Environ. Sci. Technol. 2009, 43, 3789–3795
Diagnosis of Treatment Efficiency in Industrial Wastewater Treatment Plants: A Case Study at a Refinery ETP ATYA KAPLEY* AND HEMANT J PUROHIT Environmental Genomics Unit, National Environmental Engineering Research Institute, (CSIR), Nehru Marg, Nagpur 440020, Maharashtra, India
Received November 21, 2008. Revised manuscript received April 1, 2009. Accepted April 6, 2009.
Many industries employ the activated sludge process for biological removal of pollutants present in wastewater. Yet, treatmentplantsdonotfunctionatoptimumpotential.Thebiological component of such systems remains a black box, and reasons responsible for poor performance have not been identified. We have used genomic and physiological tools to understand the process and propose that analysis of catabolic signatures and nutrient levels, are crucial parameters in assessing and monitoring the performance of an effluent treatment plant. In this study, we use activated sludge collected from a refinery running at a capacity of 8 million metric tonnes of wastewater as a model. The presence of hydroxylases, oxygenases, and dioxygenases in the biomass was demonstrated by polymerase chain reaction and sequence analysis of aromatic-ring hydroxylating dioxygenase clones extracted from the metagenome, suggests the presence of hitherto unreported enzymes. The actual degradative state of the biomass was demonstrated by respirometric analysis using 11 substrates expected in refinery wastewater. Nutrient-levels required for the microbial population were estimated by onsite analysis. Diagnosis of the degradative potential of activated sludge can be carried out by incorporating these tools in regular monitoring procedures and can set the rules for improving the efficiency of treatment.
Introduction Industrial wastewater contains highly toxic compounds that lead to pollution of the soil and groundwater and cause perturbations in the ecosystem as well as serious health problems (1).Today, activated sludge systems represent a widely used technology for biological and advanced wastewater treatment (2). Yet, the process seldom reaches the required degree of performance and release of partially treated wastewater has been shown to induce myriad problems including genotoxicity (3). Hence it is important to analyze the parameters influencing the degradative capacity of the biomass. A generalized scheme has been presented in Figure 1 that describes the scenario faced by the microbial population in an ETP treating industrial wastewater. The three-member panel on the left indicate the inputs that go into the biological unit of the effluent treatment plant (ETP), the activated sludge * Corresponding author phone/fax: +91 712 2249883; e-mail:
[email protected] or
[email protected]. 10.1021/es803296r CCC: $40.75
Published on Web 04/22/2009
2009 American Chemical Society
process. The carbon source is the wastewater that needs to be degraded; the nitrogen and phosphate sources are usually supplemented in the treatment plant in the mixing chamber and the unit is aerated to support aerobic degradation. The outcome of the degradation process is indicated in the righthand panel. If the ETP was performing efficiently, it would result in the “ideal scenario” viz. complete mineralization of the pollutants in the wastewater. However, in such complex ecosystems, degradation is never complete since the microbial community does not operate under optimum conditions. The carbon loads are not constant; they depend on the production schedule of the industry; contaminants like heavy metals or trace chemicals could be toxic to the microflora; nutrient levels may not be balanced and sudden shock loads are detrimental to performance of the biomass. This paper analyzes parameters that control the degradative capacity of the biomass (shown in square brackets in the figure) using respirometry and molecular tools. Most reports on activated biomass only describe the microbial diversity of such niches (4-6). While taxonomic data has greatly improved our knowledge, it does not give direct information on the degradative capacity or performance of the biomass. The performance of an (ETP) is decided by the catabolic potential of the microbial population (7, 8). Currently, very little is known about the relationship between microbial community function and performance of the ETP and it is essential that we understand the catabolic capacity of the system (8, 9). The advent of molecular tools in analysis of environmental samples opened a new window to study the unculturable population of any niche (10, 11). But reports of functional genes have been fewer (12-15). More recently, the analysis of protein profiles have been used to study the functional relevance of activated sludge (16). When Handelsman coined the word “metagenomics”, a Pandora’s box was opened and radically changed the way we visualize the microbial world. The functional driven approach mainly reports the discovery of new antibiotics and enzymes (17-19). Functional analysis of wastewater treatment by sampling from the metagenome has been carried out largely in the municipal/sewage wastewater systems (16, 20). Wastewater generated at industries is more complex, since it contains various xenobiotics, high salt concentrations, and varying organic loadings, making the treatment process more difficult. Even with the use of sophisticated new tools, a number of questions remain unanswered. For example, does the biomass contain the required genotype to carry out degradation of the wastewater? Even if the genotype is present, is the physiological state of the sludge favorable to allow degradation? Is the microbial community in lag phase or in degradative mode? This paper addresses these questions and suggests a strategy for improvement of treatment efficiency in an ETP.
Experimental Section Collection of Activated Biomass. Activated biomass was collected from an ETP treating wastewaters generated at a petroleum refinery in North India. The ETP runs at a capacity of 8 million metric tonnes per day and uses a combination of chemical and biological treatment. Biomass was collected from the activated sludge unit from nine different points and pooled to represent a homogeneous sample, as described earlier (6). The pooled biomass was allowed to stand for 10 min to allow settling. One liter settled biomass was collected in a 5 L collection bottle and layered with 1 L of wastewater from the ETP, and brought to the laboratory on ice within 4 h. VOL. 43, NO. 10, 2009 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
3789
FIGURE 1. Degradation scenario faced by the microbial community in ETP The diagram depicts the scenario faced by the microbial population of activated biomass in an industrial wastewater treatment plant. The three-member panel on the left describe the inputs that go into the activated sludge system and the stress factors related to each input are indicated in square brackets. The two-member panel on the right describes the two possible outcomes of the wastewater treatment process. represents the aerator in the unit. The figure showing the biological unit is not drawn to scale. It represents the ETP of a refinery running at a capacity of 8 million metric tonnes of wastewater. Catabolic Analysis of Activated Biomass Using PCR. Metagenomic DNA was prepared from the biomass by a method described earlier for extraction of PCR compatible DNA from activated biomass (21). This protocol uses organic solvent extraction with mild detergent treatment to remove various organics from the sample. DNA was prepared from five replicates and pooled. 100 µL aliquots were stored at -20 °C until required. We used 5 µL of DNA in the PCR reaction to detect the following gene loci; alkB, ARDHO, bedA, catechol 2,3-dioxygenases (C23DO), dmpN, nahG, pheA, pheB, tcbC, and xylE. Primer details and PCR data are described in Table 1. PCR protocols can be viewed in the Supporting Information. Catabolic Analysis of Activated Biomass Using Respirometric Analysis. 50 mg of activated biomass was used for oxygen uptake with 1.0 mM substrate. The substrates used were biphenyl, benzoate, catechol, dibenzothiophene, fluorene, naphthalene, octacosane, phenol, salicylate, tetracosane, and toluene. The oxygen uptake rates were determined in the oxygen chamber of a digital oxygen system (model 10, Rank Brothers, Bottisham, U.K.) as described earlier (22). Oxygen uptake was performed in triplicate for each substrate. Sequence Analysis of Aromatic-Ring Hydroxylating Dioxygenase (ARHDO) in the Metagenome. ARHDO gene was amplified from the metagenome in 10 replicates, using primers described in Table 1. The 730 bp amplicon was gel purified using the gel extraction kit from Qiagen (Qiagen, Germany) and cloned into the pDrive cloning vector (Qiagen PCR Cloning Plus Kit). Recombinant clones were initially screened by blue-white colony selection on LB-agar plates containing 100 µg mL-1 ampicillin. Transformants were grown overnight in 5 mL LB medium containing 100 µg mL-1 ampicillin, and used for plasmid DNA preparation using Qiagen Plasmid Preparation Kit (Q-20 columns). Clones were sequenced from the 5′ end using the T7 or SP6 primer, and sequence data was analyzed by BLAST to identify the corresponding clones. Sequences were deposited in GenBank and accession numbers FJ172425-FJ172444 (shown in square brackets in Figure 2 and can be viewed at http://www. ncbi.nlm.nih.gov/. A phylogenetic tree was constructed using the Bootstrap Tree method from Clustal X software. The method involves aligning sequences using the Neighbor Joining (N-J) method. 3790
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 43, NO. 10, 2009
First, the nucleotide sequences were aligned and distances were calculated (percent divergence) between all pairs of sequences from a multiple alignment. Finally, the N-J method was applied to the distance matrix. The tree was created using 1000 iterations. Biphenyl-2,3-diol-1,2 dioxygenase (bphC) gene from Pseudomonas sp. was used as outgroup in tree construction (accession no. X66122). Analysis of Nutrient Levels in the ETP. Analysis of nutrients in terms of phosphate, and nitrogen, in different ionic state (NO2-, NO3- and NH4+), were monitored on-site in the wastewater treatment system. The study was carried out for three consecutive days at an interval of one month between each analysis. Data for three months was monitored. One liter sample from the center of the activated biomass unit was withdrawn and allowed to settle for 10 min. The supernatant was used to measure nutrient concentration with commercially available kits (Merck, Germany) as per the manufacturer’s instructions. The role of phosphate in biological activity in the treatment plant was analyzed by offline analysis. One liter sample was withdrawn as described and transferred into a conical flask so as to contain 3500 MLSS (mixed liquor suspended solids). Five mg L-1 of diammonium phosphate was added and the contents stirred. Samples were withdrawn every 30 min for 2.5 h and levels of nitrite, nitrate, ammonium, and phosphate were assayed using Merck kits. In a separate experiment, respirometric analysis was carried out 2.5 h after supplementation of phosphate source as described above, using 1 mM biphenyl, phenol, and toluene as substrates.
Results Analysis of Catabolic Functions Present in the ETP. The degradative potential of the biomass was assessed using two different tools; molecular and physiological. Molecular tools, like PCR were used to assess the inherent genotype, while physiological tools, like respirometric analysis were used to assess the catabolic state of the biomass. Table 1 describes the results of catabolic analysis. Gene loci detected in the biomass were; dmpN and pheA, that are a part of the phenol degrading operons; C23O and xylE, that code for catechol 2,3 dioxygenase from different operons; bedA (benzene dioxygenase), and ARHDO (aromatic-ring hydroxylating dioxygenases). Catechol 1,2-dioxygenase activity, represented by the genotypes tcbC and pheB was not detected, nor were
VOL. 43, NO. 10, 2009 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
3791
phenol monooxygenase; pheA
catechol 2,3-dioxygenase (C23O)
catechol 2,3-dioxygenase from the xylE operon; xylE
chloro catechol 1,2-dioxygenase, tcbC
catechol 1,2-dioxygenase from the phenol degradative operon; pheB
alkane hydroxylase; alkB
benzene dioxygenase; bedA
salicylate hydroxylase (from the nah operon), nahG
aromatic-ring hydroxylating dioxygenase, ARHDO
2.
3.
4.
5.
6.
7.
8.
9.
10.
negative negative
R 5′ GGTCCGGGTAGTTGTAATCTCCAC 3 F 5′GTITGGTACTCGAGGCCCGAIG 3′
R 5′ GCAAGCTTCGAAGTAGTAITGTG 3′ F 5′ TGGGAATTCATCACAACGACAA 3′
R: 5′- ACGTGCTGGATCTCGACCCAGTTCTCGCCGTCGTCCTG-3′
F: 5′-GGAGACCTACAAGGGCCTGATTTTCGCCAACTGGGA-3′
R 5′ AAGGCCTCTTACCCTTG 3′
F 5′ACGTGAATTCCATGAACGACATGAACGCT 3′
R 5′TCIGCGGIIAICTTCCAGTTGC 3′
F 5′TGCAGYTAICACGGYTGGG 3′
R 5′GAGTGCCGCTGAAGGTGGAACA 3′
F 5′CCGCTCCAGAGTACGTAGATAAAA 3′
positive
negative
positive
negative
positive
C230R′ 5′-TCAGGTCAGCACGGTCA -3′ F 5′ AGGGCCGCGTCTATCTGAAG 3′
R 5′ GTGCCGGATCCCTGACTTTCTT 3′
positive
positive
R 5′-GTATTTCGGCGGCCGCATGCCATAGC-3′ pheA1 5′ -AAATGCATGCTTGGCGCTGATGGTGC-3′ pheA2 5′-CGGATGCATATGGAT TGCATCACCGGC-3′
C230F- 5′-CGACCTGATCTCCATGACCGA-3′
positive
PCR result
F 5′-CAT GACTTCGCCCATATGTACGACC-3′
PCR primer
* Benzene is carcinogenic and hence has not been used in respirometric analysis.
phenol hydroxylase; dmpN
catabolic gene loci
1.
S.No.
TABLE 1. Catabolic Potential of the Activated Biomass Analyzed by PCR and Respirometric Analysis
dibenzothiophene biphenyl
fluorene
salicylate
naphthalene
*
octacosane
tetracosane
4-chlorophenol
toluene catechol
benzoate
phenol
representative substrate used in respirometry
19.4 ( 0.50 10.22 ( 0.89
6.46 ( 1.52
12.93 ( 1.03
6.46 ( 1.91
10.77 ( 0.25
0.0
5.6 ( 1.51
25.86 ( 0.54 193.95 ( 1.52
20.78 ( 0.52
89.8 ( 1.17
respirometric analysis data (nmoles of O2/min/50 mg biomass)
23
13
26
26
13
29
13
25
12
12
primer reference
FIGURE 2. Phylogenetic tree showing the relationship of ARDHO clones, HKHDO1-HKHDO20, from the metagenome of a refinery wastewater treatment plant. The accession numbers for all sequences used in tree construction are given in square brackets. The tree was constructed using Clustal-X software. Bootstrap (1000 iterations) values are given. Bar, 10% shows estimated sequence divergence. Control sequences used were downloaded from GenBank. BhpC gene was used as outgroup in tree construction. alkB and nahG loci from the alkane and naphthalene degrading pathways. Figure 2 demonstrates the genetic diversity of ARHDOs sampled from the ETP metagenome. ARHDO primers were constructed from gene fragments which predominantly dioxygenate benzene or benzene derivatives and hence diversity analysis was carried out (23). BLAST analysis indicates >90% identity of all 20 clones to the biphenyl dioxygenase system of Pseudomonas and Ralstonia (bphA, bphB, and bphC) and to a synthetic construct of bphA gene. Clone HKHDO20 shows 91% homology to Pseudomonas sp. Cam-1 bph operon (AY027651) and a similarity index of 73.3 to chlorobenzene dioxygenase from Acidovorax sp. (AY554272). 3792
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 43, NO. 10, 2009
Even though all clones show >90% sequence homology to the bhp genes, the sequences are grouped into two clusters, as seen in Figure 2. Only two clones, HKHDO2 and HKHDO20 cluster with bhp genes from culturable bacteria. The other 18 clones form a different cluster, suggesting the presence of hitherto unreported or novel enzymes. In complex systems, like ETPs, where the microbial population survives in stress conditions, the presence of a genotype is not enough to guarantee expression of the degradative potential. The actual catabolic activity of the biomass can be assessed by respirometric analysis. Eleven substrates were chosen to represent pollutants expected in refinery wastewater and target genes used in PCR analysis.
FIGURE 3. Catechol as a key intermediate in degradation of aromatics. (A) Phenol conversion by phenol hydroxylase (30); (B) naphthalene degradation via nah operon (31); (C) Fluorene to catechol by Arthrobacter sp (32); (D) Biphenyl to catechol via benzoate (33); Dibenzothiphene to catechol via biphenyl (34). Results, shown in Table 1, demonstrate that the highest oxygen uptake rates were observed when catechol was used as a substrate. All other substrates showed lesser activity, in the range of 7.5-24.7 times less than catechol. No oxygen uptake was observed when tetracosane was used as a substrate. Since the highest oxygen uptake was observed when catechol was used as substrate, this data suggests that the possible aerobic degradative route for aromatic degradation in this treatment plant is channeled via catechol as represented in Figure 3. The activity of catechol 1,2dioxygenases was not observed by this analysis, validating the PCR data. Nutrient Levels in the ETP. Bacterial cell growth mainly requires carbon, nitrogen, and phosphorus. In a wastewater treatment plant, the compounds in the wastewater act as carbon source for the bacterial community in the activated biomass. Nitrogen and phosphate are supplemented in this ETP. Utilization of these two nutrients is also an indicator of biological activity. We monitored the nitrogen and phosphate levels in the ETP, over a period of time, and found very low concentration of phosphate (1 mg L-1). Off-line experiments were conducted to study biological activity with reference to change in concentration of nutrient. Biomass was spiked with phosphate to get a concentration of 5 mg L-1, and phosphate, ammonia, nitrate, and nitrite levels were monitored over a period of 2.5 h. Results, shown in Figure 4A, indicate that there was no activity of the biomass after spiking for 1.5 h, after which, nitrate and nitrite levels increased, whereas ammonia and phosphate levels decreased in the next hour. Nitrate levels increase from 15 to 21 mg L-1, nitrite levels increased from 1 to 5 mg L-1, whereas ammonium levels decreased from 15 to 11 mg L-1 and phosphate levels decreased from 5 to 1 mg L-1. This indicates that the biomass was initially in a lag phase, but after 1.5 h, it utilized the supplemented phosphate for bacterial activity and
ammonia was first oxidized to nitrite and subsequently, nitrite was oxidized to nitrate, as reported in ref 24. No change in the nutrient levels was observed henceforth. This could be due to the fact that depletion of phosphate levels meant lack of nutrients for further activity. To establish the correlation of nutrients with catabolic activity of the biomass, we performed oxygen uptake with three substrates, biphenyl, phenol, and toluene (1 mM), before spiking and 2.5 h after spiking phosphate. Results are shown in Figure 4B. Respirometric activity increases after addition of phosphate source indicating that the ETP biomass was in a state of nutrient starvation.
Discussion Rapid growth of the industrial sector has greatly improved quality of life, but has also contributed largely to environmental pollution. This is more so in developing countries where the rules for safe disposal are not stringent. Hence, it is very crucial to develop methods that can improve the efficiency of the treatment process. We have approached this issue, by focusing on the degradative potential of the activated biomass, which is controlled, among other factors, by three key parameters; presence of required genotype, physiological manifestation of catabolic potential and nutrient availability for microbial activity. The tools used to analyze these three parameters are simple and can easily be adapted to industries and operated by laypersons too. We have conducted experiments on-site, to minimize the drawbacks of extending a laboratory-scale study into industrial application. The catabolic genotype and substrates for respirometric assays to be assessed will depend on the nature of the industry generating the waste. Since industrial wastewater contains a very wide range of compounds, it may not be economically VOL. 43, NO. 10, 2009 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
3793
FIGURE 4. On-site analysis demonstrating effect of addition of nutrient (phosphate) in activated biomass of the refinery treatment plant. Panel 4A demonstrates the change in nutrient levels as demonstrated by off-line experiments carried out at the refinery premises. Panel 4B demonstrates the improved efficiency of the catabolic potential of the sludge after spiking phosphate by comparing the respirometric analysis of activated biomass before and after nutrient supplementation. The horizontal bars indicate oxygen uptake of biomass before spiking phosphate and vertical bars indicate oxygen uptake of biomass after spiking phosphate. feasible for an industry to assess all catabolic genotypes involved in degradation. We suggest that it would be practical to first identify the key molecules in the wastewater and then select target genotypes. In addition, the primers chosen may not be adequate for the alleles present in the activated sludge, but a trial and error method would have to be worked out on a case to case basis that represents the maximum pollutant removal levels. This study involves wastewater generated at a refinery, and hence, target genes were selected to represent compounds found in refinery wastewater. Pollutants widely reported in refinery wastewater (e.g., phenol (12), benzene, and naphthalene (13)) were represented by the genotypes dmpN, pheA, bedA, and nahG, respectively. Catechol 2,3and 1,2- dioxygenases from xylE, tcbC, and phe B were selected since aerobic degradation is channeled via catechols (Figure 3). C23O primers were selected since they have been reported to detect and enumerate the genes that have at least one reported catechol 2,3-dioxygenase pathway for biodegradation of compounds like benzene, toluene, xylenes, phenol, naphthalene, and biphenyl; all of them are compounds expected in petroleum wastewater (25). In a previous study, we have demonstrated that bioaugmentation of the alkB genotype greatly improves the degradative efficiency of a laboratory-scale reactor running on wastewater collected from a refinery, and hence, this locus was included in this study (26). ARHDOs are key enzymes in aerobic bacterial degradation of aromatic compounds and since the reported consensus primers were constructed from gene fragments which predominantly dioxygenate benzene or benzene derivatives (23). It was interesting to understand if the system contains 3794
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 43, NO. 10, 2009
any novel ARHDOs which might help us understand unexplored degradative routes in the activated biomass and hence sequence analysis was carried out. This step however, is not essential for monitoring the performance of the ETP an need not be implemented at the industry level. It is possible that the conditions prevailing in the ETP do not support microbial activity that is responsible for converting harmful pollutants into harmless compounds. Hence, the functional oxidizing capacity vis-a`-vis catabolic potential of the biomass was also studied by respirometric analysis. For each genotype, a representative substrate was used for oxygen uptake analysis. The highest rates were observed when catechol was used a substrate. This is expected since degradation of aromatics proceeds via catechols or substituted catechols. Besides, intermediate compounds in the degradative pathways are used for the degradation of several aromatic compounds. Surprisingly, oxygen uptake rates were low with biphenyl, fluorene, and naphthalene, suggesting that the upper pathway enzymes for multiple-ring compounds could be rate limiting. Use of the respirometric tool provides the answer to the degradative state of the biomass at a particular time. In some wastewater treatment plants, especially those treating municipal wastewaters, removal of nitrogen is an important concern (27). However, in industrial wastewater treatment plants, nitrogen and phosphate, important nutrients in cell growth, are supplemented into the ASP unit to sustain bacterial population in the face of heavy organic loadings. Hence, this study also monitored the levels of these two nutrients on-site to assess the biological activity of the activated biomass. Supplementation of phosphate source has been proved to improve oxygen uptake rates (Figure 4B), indicating that the ETP is not operating at an optimum efficiency and scope of improvement of degradation exists. ETPs play a very important role in minimizing the pollutant load entering the environment. Yet, the treatment strategies do not include monitoring of the activated biomass. We have previously demonstrated the importance of genomic tools in environmental impact assessment (28). In this study, we demonstrate the relevance of analyzing the catabolic and genetic capacity of the activated biomass and the parameters that should be addressed by physiological and genomic tools to improve the efficiency of wastewater degradation. We present a straightforward approach to obtain the information which would be useful to plant operators. This type of information suggests which pathways are present and active in the system. When a system fails these methods would provide reasons why it might have failed.
Acknowledgments This study was supported by a grant from the Council of Scientific and Industrial Research (CSIR), India, project NWP19(1.5).
Supporting Information Available Details of PCR protocols used in this study and hybridization experiments confirming the amplification products. This material is available free of charge via the Internet at http:// pubs.acs.org.
Literature Cited (1) Xiao, R.; Du, X.; He, X.; Zhang, Y.; Yi, Z.; Li, F. Vertical distribution of polycyclic aromatic hydrocarbons (PAHs) in Hunpu wastewater-irrigated area in northeast China under different land use patterns. Environ. Monit. Assess. 2008, 142, 23–34. (2) Eschenhagen, M.; Schupplerb, M.; Roske, I. Molecular characterization of the microbial community structure in two activated sludge systems for the advanced treatment of effluents. Water Res. 2003, 37, 3224–3232.
(3) Krishnamurthi, K.; Devi, S. S.; Hengstler, J. G.; Hermes, M.; Kumar, K.; Dutta, D.; Muhil Vannan, S.; Subin, T. S.; Yadav, R. R.; Chakrabarti, T. Genotoxicity of sludges, wastewater and effluents from three different industries. Arch. Toxicol. 2008, DOI: 10.1007/s00204-008-0380-0. (4) Akarsubasia, A. T.; Inceb, O.; Kirdarc, B.; Orhonb, N. A.; Curtisd, T. P.; Headd, I. M.; Ince, B. K. Effect of wastewater composition on archaeal population diversity. Water Res. 2005, 39, 1576– 1584. (5) Siriponga, S.; Rittmann, B. E. Diversity study of nitrifying bacteria in full-scale municipal wastewater treatment plants. Water Res. 2007, 41, 1110–1120. (6) Kapley, A.; Baere, T-De.; Purohit, H. J. Eubacterial diversity of activated biomass from a common effluent treatment plant. Res. Microbiol. 2007, 158, 494–500. (7) Watanabe, K.; Futamata, H.; Harayama, S. Understanding the diversity in catabolic potential of microorganisms for the development of bioremediation strategies. Antonie van Leeuwenhoek. 2002, 81, 655–663. (8) Kapley, A.; Prasad, S.; Purohit, H. J. Changes in microbial diversity in fed-batch reactor operation with wastewater containing nitroaromatic residues. Bioresour. Technol. 2007, 98, 2479–2484. (9) Smith, N. R.; Yu, Z.; Mohn, W. W. Stability of the bacterial community in a pulp mill effluent treatment system during normal operation and a system shutdown. Water Res. 2003, 37, 4873–4884. (10) Saikaly, P. E.; Stroot, P. G.; Oerther, D. B. Use of 16S rRNA gene terminal restriction fragment analysis to assess the impact of soilids retention time on the bacterial diversity of activated sludge. Appl. Environ. Microbiol. 2005, 71, 5814–5822. (11) Li, A. J.; Yang, S. F.; Li, X. Y.; Gu, J. D. Microbial population dynamics during aerobic sludge granulation at different organic loading rates. Water Res. 2008, 42, 3552–3560. (12) Kapley, A.; Purohit, H. J. Tracking of phenol degrading genotype. Environ. Sci. Pollut. Res. 2001, 8, 89–90. (13) Moharikar, A.; Kapley, A.; Purohit, H. J. Detection of dioxygenase genes present in various activated sludge. Environ. Sci. Pollut. Res. 2003, 10, 373–376. (14) Dionisi, H. M.; Harms, G.; Layton, A. C.; Greogory, I. R.; Parker, J.; Hawkins, S. A.; Robinson, K. G.; Sayler, G. S. Power analysis for real-time PCR quantification of genes in activated sludge and analysis of the variability introduced by DNA extraction. Appl. Environ. Microbiol. 2003, 69, 6597–6604. (15) Suenaga, H.; Ohnuki, T.; Miyazaki, K. Functional screening of a metagenomic library for genes involved in microbial degradation of aromatic compounds. Environ. Microbiol. 2007, 9, 2289–2297. (16) Wilmes, P.; Wexler, M.; Bond, P. L. Metaproteomics provides functional insight into activated sludge wastewater treatment. PLoS One 2008, 3, e1778, DOI: 10.1371/journal.pone.0001778. (17) Handelsman, J. Metagenomics: application of genomics to uncultured microorganisms. Microbiol. Mol. Biol. Rev. 2004, 68, 669–685. (18) Schloss, P. D.; Handelsman, J. Biotechnological prospects from metagenomics. Curr. Opin. Biotechnol. 2003, 14, 303–310. (19) Kennedy, J.; Marchesi, J. R.; Dobson, A. D. Marine metagenomics: strategies for the discovery of novel enzymes with biotechnological applications from marine environments. Microb. Cell Fact. 2008, 7, 27.
(20) Hallin, S.; Throback, I. N.; Dicksved, J.; Pell, M. Metabolic profiles and genetic diversity of denitrifying communities in activated sludge after addition of methanol or ethanol. Appl. Environ. Microbiol. 2006, 72, 5445–5452. (21) Purohit, H. J.; Kapley, A.; Moharikar, A.; Narde, G. Extraction of activated biological sludge for PCR compatible DNA from effluent treatment systems. J. Microbiol. Methods. 2003, 52, 315– 323. (22) Kutty, R.; Purohit, H. J.; Khanna, P. Isolation and Characterization of a Pseudomonas sp strain PH1 utilizing meta-aminophenol. Can. J. Microbiol. 2000, 46, 211–217. (23) Kahl, S.; Hofer, B. A genetic system for the rapid isolation of aromatic-ring-hydroxylating dioxygenase activities. Microbiology. 2003, 149, 1475–1481. (24) Dosta, J.; Gali, A.; Benabdallah, E.-H.; Mata-A’ lvarez, S. J. Operation and model description of a sequencing batch reactor treating reject water for biological nitrogen removal via nitrite. Bioresour. Technol. 2007, 98, 2065–2075. (25) Mesarch, M. B.; Nakatsu, C. H.; Nies, L. Development of catechol 2,3-dioxygenase-specific primers for monitoring bioremediation by competitive quantitative PCR. Appl. Environ. Microbiol. 2000, 66, 678–683. (26) Domde, P.; Kapley, A.; Purohit, H. J. Impact of Bioaugmentation with consortium of bacteria on the remediation of wastewater containing hydrocarbons. Environ. Sci. Pollut. Res. 2007, 14, 7–11. (27) Vaiopoulou, E.; Melidis, P.; Aivasidis, A. An activated sludge treatment plant for integrated removal of carbon, nitrogen and phosphorus. Desalination. 2007, 211, 192–199. (28) Purohit, H.; Raje, D. V.; Kapley, A.; Padmanabhan, P.; Singh, R. N. Genomics tools in environmental impact assessment. Environ. Sci. Technol. 2003, 37, 356A–363A. (29) Narde, G.; Kapley, A.; Purohit, H. J. Isolation and characterization of Citrobacter strain HPC 255 for broad range substrate specificity for chlorophenol. Curr. Microbiol. 2004, 48, 419–423. (30) Nordlund, I.; Powlowski, J.; Hagstrom, A.; Shingler, V. Conservation of regulatory and structural genes for a multi-component phenol hydroxylase within phenol-catabolizing bacteria that utilize a meta-cleavage pathway. Gen. Microbiol. 1993, 139, 2695– 2703. (31) Yen, K.-M.; Gunsalus, I. C. Plasmid gene organization: Naphthalene/salicylate oxidation. Proc. Natl. Acad. Sci. U. S. A. 1982, 79, 874–878. (32) Casellas, M.; Grifoll, M.; Bayona, J. M.; Solanas, A. M. New metabolites in the degradation of fluorene by Arthrobacter sp. strain F101. Appl. Environ. Microbiol. 1997, 63, 819–826. (33) Seeger, M.; Timmis, K. N.; Hofer, B. Conversion of chlorobiphenyls into phenylhexadienoates and benzoates by the enzymes of the upper pathway for polychlorobiphenyl degradation encoded by the bph locus of Pseudomonas sp. strain LB400. Appl. Environ. Microbiol. 1995, 61, 2654–2658. (34) Li, W.; Zhang, Y.; Wang, M. D.; Shi, Y. Biodesulfurization of dibenzothiophene and other organic sulfur compounds by a newly isolated microbacterium strain ZD-M2. FEMS Microbiol. Lett. 2005, 247, 45–50.
ES803296R
VOL. 43, NO. 10, 2009 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
3795
