGF and vascular endothelial growth factor (VEGF) have been loaded on polymeric matrices to accelerate the regeneration.27 R-Spondin 1 is a roof plate-specific spondin 1, which is a 27 kDa protein that belongs to the R-Spondin family.29,30 R-Spondin protein induces proliferation of crypt epithelial cells and also stabilizes the cytosolic β-catenin pathway.31 The Wnt signaling pathway plays a vital role in diverse biological process during embryonic development, adult homeostasis, and disease pathogenesis.32,33 R-Spondins are known to regulate Wnt/β-catenin signaling pathway and are responsible for angiogenesis.34 However, thus far, no attempts have been made to use this growth factor for tissue engineering. Therefore, because of its well-established role in promoting angiogenesis, R-Spondin can be an invaluable component for skin tissue regeneration approaches. The objective of this study was to develop poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV) fibers via electrospinning and to optimize the process parameters to obtain defect-free fibers. The physico-chemical properties, cell adhesion, proliferation, and gene expression of human skin fibroblast cells were evaluated and compared with 2-D PHBV films. Furthermore, we have evaluated the in vivo wound healing potential of PHBV fibers in the presence and absence of R-Spondin 1.
2. MATERIALS AND METHODS 2.1. Materials. PHBV, molecular weight, Mw = 450 kDa (Good Fellow Cambridge, Huntingdon, England), dichloromethane (DCM), and dimethylformamide (DMF) (Merck, Mumbai, India) were used for these studies. Human skin fibroblasts (CRL 2072) and Eagle’s minimum essential media (EMEM) were obtained from ATCC. Fetal bovine serum (FBS), phosphate-buffered saline (PBS) solution and antibiotics (penicillinstreptomycin (P/S)) were purchased from Gibco (Grand Island,New York, USA). CellTiter 96 aqueous one solution and the livedead cell viability kit were purchased from Promega (Madison, Wisconsin, USA) and Molecular Probes (Eugene, Oregon, USA), respectively. Bactigras (Antibiotic impregnated gauze) was obtained from Smith & Nephew Healthcare (Mumbai, India), and R-Spondin 1 was purchased from Bi Biotech India (New Delhi, India). 2.2. Scaffold Fabrication. PHBV 2-D fibers and films were prepared by electrospinning and solvent casting, respectively. PHBV was dissolved in a mixture of DCM and DMF in the ratio 9:1 to form a 15% (w/v) solution. The polymer solution was loaded in a 1 mL glass
ARTICLE
syringe with 26 gauge blunt needle, and the flow rate was maintained at 0.003 mL/min using a syringe pump (Kent Scientific, Torrington, Connecticut, USA). The tip of the needle was connected to a high voltage of 10 kV (Zeonics, Bangalore, India), and the fibers were collected onto grounded static collector, which was placed 12 cm away from the charged needle tip. The fibers collected were vacuum-dried for 3 days and used for further characterization and cell culture studies. Two-dimensional PHBV films were cast by dissolving the PHBV in DCM/DMF (9:1) and kept overnight at room temperature and further vacuum-dried for 3 days. 2.3. Surface Morphology. The surface morphology of the electrospun PHBV fibers and 2-D films was analyzed using scanning electron microscopy (FE-SEM, JSM 6701F, JEOL, Tokyo, Japan) at an accelerating voltage of 3 kV at various magnifications. The samples were sputter-coated with platinum prior to imaging. The fiber diameters were measured from different locations, and the fiber diameter versus number of fibers was plotted. 2.4. Tensile Properties. The tensile properties of the PHBV fibers and 2-D films were evaluated using a uniaxial tensile machine (Instron 3345, Bucks, U.K.). Fibers of 10 mm 83 mm 0.12 mm (n = 6) and 2-D films of 10 mm 90 mm 0.2 mm (n = 6) were used in this study. The ends of the samples were mounted on the gripping units of the tensile tester, and a load of 500 N at an extension rate of 1 mm/min was applied until failure.7 2.5. Porosity Analysis. Pore size distribution and percentage porosity of the electrospun PHBV fibers and the 2-D film were measured using a mercury intrusion porosimeter (Autopore IV, Micromeritics Instrument, Norcross, Georgia, USA). We used 0.1 g of PHBV fibers with 0.12 mm thickness (n = 3) and 0.8 g of PHBV 2-D films with 0.2 mm thickness (n = 3) in this study. The determination of porosity was based on the relationship between the applied pressure and the pore diameter into which mercury intrudes. 2.6. In Vitro Degradation. In vitro degradation of the PHBV fibers and 2-D film were studied for 5 weeks. The thickness of PHBV fibers and 2-D film used in this study was 0.12 and 0.2 mm, respectively. We placed 0.015 g of samples in PBS solution at 37 °C in a shaking water bath. The PBS was changed every alternate day. The specimens were removed after 1, 2, 3, 4, and 5 weeks and rinsed twice with distilled water to remove salts and dried.17 The weight of the dried samples was recorded, and the percentage weight loss was calculated using the following formula weight loss ð%Þ ¼
initial weight f inal weight 100 initial weight
2.7. Cell Seeding. Human skin fibroblast cells were cultured in a growth media comprising EMEM supplemented with 10% FBS and 1% P/S and maintained at 37 °C in 5% carbon dioxide. The PHBV fibers were electrospun on glass coverslips, whereas the 2-D PHBV films were cut into 15 mm circular disks using a cork borer. The samples were sterilized under UV light for 20 min on each side, followed by immersion in 70% ethanol, and were washed with PBS solution twice. We seeded 50 000 human skin fibroblast cells on the fibers and 2-D film matrices to determine the cell adhesion and proliferation. Tissue culture polystyrene (TCPS) was used as control, and the growth medium was changed every other day. 2.8. Cell Adhesion. Cell adhesion on PHBV fibers and 2-D films was qualitatively evaluated by SEM. To study the interaction of the cells on the matrices, we removed the samples after 1, 6, and 12 h and at later time points such as 1, 3, and 7 days. The samples were washed with PBS and fixed with 4% glutaraldehyde overnight at 4 °C. The samples were washed with PBS and dehydrated with increasing alcohol concentration from 50 to 100%, followed by air-drying. The dried samples were sputter-coated with platinum and observed under a scanning electron microscope. 3157
dx.doi.org/10.1021/bm200618w |Biomacromolecules 2011, 12, 3156–3165
Biomacromolecules
ARTICLE
Table 1. Sequences for Forward (Sense) and Reverse (Antisense) Gene Specific Primers for Human Skin Fibroblasts Used in Real-Time RT-PCR Amplification genes β actin
sequence name
primer
sequences
base no
HsActinB4
HsActinB4-997F
CCCTGGCACCCAGCAC
16
collagen I
NM_000088
HsActinB4-1067R COL1A1-48F
GCCGATCCACACGGAGTAC TGGTGCAGCTGGTCTTCCA
19 19
COL1A1-139R
CACGGACGCCATCTTTGC
18
collagen III
NM_000090
COL3A1-118F
GATGTGCAGCTGGCATTCC
19
COL3A1-218R
CCACTGGCCTGATCCATGTAT
21
elastin
NM_000501
elastin-309F
CCAAAGCCGCCCAGTTT
17
elastin-454R
AAGGCCAGCAGCACCGTAT
19
2.9. Cell Proliferation. The proliferation of cells on the PHBV fibers and 2-D films were studied after 1, 3, and 7 days using MTS assay (CellTiter 96 AQueous one solution, Promega). At the end of each time point, the samples were washed with PBS solution to remove the nonadherent cells. MTS reagent (200 μL) and 1 mL of serum-free media were added to each of the samples and incubated at 37 °C for 2 h. The reaction was stopped by the addition of 250 μL of sodium dodecyl sulfate (SDS) solution. The absorbance was measured at 490 nm using a multiplate reader (Infinite 200M, Tecan, Durham, North Carolina, USA). 2.10. Cell Viability. Viability of human skin fibroblast cells after 24 h on PHBV fiber mats was evaluated using a live/dead cell viability kit following the protocol provided by the manufacturer. The samples were imaged at different magnifications using a laser scanning confocal microscope (FV1000, Olympus, Tokyo, Japan). Furthermore, immunostaining was performed after 24 h. In brief, the adhered cells on scaffold were fixed with 3.7% formaldehyde solution for 30 min and incubated in a cold cytoskeleton buffer (5 mM NaCl, 150 mM MgCl2, 0.5 mM Tris base, and 0.5% Triton X-100 in PBS solution) for 5 min. The scaffolds were incubated in blocking buffer solution (5% FBS, 0.1% Tween-20, and 0.02% sodium azide in PBS) for 30 min at 37 °C, followed by incubation in antivinculin (1:200) (Invitrogen, Carlsbad, California, USA) for 1 h at 37 °C and subsequently with anti-mouse IgG (whole molecule)FITC (Sigma-Aldrich, St. Louis, Missouri, USA) and rhodaminephalloidin (1:200) (Invitrogen) for 1 h at 37 °C. These fluorescence-treated scaffolds were placed on the Petri dish and observed under laser scanning confocal microscope (FV1000, Olympus). 2.11. Real-Time RT-PCR. Expression pattern of ECM proteins such as collagen type I, type III and elastin were evaluated using a realtime RT-PCR after 3, 7, and 14 days of culture. The total RNA was isolated using trizol (Invitrogen) following the procedure described by the manufacturer.35 In brief, 1 mL of trizol was added to the samples and kept for 0.5 h at room temperature. The solution was collected, and RNA was extracted with 0.2 mL of chloroform (Merck). The solution was centrifuged at 12 000 rpm for 15 min at 4 °C and extracted RNA was stabilized using 70% ethanol prepared with nuclease-free water (Qiagen, Germantown, Maryland, USA). The RNA was centrifuged using a QIA shredder spin column (Qiagen) and dissolved in RNase-free water (Qiagen). cDNA was obtained after a two-step reaction and subjected to a real-time RT-PCR (Eppendorf AG22331, Germany). The primers were designed on the basis of published gene sequences and are shown in Table 1. Quantitative values were determined by the δδ method and normalized with the house-keeping gene, β-actin, and the control. 2.12. Animal Studies. We used 30 female Rattus norvegicus rats, weighing about 200250 g. The animal studies were conducted at the Central Animal Facility of the University, and the protocol was approved by the Institutional Animal Ethics Committee (64/SASTRA/IAEC/ RPP). The animals were randomly divided into five groups prior to surgery. Rats were anesthetized by an intraperitoneal injection of 10 mg/kg
xylazine (Indian Immunologicals, Hyderabad, India) and 90 mg/kg Ketamine (Themis Chemicals, Mumbai, India). The skin was shaved and disinfected with 70% alcohol. A full thickness wound of about 10 10 mm was created in the dorsum of the animals using a sterile surgical blade. Group I served as negative control (no treatment), Group II served as positive control (Bactigras), and Group III received PHBV fibers. Group IV received topical administration of 50 ng of R-Spondin 1, whereas Group V received PHBV fibers and topical administration 50 ng of R-Spondin 1. Animals were individually caged and fed with normal diet with access to water ad libitum. The animals were sacrificed after 7 and 14 days. The extent of wound closure was traced by tracer sheet, and the percentage of wound closure was measured. 2.13. Histopathology. After the animals were sacrificed, the tissues were collected at the newly regenerated region and fixed in phosphate-buffered 10% formalin, dehydrated in ethanol, cleared in xylene, and embedded in paraffin. They were sectioned at a thickness of 3 μm and stained with hematoxylin and eosin. 2.14. Biochemical Studies. Fresh tissue (50 mg) excised from the each experimental animal was washed with PBS solution and homogenized with 1 mL of 0.01 M Tris buffer (pH 7.0) and centrifuged at 1000g for 10 min at 4 °C.36 The total protein content was measured by adding 1 mL of Biuret reagent and recording the absorbance at 575 nm.37 Protein hydrolysate was prepared by autoclaving the tissue homogenate with 1 mL of 6 N HCl in a sealed tube for 3 h.38 The hydrolysate was cooled and neutralized with 6 N NaOH and made up to 2 mL. We mixed 250 μL of the solution with 250 μL of 0.01 M copper sulfate, followed by 2.5 N NaOH and 6% H2O2 for the estimation of hydroxy proline. This mixture was kept at 80 °C with vigorous shaking for 5 min, followed by the addition of 1 mL of 3 N H2SO4 and 0.5 mL of 5% p-dimethylaminobenzaldehyde (PDMA). The absorbance of the solution was measured at 540 nm, and the collagen content of the tissue sample was calculated by multiplying the hydroxy proline content by the factor 7.46.39 Super oxide dismutase (SOD) content of tissue samples was measured by 19160 SOD determination kit (Fluka, USA) by following the manufacturer’s protocol. Furthermore, the catalase activity in erythrocytes and tissue was determined as described by Sinha et al.40 In brief, 450 μL of PBS was mixed with 50 μL of tissue homogenate, followed by the addition of 0.1 M H2O2. The tubes were allowed to stand for 1 min at room temperature. The reaction was stopped by the addition of potassium dichromate and acetic acid in the ratio 1:3. The tubes were kept in boiling water bath, and the absorbance was measured at 620 nm. 2.15. Statistics. Analysis of variance (one-way ANOVA) was used to determine the level of significance for the mechanical properties of the PHBV fibers and 2-D films (n = 6). Analysis of variance (two-way ANOVA) was used to evaluate the significance between the PHBV fibers and 2-D films (n = 3) for biodegradation, cell proliferation, gene expression, wound closure, and biochemical analysis. In both cases, the statistical significance was evaluated at p < 0.05. 3158
dx.doi.org/10.1021/bm200618w |Biomacromolecules 2011, 12, 3156–3165
Biomacromolecules
Figure 1. Scanning electron micrograph showing the surface morphology of (A) electrospun nonwoven PHBV fibers, (B) solvent cast PHBV 2-D film, and (C) histogram showing the PHBV fiber size distribution.
3. RESULTS 3.1. Physicochemical Characterization. The structure and surface morphology of PHBV fibers and 2-D film were observed under a scanning electron microscope (Figure 1A,B). The average diameter of the fibers obtained at 15% (w/v) polymer concentration was 724 ( 91 nm (Figure 1C). The tensile strength of PHBV fibers and 2-D film was found to be 1.42 ( 0.23 and 1.57 ( 0.58 MPa, respectively (Table 2). Young’s modulus of the PHBV fibers and 2-D film was found to be 1028 ( 201 and 5619 ( 986 MPa respectively (Table 2). PHBV fibers had a pore size 2.02 ( 0.05 μm and a porosity of 74.00 ( 1.31%, whereas the 2-D film exhibited a pore size 58.47 ( 3.1 nm and a porosity of 19.85 ( 0.51% (Table 2).
ARTICLE
Figure 2 shows the change in morphology and structure of PHBV fibers and 2-D film during biodegradation. Morphology of fibers was changed after the second week (Figure 2B), and the fiber integrity was completely lost after 5 weeks (Figure 2E). The appearance of tiny pores on the PHBV 2-D film was observed over the 5-week period (Figure 2FJ). There was a significant amount of weight loss in the PHBV fibers when compared with 2-D film after 1, 2, 3, 4, and 5 weeks (*p < 0.05) (Figure 3). 3.2. In Vitro Studies. Figure 4 shows the adhesion and proliferation of human skin fibroblast cells on PHBV fibers and 2-D film, respectively. The cells appeared to have spread morphology on the surface of PHBV fibers (Figure 4A1) when compared with spherical morphology on PHBV 2-D films (Figure 4A2) after 1 h of culture. By day 3, cells have completely covered the surface of the PHBV fibers (Figure 4E1). The cell proliferation was quantified by MTS assay, and the results indicate that cells on the surface of the PHBV fibers were comparable to TCPS after 7 days of culture (p > 0.05) (Figure 5). Figure 6A shows the confocal image of the cell viability test after 1 day of culture where live cells (stained green) have adhered to the PHBV fibers. The adhered cell morphology and cytoskeletal structure on the surface of PHBV fibers (Figure 6B1B3) and 2-D film (Figure 6C1C3) were qualitatively assessed after 1 day using a laser scanning confocal microscope. The results demonstrate that cells adhered and stretched along the fiber when compared with 2-D film. Figure 7 shows the gene expression profile of the human skin fibroblast cells cultured on PHBV fibers and 2-D film after 3, 7, and 14 days. Collagen I and III content was markedly increased after 7 days on the PHBV fibers, which is comparable to 2-D film. After 14 days of culture, significantly higher levels of elastin were expressed in 2-D film when compared with the fibers (*p < 0.05). 3.3. In Vivo Studies. The wound contracture was qualitatively and quantitatively assessed after 7 and 14 days post-surgery. Figure 8 shows the macroscopic image of the wound contracture for 14 days for all five groups. The wound was completely covered for group V (R-Spondin-1-loaded PHBV fibers) after 14 days (Figure 8E2). Quantitative assessment shows that wound closure was significantly higher in groups IV (R-Spondin 1 alone) and V (R-spondin-1-loaded-PHBV fibers) compared with other groups after 7 days (*p < 0.05) (Figure 9). However, there was no significant difference between the groups after 14 days (p > 0.05) (Figure 9). The histopathological images of the wound area are shown in Figure 10. Among the different groups, the skin sections of Group IV revealed more vascular and fibrous granulation tissue, indicating maximum healing, followed by Groups V, I, III, and II at the end of first week, whereas at the end of second week, all groups had progressed to late fibroblastic phase and wound contracture. Re-epithelialization was most pronounced in Group V, followed by Groups II, IV, III, and I. Figure 11 shows the total protein, collagen, SOD, and catalase content in the new tissue area. Protein concentration and collagen content were distinctly increased in negative and positive control at the later stage of wound contraction (2 weeks) when compared with groups IIIV (Figure 11A,B). Group V showed higher SOD activity (Figure 11C), whereas group III exhibited higher catalase activity (Figure 11D).
4. DISCUSSION Tissue engineering has emerged as an alternative strategy to conventional autografts and allografts, and it involves the use of 3159
dx.doi.org/10.1021/bm200618w |Biomacromolecules 2011, 12, 3156–3165
Biomacromolecules
ARTICLE
Table 2. Tensile Strength, Young’s Modulus, Porosity, and Pore Size of PHBV Fibers and Solvent Cast PHBV 2-D Film material
tensile strength (MPa)
Young’s modulus (MPa)
porosity (%)
pore size (μm)
PHBV fibers
1.40 ( 0.23
1028 ( 201
74.50 ( 1.31
2.0 ( 0.05
PHBV 2-D film
1.57 ( 0.58
5619 ( 986
19.85 ( 0.51
0.058 ( 0.003
Figure 3. Weight loss of PHBV fibers and solvent cast PHBV 2-D film over 5 weeks in phosphate-buffered saline at 37 °C; *p < 0.05.
Figure 2. Surface morphology of the degraded PHBV fibers and PHBV 2-D film after different time points. PHBV fibers after (A) 1; (B) 2; (C) 3, (D) 4, and (E) 5 weeks. PHBV 2-D films after (F) 1, (G) 2, (H) 3, (I) 4, and (J) 5 weeks.
scaffolds, cells, and biological factors alone or in combination.41 Fiber scaffolds have been extensively investigated as wound dressings because they protect the wound area from loss of fluid and proteins, aid in removal of exudates, inhibit microbes, and improve cell adhesion and proliferation.4244 PHBV, a biodegradable and biocompatible polyester has generated considerable interest as scaffolding material in tissue engineering approaches.18 The integration of the properties of PHBV and the advantages of fibrous geometry could provide a
better solution for skin tissue engineering. Electrospinning, a versatile tool for producing fibers, is influenced by a number of process and solution parameters. The choice of the solvent plays a key role in the achievement of defect-free fibers. PHBV dissolved in DCM when electrospun produced beaded fibers due to the lower dielectric constant of the solvent (data not shown). The addition of DMF possessing a higher dielectric constant resulted in defect-free fibers. The polymer concentration of 15% (w/v) produced defect-free fibers at 10 kV, 0.003 mL/min flow rate, and the tip-to-target distance of 12 cm. Higher concentrations of polymer increase the viscosity, resulting in greater defects and higher fiber dimensions, whereas low polymer concentrations produce discontinuous fibers due to insufficient viscosity. Higher flow rates impair effective volatilization of the solvent, resulting in defects, whereas lower flow rates promote solidification of the polymer in the syringe. Higher applied potentials increase the repulsive forces within the polymer droplet and reduce the effective solvent evaporation, leading to defects, whereas low potentials fail to provide adequate driving force to the polymer to reach the collector. Greater tip-to-target distances reduce the effective electric field, whereas smaller tip-totarget distances provide insufficient time for solvent evaporation. PHBV fibers exhibited lower tensile strength and Young’s modulus when compared with solvent-cast 2-D PHBV film. This suggests that PHBV fibers might be more elastic than the 2-D films and hence suitable for skin tissue engineering. Venugopal et al. have previously shown the efficacy of elastic poly(caprolactone) and poly(caprolactone)collagen nanofibrous coating for skin regeneration applications when compared with less elastic matrices.45 The increase in Young’s modulus for the PHBV film may be due to its greater thickness (0.2 mm) and lower porosity (19%) when compared with the fibers (0.12 mm and 74%). The lower tensile strength (1.4 MPa) and Young’s modulus of PHBV fibers were shown to promote cell adhesion and proliferation. This result is in concurrence with the conclusions arrived at by Bhattarai et al., who have shown that a nanofibrous scaffold of poly(p-dioxanone-co-L-lactide)-b-poly(ethylene glycol) with tensile strength 1.4 MPa supported fibroblast adhesion and proliferation.46 3160
dx.doi.org/10.1021/bm200618w |Biomacromolecules 2011, 12, 3156–3165
Biomacromolecules
ARTICLE
Figure 5. MTS assay showing the cell proliferation on PHBV fibers and PHBV 2-D film after 1, 3, and 7 days. TCPS used as control.
Figure 4. Cell adhesion of human skin fibroblasts on the surface of PHBV fibers and 2-D films. Scanning electron micrographs of cells attached on PHBV fibers after (A1) 1 h, (B1) 6 h, (C1) 12 h, (D1) 1 day, (E1) 3 days, and (F1) 7 days and on PHBV 2-D film after (A2) 1 h, (B2) 6 h, (C2) 12 h, (D2) 1 day, (E2) 3 days, and (F2) 7 days.
The degradation profile of the PHBV fibers was nearly twice as fast when compared with that of 2-D film after 5 weeks. The faster degradation of PHBV fibers when compared with 2-D film could be due to the greater surface area presented by the fibrous morphology, thereby increasing the number of reactive sites on the surface for hydrolysis. Also, the higher porosity of the PHBV
fibers (74%) increases water permeability and thereby the hydrolytic degradation, whereas the lower porosity restricts the degradation to the surface as in the case of PHBV film (19%). The difference in thickness of the PHBV fibers and film might have also contributed to faster degradation. Fibroblasts generally spread well in hydrophilic surfaces.47 However, the rate at which a monolayer of cells forms on a scaffold is influenced by the chemical, morphological, and mechanical properties of the scaffold. Fibrous scaffolds provide greater surface area and better contact guidance, which is reflected in the increased adhesion and spreading of fibroblasts in the fibrous mat within day 1 when compared with the film. These results are in agreement with those reported by Meng et al. for the proliferation of NIH-3T3 cells on PHBVgelatin scaffolds.48 The better oxygen permeability of PHBV and porosity of the fibrous mat aid nutrient diffusion, and hence a greater percentage of live cells is seen in the fibrous mat. The staining of the cytoskeletal protein actin and the membranecytoskeletal adaptor protein vinculin show the co-localization of these proteins as well as confirm the formation of focal adhesion complexes between the cells and the fibrous scaffold. The presence of vinculin indicates a high degree of cell adhesion and spreading on the scaffolds, implying the suitability of the PHBV fibers as extracellular mimics. The gene regulation studies after 14 days show an up-regulation of collagen I and elastin in both PHBV fibers and 2-D film, whereas collagen III is down-regulated in both types of scaffolds. Also, elastin content shows about five times higher expression in PHBV 2-D film when compared with PHBV fibers. This can be attributed to the greater stiffness of the film, which has stimulated higher expression of elastin to reduce stiffness and improve elasticity of the film. Increase in collagen I content is comparable in both PHBV fibers and 2-D film. Previous reports have shown that the collagen expression profile is regulated in a timedependent manner.49 Enhanced recruitment of fibroblasts on a scaffold initiates synthesis of ECM proteins. Because collagen is a major component of the ECM, this stimulus results in enhanced collagen levels. Dermal collagen comprises about 8090% collagen I and 1020% of collagen III.50 The role of collagen I and III is to enhance the mechanical strength of the affected wound area.51 The up-regulation of collagen I in our experiments confirms that the PHBV fibers mimic the extracellular environment of native skin. Collagen III levels are generally up-regulated in the early phase of wound healing and in mechanically poor tissues.52 The down-regulation of collagen III in both PHBV fibers and 2-D film indicates good mechanical properties imparted 3161
dx.doi.org/10.1021/bm200618w |Biomacromolecules 2011, 12, 3156–3165
Biomacromolecules
ARTICLE
Figure 7. Gene expression profile of (A) collagen type I, (B) collagen type III, and (C) elastin on nonwoven electrospun PHBV fibers and 2-D film; *p < 0.05.
Figure 6. Cell viability and cytoskeletal staining of human skin fibroblasts on PHBV fibers after 1 day. (A) Cell viability, (B1) cytoskeletal staining, (B2) actin staining, and (B3) merged image of (B1) and (B2). Cytoskeletal staining of human skin fibroblasts on PHBV 2-D film after 1 day (C1) cytoskeletal staining (C2) actin staining (C3) merged image of (C1) and (C2).
by the scaffolds as well as rapid cell proliferation in both cases. The gene expression results indicate the importance of mechanical properties of the scaffold in regulating gene expression and thereby functions of the cell. The in vivo experiments show that the wound contraction is enhanced significantly in the presence of R-Spondin 1 after 7 days in both the presence and absence of PHBV fibers. R-Spondin 1 is an activator of the Wnt/β catenin signaling pathway and can accelerate angiogenesis, which is a key stage in the wound healing process. Therefore, incorporation of R-Spondin 1 results in accelerated wound healing, even in the absence of a scaffold. However, histopathological observations reveal that the presence
of PHBV fibers promotes re-epithelialization in the presence of R-Spondin 1, implying that the fiber geometry aids recruitment of fibroblasts to the site of injury. The reports available on in vivo studies using various growth factors remain unclear about the role of the growth factor in altering the cell metabolism.28 To understand the role of the growth factors, there exists a need to investigate the wound healing induced by the growth factor using biochemical assays in the newly regenerated tissue. Collagen is the predominant ECM protein in the granulation tissue of a healing wound. Collagen expression levels are reported to increase rapidly in the wound area, which contributes to the strength and integrity of the tissue matrix.53,54 Free radicals and oxidative reaction products have been proven to cause extensive tissue damage, especially in connective tissue disorders like fibrosis as well as during wound healing.53,55 Overproduction of free radicals leads to oxidative stress, thereby causing cytotoxicity and delayed wound healing.56 Hence the estimation of SOD and catalase in the newly regenerated tissue becomes important because these antioxidants accelerate the process of wound healing, thereby destroying the free radicals.57 The biochemical parameters show no change 3162
dx.doi.org/10.1021/bm200618w |Biomacromolecules 2011, 12, 3156–3165
Biomacromolecules
ARTICLE
Figure 9. Wound contraction over a period of 14 days for various groups (Group I, negative control; Group II, positive control; Group III, PHBV fibers; Group IV, R-Spondin 1 alone; and Group V, PHBV fibers with R-Spondin 1); *p < 0.05.
Figure 8. Macroscopic image of the wound contracture over time for all five groups. (A1) 1 week and (A2) 2 weeks of negative control; (B1) 1 week and (B2) 2 weeks of positive control; (C1) 1 week and (C2) 2 weeks of PHBV fibers; (D1) 1 week and (D2) 2 weeks of R-Spondin 1; and (E1) 1 week and (E2) 2 weeks of PHBV fibers loaded with R-Spondin 1.
in the collagen content after 14 days in the R-Spondin-1-treated groups, indicating that the primary role of the growth factor is to promote angiogenesis, whereas the presence of a scaffold or ECM is necessary to increase collagen levels. Enhancement in SOD activity in the scaffold and growth-factor-treated groups indicates high levels of free radical scavenging and anti-oxidant
Figure 10. Histopathological images showing the hematoxylin and eosin stain after 1 and 2 weeks of implantation for the five groups. (A1) 1 week and (A2) 2 weeks of negative control; (B1) 1 week and (B2) 2 weeks of positive control; (C1) 1 week and (C2) 2 weeks of PHBV fibers; (D1) and (D2) 2 weeks of R-Spondin 1; (E1) 1 week and (E2) 2 weeks of PHBV fibers loaded with R-Spondin 1 (F: fibrous granulation tissue; R: re-epithelialization; T: thrombus; P: polymorphonuclear leucocytes; E: fibrinous exudates; V: vascular granulation tissue). 3163
dx.doi.org/10.1021/bm200618w |Biomacromolecules 2011, 12, 3156–3165
Biomacromolecules
ARTICLE
Figure 11. Biochemical parameters of newly regenerated tissue of various groups: (A) total protein content, (B) collagen content, (C) SOD activity, and (D) catalase activity.
activity, which are hallmark of rapid wound healing. The relatively higher amount of catalase, a hydrogen peroxide scavenging enzyme, seen in the PHBV fiber scaffold at the end of both 7 and 14 days implies an increase in hydrogen peroxide levels at the site of injury. Hydrogen peroxide is a messenger for dermal wound healing and promotes the participation of two key activators of angiogenesis, namely, VEGF and basic fibroblast growth factor (FGF2).58 R-Spondin-1-treated groups also show increased catalase activity after 14 days. This may be due to the promotion of angiogenesis by R-Spondin 1. In the case of PHBV fibers alone, it is possible that the geometry could have promoted greater recruitment of fibroblasts, thereby retarding angiogenesis. Therefore, the results demonstrate that successful skin tissue engineering and wound healing requires a combination of material, geometry, mechanical, and chemical stimuli. This is in accordance with previous reports that show that topography and mechanical and chemical stimuli are known to affect the cell metabolism.59,60
’ AUTHOR INFORMATION
5. CONCLUSIONS Electrospun PHBV fibers were optimized to obtain defect-free morphology with an average fiber diameter of 724 ( 91 nm and possess marked similarities to the natural ECM. The fibrous morphology promoted bulk degradation of the scaffold, which was significantly quicker than the 2-D film. The expression profiles of collagen I, collagen III, and elastin were markedly changed after 3 days, which confirmed that cell proliferation was high. The presence of R-Spondin 1, an angiogenesis-promoting growth factor, along with fibrous scaffold accelerated wound contraction within 7 days. Histological studies revealed that R-Spondin-1-loaded fibrous scaffold promotes the re-epithelization. Biochemical parameters like total protein, collagen content,
’ REFERENCES
SOD, and catalase activity were markedly different between groups. These studies clearly demonstrate that fibrous scaffolds significantly alter the cell behavior and perform better as scaffold materials to regenerate the tissues in the presence of suitable growth factors. The results also demonstrate the influence of mechanical properties of the scaffold on the expression of ECM proteins that can influence the extent and rate of regeneration of skin tissue.
Corresponding Author
*E-mail:
[email protected]. Tel: + 91 4362 264220. Fax: + 91 4362 264265.
’ ACKNOWLEDGMENT We acknowledge the Nano Mission Council (SR/S5/NM-07/ 2006 & SR/NM/PG-16/2007), Department of Science & Technology, India, and FIST, Department of Science & Technology, India (SR/FST/LSI-327/2007) for the financial support. The joint financial support from the Drugs & Pharmaceuticals Research Programme, Department of Science & Technology, India, and SASTRA University for the Central Animal Facility is also acknowledged.
(1) Groeber, F.; Holeiter, M.; Hampel, M.; Hinderer, S.; SchenkeLayland, K. Adv. Drug Delivery Rev. 2011, 63, 352–366. (2) Ben-Bassat, H.; Chaouat, M.; Segal, N.; Zumai, E.; Wexler, M. R.; Eldad, A. Burns 2001, 27, 425–431. (3) Heunis, T. D. J.; Dicks, L. M. T. J. Biomed. Biotechnol. 2010, 2010, 1–10. 3164
dx.doi.org/10.1021/bm200618w |Biomacromolecules 2011, 12, 3156–3165
Biomacromolecules (4) Ma, L.; Gao, C.; Mao, Z.; Zhou, J.; Shen, J.; Hub, X.; Han, C. Biomaterials 2003, 24, 4833–4841. (5) Katti, D. S.; Laurencin, C. T. In Structure Property Relationship; Advani, S. G., Shonaike, G. O., Eds.; CRC Press: Boca Raton, FL, 2003; p 479. (6) Li, W. J.; Laurencin, C. T.; Caterson, E. J.; Tuan, R. S.; Ko, F. K. J. Biomed. Mater. Res. 2002, 60, 613–621. (7) Dhandayuthapani, B.; Krishnan, U. M.; Sethuraman, S. J. Biomed. Mater. Res., Part B 2010, 94, 264–272. (8) Vitte, J.; Benoliel, A. M.; Pierres, A.; Bongrand, P. Eur. Cells Mater. 2004, 7, 52–63. (9) Karuri, N. W.; Liliensiek, S.; Teixeira, A. I.; Abrams, G.; Campbell, S.; Nealey, P. F.; Murphy, C. J. J. Cell Sci. 2004, 117, 3153–3164. (10) Glass-Brudzinski, J.; Perizzolo, D.; Brunette, D. M. J. Biomed. Mater. Res. 2002, 61, 608–618. (11) Dalby, M. J.; Yarwood, S. J.; Riehle, M. O.; Johnstone, H. J.; Affrossman, S.; Curtis, A. S. Exp. Cell Res. 2002, 276, 1–9. (12) Chou, L.; Firth, J. D.; Uitto, V. J.; Brunette, D. M. J. Biomed. Mater. Res. 1998, 39, 437–445. (13) Hogge, J.; Krasner, D.; Nguyen, H.; Harkless, L. B.; Armstrong, D. G. J. Am. Podiatric Med. Assoc. 2000, 90, 57–65. (14) O’Meara, S.; Cullum, N.; Majid, M.; Sheldon, T. Health Technol. Assess. 2000, 4, 1–237. (15) Huang, Z. M..; Zhang, Y. Z.; Kotaki, M.; Ramakrishna, S. Compos. Sci. Technol. 2003, 63, 2223–2253. (16) Subramanian, A.; Krishnan, U. M.; Sethuraman, S. J. Biomed. Sci. 2009, 16, 1–11. (17) Subramanian, A.; Krishnan, U. M.; Sethuraman, S. Biomed. Mater. 2011, 6, 1–10. (18) Han, I.; Shim, K. J.; Kim, J. Y.; Im, S. U.; Sung, Y. K.; Kim, M.; Kang, I.; Kim, J. C. Artif. Organs 2007, 31, 801–808. (19) Sethuraman, S.; Nair, L. S.; El-Amin, S.; Nguyen, M. T.; Singh, A.; Greish, Y. E.; Allcock, H. R.; Brown, P. W.; Laurencin, C. T. J. Biomater. Sci., Polym. Ed. 2011, 22, 733–752. (20) Meng, W.; Kim, S.; Yuan, J.; Kim, J. C.; Kwon, O. H.; Kawazoe, N.; Chen, G.; Ito, Y.; Kang, I. J. Biomater. Sci., Polym. Ed. 2007, 18, 81–94. (21) Lee, I. S.; Kwon, O. H. Macromol. Res. 2004, 12, 374–378. (22) Ito, Y.; Hasuda, H.; Kamitakahara, M.; Ohtsuki, C.; Tanihara, M.; Kang, I.; Kwon, O. H. J. Biosci. Bioeng. 2005, 100, 43–49. (23) Sombatmankhong, K.; Suwantong, O.; Waleetornceepsawat, S.; Supaphol, P. J. Polym. Sci., Part B: Polym. Phys. 2006, 44, 2923–2933. (24) Ndreu, A.; Nikkola, L.; Ylikauppila, H.; Ashammakhi, N.; Hasirci, V. Nanomedicine 2008, 3, 45–60. (25) Kwon, K. I.; Kidoaki, S.; Matsuda, T. Biomaterials 2005, 26, 3929–3939. (26) Harding, K. G.; Morris, H. L.; Patel, G. K. BMJ [Br. Med. J.] 2002, 324, 160–163. (27) Metcalfe, A. D.; Ferguson, M. W. J. J. R. Soc. Interface 2007, 4, 413–437. (28) Werner, S.; Grose, R. Physiol. Rev. 2003, 83, 835–870. (29) Lowther, W.; Wiley, K.; Smith, G. H.; Callahan, R. J. Virol. 2005, 79, 10093–10096. (30) Kim, K. A.; Zhao, J.; Andarmani, S.; Kakitani, M.; Oshima, T.; Binnerts, M. E.; Abo, A.; Tomizuka, K.; Funk, W. D. Cell Cycle 2006, 5, 23–26. (31) Kim, K.; Wagle, M.; Tran, K.; Zhan, X.; Dixon, M. A.; Liu, S.; Gros, D.; Korver, W.; Yonkovich, S.; Tomasevic, N.; Binnerts, M.; Abo, A. Mol. Biol. Cell 2008, 19, 2588–2596. (32) Logan, C. Y.; Nusse, R. Annu. Rev. Cell Dev. Biol. 2004, 20, 781–810. (33) Moon, R. T.; Kohn, A. D.; De Ferrari, G. V.; Kaykas, A. Nat. Rev. Genet. 2004, 5, 691–701. (34) Kazanskaya, O.; Ohkawara, B.; Heroult, M.; Wu, W.; Maltry, N.; Augustin, H. G.; Niehrs, C. Development 2008, 135, 3655–3664. (35) Sethuraman, S.; Nair, L. S.; El-Amin, S.; Nguyen, M.; Singh, A.; Krogman, N.; Greish, Y. E.; Allcock, H. R.; Brown, P. W.; Laurencin, C. T. Acta Biomater. 2010, 6, 1931–1937.
ARTICLE
(36) Mohammed, S. P.; Prabu, P. C.; Panchapakesan, S.; Ramanathan, A. Indian J. Vet. Pathol. 2010, 34, 69–75. (37) Doumas, B. T.; Watson, W. A.; Biggs, A. G. Clin. Chim. Acta 1971, 31, 87–96. (38) Nayak, B. S.; Sandiford, S.; Maxwell, A. eCAM 2009, 6, 351–356. (39) Madden, J. W.; Chvapil, M.; Carlson, E. C.; Janet, N. R. Toxicol Appl. Pharmacol. 1976, 26, 426–437. (40) Sinha, A. K. Anal. Biochem. 1972, 47, 389–394. (41) MacNeil, S. Nature 2007, 445, 874–880. (42) Khil, M. S.; Cha, D. I.; Kim, H. Y.; Kim, I. S.; Bhattarai, N. J. Biomed. Mater. Res., Part B 2003, 67, 675–679. (43) Zhang, Y.; Lim, C. T.; Ramakrishna, S.; Huang, Z. M. J. Mater. Sci.: Mater. Med. 2005, 16, 933–946. (44) Zong, X.; Li, S.; Chen, E.; Garlick, B.; Kim, K. S.; Fang, D.; Chiu, J.; Zimmerman, T.; Brathwaite, C.; Hsiao, B. S.; Chu, B. Ann. Surg. 2004, 240, 910–915. (45) Venugopal, J.; Ma, L. L.; Ramakrishna, S. Tissue Eng. 2005, 11, 847–854. (46) Bhattarai, S. R.; Bhattarai, N.; Yi, H. K.; Hwang, P. H.; Cha, D. I.; Kim, H. Y. Biomaterials 2004, 25, 2595–2602. (47) Yuan, J.; Xing, Z. C.; Park, S. W.; Geng, J.; Kang, I. K. Macromol. Res. 2009, 17, 850–855. (48) Meng, W.; Xing, Z. C.; Jung, K. H.; Kim, S. Y.; Yuan, J.; Kang, I. K.; Yoon, S. C; Shin, H. I. J. Mater. Sci.: Mater. Med. 2008, 19, 2799–2807. (49) Scharffetter, K.; Stolz, W.; Lanket-Buttgereit, B.; Hatamochi, A.; Sohnchen, R.; Krieg, T. J. Invest. Dermatol. 1989, 93, 405–412. (50) Monaco, J. L.; Lawrence, W. T. Clinics Plast. Surg. 2003, 30, 1–12. (51) Mariggio, M. A.; Cassano, A.; Vinella, A.; Vincenti, A.; Fumarulo, R.; Muzio, L. L.; Maiorano, E.; Ribatti, D.; Favia, G. Int. J. Immunopathol. Pharmacol. 2009, 22, 485–492. (52) Barnes, M. J.; Morton, L. F.; Bennett, R. C.; Bailey, A. J.; Sims, T. J. Biochem. J. 1976, 157, 263–266. (53) Agarwal, P. K.; Singh, A.; Gaurav, K.; Goel, S.; Khanna, H. D.; Goel, R. K. Indian J. Exp. Biol. 2009, 47, 32–40. (54) Panchatcharam, M.; Miriyala, S.; Gayathiri, V. S.; Suguna, L. Mol. Cell. Biochem. 2006, 290, 87–96. (55) Senel, O.; Cetinkale, O.; Ozbay, G.; Ahcioglu, F.; Bulan, R. Ann. Plast. Surg. 1997, 39, 516–523. (56) Dissemond, J.; Goos, M.; Wagner, S. N. Hautarzt 2002, 53, 718–723. (57) Halliwell, B.; Grootveld, M.; Gutteridge, J. M. Methods Biochem. Anal. 1988, 33, 59–90. (58) Roy, S.; Khanna, S.; Nallu, K.; Hunt, T. K.; Sen, C. K. Mol. Ther. 2006, 13, 211–220. (59) Kumbar, S. G.; Nukavarapu, S. P.; James, R.; Nair, L. S.; Laurencin, C. T. Biomaterials 2008, 29, 4100–4107. (60) Kumbar, S. G.; James, R.; Nukavarapu, S. P.; Laurencin, C. T. Biomed. Mater. 2008, 3, 034002.
3165
dx.doi.org/10.1021/bm200618w |Biomacromolecules 2011, 12, 3156–3165
