J. Med. Chem. 2002, 45, 3669-3683
3669
Dicaffeoyltartaric Acid Analogues Inhibit Human Immunodeficiency Virus Type 1 (HIV-1) Integrase and HIV-1 Replication at Nontoxic Concentrations Ryan A. Reinke,† Peter J. King,† Joseph G. Victoria,† Brenda R. McDougall,‡ Guoxiang Ma,§ Yingqun Mao,§ Manfred G. Reinecke,§ and W. Edward Robinson, Jr.*,†,‡,| Departments of Microbiology & Molecular Genetics, Pathology, and Medicine, University of California, Irvine, California 92697, and Department of Chemistry, Texas Christian University, Fort Worth, Texas 76129 Received July 31, 2001
The human immunodeficiency virus type 1 (HIV-1) is a major health problem worldwide. In this study, 17 analogues of L-chicoric acid, a potent inhibitor of HIV integrase, were studied. Of these analogues, five submicromolar inhibitors of integrase were discovered and 13 compounds with activity against integrase at less than 10 µM were identified. Six demonstrated greater than 10-fold selectivity for HIV replication over cellular toxicity. Ten analogues inhibited HIV replication at nontoxic concentrations. Alteration of the linkages between the two biscatechol rings, including the use of amides, mixed amide esters, cholate, and alkyl bridges, was explored. Amides were as active as esters but were more toxic in tissue culture. Alkyl and cholate bridges were significantly less potent against HIV-1 integrase in vitro and were inactive against HIV-1 replication. Two amino acid derivates and one digalloylderivative of L-chicoric acid (L-CA) showed improved selectivity over L-CA against integration in cell culture. These data suggest that in addition to the bis-catechols and free carboxylic acid groups reported previously, polar linkages are important constituents for optimal activity against HIV-1 integrase and that new derivatives can be developed with increased specificity for integration over HIV entry in vivo. Introduction The acquired immune deficiency syndrome (AIDS), caused by infection with the human immunodeficiency virus (HIV), remains a serious global health problem. Recent advances in treatment, including the use of combinations of both reverse transcriptase and protease inhibitors,1-3 have resulted in significant increases in disease-free survival. However, expense and toxicity coupled with the emergence of single and multiple drug resistant viruses have made it clear that development of new inhibitors targeted toward other viral or cellular proteins is of paramount importance. One viral protein that is a potential target for therapy is HIV integrase (IN). The IN protein is an attractive therapeutic target. First, integration is absolutely required for productive and stable infection by HIV.4-8 Second, there is no known mammalian homologue of IN, although recent work suggests that inhibitors of IN may also inhibit the RAG1/RAG2 recombinase in human B and T lymphocytes.9 Finally, integrase inhibitors in combination with either reverse transcriptase or protease inhibitors have been potently synergistic in vitro against both wild-type HIV and reverse transcriptase inhibitor resistant viruses.10,11 Integrase mediates the covalent linkage of the viral cDNA into the host chromosome, resulting in the * To whom correspondence should be addressed. Address: Department of Pathology, D440 Med Sci I, University of California, Irvine, CA, 92697-4800. Phone: (949) 824-3431. Fax: (949) 824-2505. Email:
[email protected]. † Department of Microbiology & Molecular Genetics, University of California, Irvine. ‡ Department of Pathology, University of California, Irvine. § Texas Christian University. | Department of Medicine, University of California, Irvine.
formation of a stable provirus.12-14 The integration reaction proceeds through a series of enzymatic “steps” beginning with the removal of two terminal nucleotides from each 3′ end of the viral DNA.15-17 The resulting nucleophilic hydroxyl groups attack the host chromosome.15,16 The resulting DNA gaps are repaired, and the provirus is formed, most likely by host DNA break repair machinery.18-20 These biological reactions are illustrated in Figure 1. Purified recombinant integrase, synthesized in Escherichia coli, can mediate these reactions in vitro.21 These integration reactions and the reverse of strand transfer, called disintegration,22,23 have been used to determine the biochemical requirements for integration and to identify inhibitors of the reaction. The in vitro reactions18,21,23-26 are described in detail in the Experimental Section. While a large number of integrase inhibitors have been described {reviewed in refs 27 and 28}, few have met the criterion for “lead” compounds because of the lack of activity against replicating virus, cell toxicity, lack of selectivity, or a combination of these factors. The dicaffeoyltartaric acids (DCTAs) and dicaffeoylquinic acids (DCQAs), on the other hand, are excellent lead compounds against HIV integrase.29,30 The most potent and selective of these agents to date is L-chicoric acid (L-CA), which inhibits type 1 HIV (HIV-1) replication at nontoxic concentrations. It is selective against HIV-1 integrase compared to other metalloenzymes including reverse transcriptase, restriction endonucleases, and other DNA binding proteins.31,32 L-CA is one of the most potent inhibitors of integrase in biochemical assays with 50% inhibitory concentrations (IC50 values) of approximately 150 nM in the 3′-end-processing reaction.29,30 Finally, it is an excellent template for structure-
10.1021/jm010359d CCC: $22.00 © 2002 American Chemical Society Published on Web 07/18/2002
3670
Journal of Medicinal Chemistry, 2002, Vol. 45, No. 17
Reinke et al.
results of previously reported docking experiments utilizing a different crystal structure and an alternative docking program,30 which suggested that the DCTAs and DCQAs interacted with aspartate 64, histidine 67, glutamate 92, aspartate 116, asparagine 117, glutamine 148, and lysine 159. Furthermore, L-CA appeared to interact more tightly with the protein and to fill a putative drug binding cleft better than other, less potent DCQAs.30 These interactions are virtually identical to the drug binding pocket identified by Sotriffer et al. as residues 64-67, 116, 148, 151-152, 155-156, 159, and, for larger molecules such as L-CA, residue 92.35 To identify more potent and selective inhibitors of HIV-1 integrase, the third round of SAR reported herein was performed. In particular, this paper examines variations in the nature of (1) the linkage between the catechol rings and the central acid core, the goal of which was to decrease susceptibility of the analogues to hydrolysis, (2) the carboxylic acid core, to ascertain whether blocking one carboxylic acid as an amide would increase cell entry thus leading to more effective inhibitors, and (3) possible heterocyclic substitutes for the catechol rings to potentially reduce toxicity of the molecules and decrease their chemical reactivity. Results
Figure 1. Integration reaction. (A) Viral cDNA enters the nucleus as part of the preintegration complex (PIC). (B) Integrase catalyzes the removal of two nucleotides from each 3′-end of the viral cDNA (3′-end-processing). Next, integrase catalyzes the nucleophilic attack by the free hydroxyls of the viral cDNA on the host chromosome. Favored sites are between nucleosomes in regions of DNA stress. (C) The subsequent covalent linkage of the viral 3′-ends to the host chromosome is termed strand transfer, generating unpaired DNA breaks at either end of the virus. (D) Finally, the overhangs and gaps are repaired, likely by host-DNA repair machinery (5′-endjoining), generating the integrated provirus.
activity relationship (SAR) studies.33 Two previous rounds of SAR have identified key structural features involved in selectivity and potency against both integrase and HIV replication in tissue culture, i.e., a free carboxylic acid and two 3,4-catechol rings.29,30,33,34 The latter group is common to many other polyhydroxylated inhibitors of integrase, but as revealed in our first SAR paper,33 the former group is required for inhibition of HIV replication in tissue culture. More recently, Sotriffer et al. utilized computational docking to demonstrate that several inhibitors of integrase fill an inhibitor binding cleft near the catalytic site. L-CA more completely fills the groove than other integrase inhibitors.35 Such docking experiments suggested that L-CA interacts with lysines 156 and 159, as well as cysteine 65, threonine 66, histidine 67, glutamine 148, and glutamate 152. The most favorable contacts are with glutamate 152, a member of the catalytic triad, and glutamine 148.35 These results are quite similar to
Synthetic Goals and Methodology. Our prior SAR study 33 of L-CA analogues concluded that (i) at least one free carboxyl group was necessary for anti-HIV activity but not integrase inhibition, although maximal inhibition of integrase was observed only for molecules containing a free carboxyl group, (ii) the stereochemistry of the chicoric acid (D-, L-, or meso-) had modest effects on either activity, (iii) a minimum of two ortho phenolic OH groups in each aryl ring were necessary for activity, (iv) the catechol systems must be situated at the 3,4-, not the 2,3-positions, relative to the side chain, and (v) the nature and length of the link between the ester function and the catechol did not greatly affect the above activities. The present paper examines the effect of substituting the ester linkages between the central acid core and the two caffeoyl groups with amide and all carbon linkages. Several compounds in which the tartaric acid core was replaced with cholic acids and the catechols with heterocyclic rings were also prepared. The dicaffeoyl derivatives of L-serine, D,L-isoserine, L-lysine, and D,L-2,3-diaminopropionic acid were prepared from the corresponding methyl ester hydrochlorides 2a, 2b, 2c, and 2d by reaction of the acid chloride of the blocked caffeic acid 1 to give the fully blocked ester amides 3a, 3b, 3c, and 3d, respectively. Simultaneous deblocking of the catechols and saponification of the methyl esters gave the target compounds 4a, 4b, 4c, and 4d (Scheme 1). The dicaffeoyl derivative of 3,5diaminobenzoic acid was prepared directly from the acid by reaction with 1 to give 5 whose catechols were deblocked to give 6 (Scheme 1). All of these dicaffeoyl derivatives are new, although the racemate of 4a and the acetoxy and methoxy derivatives of 4d have been reported.34 Reaction of methyl 7-deoxycholate (7) with the acid chloride of the blocked caffeic acid 1 gave the protected ester 8, which was saponified and deblocked in one operation to give 3,12-dicaffeoyl-7-deoxycholic acid (9)
Dicaffeoyltartaric Acid Analogues
Journal of Medicinal Chemistry, 2002, Vol. 45, No. 17 3671
Scheme 1
Scheme 3
Scheme 2
(Scheme 2). Cholic acid (10) itself was converted to its diphenylmethyl ester 11, which upon reaction with the acid chloride of 1 gave a mixture of the diphenyl methyl esters of the protected di- and tricaffeoylcholic acids. Chromatography separated the former as a 1:1 mixture (15 + 16) of the protected 3,7- and 3,12-dicaffeoyl compounds and the latter (12) as the 3,7,12-tricaffeoyl derivative. The diphenyl methyl ester group of each of these was removed with HOAc to give the free acids 17 + 18 and 13, respectively. The methoxycarbonyl blocking groups of each were cleaved with mild base to give a 1:1 mixture of 3,7- and 3,12-dicaffeoylcholic acids (19 + 20) and 3,7,12-tricaffeoylcholic acid (14) (Scheme 2).
The identity and composition of the mixture 19 + 20 were determined from the position and relative areas of the carbinol hydrogens in the 1H NMR and comparisons with the same peaks in 11, 14, and 9 (see Experimental Section). Bis-catechol derivatives of a series of succinic acids were prepared by a double Stobbe condensation of diethyl succinate with the R-pyranyl-protected 3,4dihydroxybenzaldehyde 21a36 or with veratraldehyde to give the bis(benzylidene)succinic acids 22a (after deprotection) and 22b (Scheme 3). The latter was reduced to give a mixture of the known37 meso- and D,L-2,3-bis(3,4dimethoxybenzyl)succinic acids 23a and 24a, respectively. Demethylation with BBr3 led to the target biscatechol acids 23b and 24b. Treatment of 23a with acetic anhydride has been shown38 to give the isomerized D,L-anhydride, 25, which also was formed by heating either 23a or 24a in a vacuum without solvent. Reaction of 25 with ammonia, diethylamine, or ndecylamine gave the monoamides 26a, 26b and 26c, respectively, which upon demethylation with BBr3 led to the target bis-catechol monoamides 27a, 27b, and 27c (Scheme 3). The chicoric acid analogues in which the caffeoyl groups are replaced by 2-thenoyl (28a) and 3-thenoyl (28b) residues were prepared directly from L-tartaric acid and the corresponding acid chlorides. Tetraacetylchicoric acid (29)33,34 was prepared from bisdiphenylmethyl tartrate and diacetylcaffeoyl chloride followed by selective hydrolysis of the diphenylmethyl esters (Scheme 4). Biological Activities of Synthetic Compounds. Compounds were tested at multiple concentrations to determine the IC50 for both 3′-end-processing/strand
3672
Journal of Medicinal Chemistry, 2002, Vol. 45, No. 17
Scheme 4
transfer and disintegration reactions as described previously.33 All compounds were diluted, and their toxicity to an established cell line, MT-2, and their anti-HIV effects were analyzed. Results for these assays are reported as the 5% cytotoxic dose (CT5) and the 50% effective dose (ED50), respectively. The CT5 is 1 standard deviation from the cell control and represents a nontoxic dose. The anti-HIV assay described39 and its modification29,30,33 have been shown to correlate with other measures of viral replication, including viral RNA and protein synthesis, reverse transcriptase release, and numbers of infectious particles.40 Biological Activities of Amino Acid Derivatives of L-Chicoric Acid. Compounds 4a, 4b, and 4d were all potent inhibitors of HIV-1 integrase in both the 3′end-processing and strand transfer assays (Table 1). All four compounds, 4a, 4b, 4c, and 4d, were potent inhibitors of the disintegration reaction (Table 1). Potency for these molecules was similar to the potency for L-CA. Cell toxicity and anti-HIV activities of each of the four molecules are illustrated in Figure 2. The most potent and selective compound was 4b. Interestingly, the toxicity of the dicaffeoyl derivative of isoserine (4b) is much reduced compared to those of the R-amino acid derivatives (4a, 4c, and 4d) and second only to L-CA itself. This leads to the therapeutic index (TI) of 4b (88) exceeding that of L-CA (63) (Figure 2). Reproducibility in both antiviral activity and disintegration assays for compound 4b is illustrated in Figure 3. This level of reproducibility is similar for all molecules reported herein and is merely representative. The relative potency of all the amino acid derivatives in the disintegration assay are illustrated in Figure 4A. Biological Activities of Benzoic Acid Derivatives. We had previously reported that 3,5 dicaffeoylbenzoic acid (3,5-DCBA) was inactive against both integrase and HIV replication.30 On the basis of docking experiments,30 we had concluded that the linker between the two caffeic acid groups must be more flexible than allowed for by the planar benzene ring. Alternatively, since phenyl esters are more easily hydrolyzed than alkyl esters, 3,5-DCBA might not survive under the assay conditions, thus accounting for its lack of activity. Since amides are more stable to hydrolysis than esters, the dicaffeoyl derivative of 3,5-diaminobenzoic acid (6) was prepared and proved to be a potent inhibitor of HIV integrase and a selective inhibitor of HIV replication with an ED50 of 4.6 µM and a CT5 of 47 µM (Table 1). Biological Activities of Dicaffeoylcholates. The serum half-life of dicaffeoyltartaric acids is likely to be short. In an attempt to improve lipid solubility as well
Reinke et al.
as to determine whether a large polycyclic group could replace tartaric acid, di- and tricaffeoylcholates were synthesized. A 1:1 mixture of 3,7- and 3,12-dicaffeoylcholic acids, 19 + 20, and pure 3,12-dicaffeoyl-7-deoxycholic acid, 9, were found to be fairly weak inhibitors of integrase but inactive against HIV at nontoxic concentrations in tissue culture (Table 1). A tricaffeoylcholic acid, 14, was slightly less toxic with a CT5 of 11 µM. Compound 14 was a potent inhibitor of integrase with an IC50 of 750-1000 nM in both the end-processing and disintegration assays (Figure 5) but did not inhibit HIV replication at concentrations as high as 140 µM. Figure 5 is representative of end-processing/strand transfer and disintegration assays for other molecules reported herein. The relative potencies of 19 + 20 and 14 are illustrated in Figure 4B. Biological Activities of Succinate Derivatives. To determine if anti-HIV or anti-integrase activities required either ester or amide links between the catechol system and the central core, several succinic acid derivatives were prepared in which the catechols were connected to the central core by carbon-carbon bonds. The dimer of caffeic acid (22a) had an ED50 similar to that of L-CA. The same is true for both tetrahydro stereoisomers, 23b and 24b, which were active against HIV replication and inhibited HIV integrase (Table 1). The more potent of these molecules, 24b, was active against HIV replication at concentrations below 2 µM. Both molecules were potent inhibitors of the endprocessing reaction with an IC50 of 230-440 nM. Unlike other derivatives of the dicaffeoyltartaric acids, there was a significant difference between activities against end-processing and disintegration. The IC50 for the latter reaction was 2-4 µM (Figure 4C). Monoamides 27a, 27b and 27c were weakly active against both viral replication and disintegration (Table 1). These derivatives also demonstrated significantly more potent inhibition of end processing than disintegration. Their activities in the disintegration reaction (Figure 4D) were similar to, although slightly less active than, those of other succinate derivatives (Figure 4C). Replacement of Bis-Catechols. Two analogues in which the catechols were replaced with electron-rich thiophene rings were prepared. Compounds 28a and 28b were not active against HIV integrase or against HIV replication (Table 1). Acetylation of the catechols on L-CA to give 29 resulted in significantly attenuated inhibition of HIV integrase and little inhibition of HIV replication (Table 1). Indeed, unlike all other chicoric acid derivatives, the IC50 of 29 was higher against integrase than the ED50 against HIV replication, suggesting an alternative mechanism of action. One possibility is that the acetylated derivative acts to inhibit viral entry, as suggested by others.41 Select Analogues Demonstrate Improved AntiIntegrase Activity in Cells. Quantitative real-time polymerase chain reaction (PCR) was performed using primers that amplify HIV two LTR circle DNA and cDNA. Failure of integration results in two LTR circle formation; therefore, the ratio of two LTR circle DNA to cDNA is a measure of failed integration. Others have shown that this ratio increases in the presence of integrase inhibitors.42,43 As illustrated in Figure 6, dicaffeoyl-L-lysine 4c, dicaffeoyl-D,L-isoserine 4b, and
Dicaffeoyltartaric Acid Analogues
Journal of Medicinal Chemistry, 2002, Vol. 45, No. 17 3673
Table 1. Biologic Activity of DCTA Analogues compound L-tartaric L-chicoric
acid acid
4a 4b 4c 4d 6 9 14 19 + 20 22a 23b 24b 27a 27b 27c 28a 28b 29
CT5a (µM)
ED50b (µM)
TIc
IC50 (µM)d end-processing
IC50e (µM) disintegration
>1000 264 39 175 43 35 47 6.4 11.4 4.6 55 76 71 123 93 34 190 100 18.6
>1000 4.2 2.5 2 3.7 35 4.6 >17 >140 >17 4.4 12.6 1.9 49 186 >37 >190 .95 4
15, r2 > 0.99). Standard curves were generated using dilutions of 20000-20 chronically HIVLAI-infected H9 cells. While ratios were calculated using infected cell equivalents, there was approximately 200-fold more cDNA than two LTR circle DNA by copy number, consistent with previously published results.43 Biochemical Assays of Integrase Activity. The 3′-endprocessing, strand transfer, and disintegration activities of IN in the presence and absence of inhibitors were assayed in
vitro29,30,33 as modified from Chow et al.22 The following oligonucleotides (GenoSys, Inc.) were used as DNA substrates: T1 (16 mer), 5′-CAGCAACGCAAGCTTG-3′; T3 (30 mer), 5′GTCGACCTGCAGCCCAAGCTTGCGTTGCTG-3′; V2 (21mer), 5′-ACTGCTAGAGATTTTCCACAT-3′; V1/T2 (33 mer), 5′-ATGTGGAAAATCTCTAGCAGGCTGCAGGTCGAC-3′; V1 (21mer), 5′-ATGTGGAAAATCTCTAGCAGT-3′; db-Y1 (38mer), 5′TGCTAGTTCTAGCAGGCCCTTGGGCCGGCGCTTGCGCC3′. The oligonucleotides were gel-purified. Oligonucleotides T1, V1, and db-Y1 were labeled at the 5′-ends using T4 polynucleotide kinase and [γ-32P] ATP (3000 Ci/mmol, Amersham). Labeled substrate was purified using a p6 spin column. The substrate for assaying disintegration activity, the Y oligomer, was prepared by annealing the labeled T1 strand with oligonucleotides T3, V2, and V1/T2. The end-processing/strand transfer substrate was prepared by annealing the labeled V1 strand with V2. The dumbbell substrate was prepared by heating labeled db-Y1 to 95 °C followed by slow cooling. In a 20 µL volume, the DNA substrate (0.1 pmol of db-Y1 and “y”oligo; 0.2 pmol of V1/V2) was incubated with 1.5 pmol of recombinant IN for 60 min at 37 °C in a buffer containing a final concentration of 20 mM HEPES, pH 7.5, 10 mM DTT, 0.05% Nonidet P-40, and 10 mM MnCl2. To each 19 µL of reaction mixture, 1 µL of inhibitor at various concentrations in solvent or solvent alone was added. The reaction was stopped by the addition of EDTA to a final 18 mM concentration. Reaction products were heated at 90 °C for 3 min before analysis by electrophoresis on a 15% polyacrylamide gel with 7 M urea in Tris-borate/EDTA buffer. All reactions were performed at enzyme excess, and reactions were stopped within the linear range of the reaction. Reactions were performed in the presence of MnCl2 rather than MgCl2 because this class of molecules inhibits HIV IN whether Mg2+ or Mn2+ is the source of divalent cation, and for the interaction of IN with L-CA, the metal ion is not required.32 These data are more consistent with the inhibitory activity of bis-catechols against avian sarcoma virus IN. IC50 analysis was determined from a median effect plot using CalcuSyn software (Biosoft, Cambridge, U.K.) on 0.5 log dilutions of inhibitor in triplicate experiments.
Acknowledgment. This work was supported in part by the Public Health Service (Grant RO1AI41360), JT, Inc. (W.E.R.), the Burroughs-Wellcome Foundation (Application No. 2609 to W.E.R.), and the Texas Christian University Research Fund (M.G.R.). W. Edward Robinson, Jr. is a Burroughs-Wellcome Foundation Clinical Scientist in Translational Research. References (1) Hammer, S. M.; Katzenstein, D. A.; Hughes, M. D.; Gundacker, H.; Schooley, R. T.; Haubrich, R. H.; Henry, W. K.; Lederman, M. M.; Phair, J. P.; Niu, M.; Hirsch, M. S.; Merigan, T. C. A trial comparing nucleoside monotherapy with combination therapy in HIV-infected adults with CD4 cell counts from 200 to 500 per cubic millimeter. N. Engl. J. Med. 1996, 335, 1081-1090. (2) Hammer, S. M.; Squires, K. E.; Hughes, M. D.; Grimes, J. M.; Demeter, L. M.; Currier, J. S.; Eron, J. J.; Feinberg, J. E.; Balfour, H. H., Jr.; Deyton, L. R.; Chodakewitz, J. A.; Fischl, M. A. ACTG. A controlled trial of two nucleoside analogues plus indinavir in persons with human immunodeficiency virus infection and CD4 cell counts of 200 per cubic millimeter or less. N. Engl. J. Med. 1997, 337, 725-733. (3) Collier, A. C.; Coombs, R. W.; Schoenfeld, D. A.; Bassett, R. L.; Timpone, J.; Baruch, A.; Jones, M.; Facey, K.; Whitacre, C.; McAuliffe, V. J.; Friedman, H. M.; Merigan, T. C.; Reichman, R. C.; Hooper, C.; Corey, L. Treatment of human immunodeficiency virus infection with saquinavir, zidovudine, and zalcitabine. N. Engl. J. Med. 1996, 334, 1011-1017. (4) Cannon, P. M.; Wilson, W.; Byles, E.; Kingsman, S. M.; Kingsman, A. J. Human immunodeficiency virus type 1 integrase: effect on viral replication of mutations at highly conserved residues. J. Virol. 1994, 68, 4768-4775. (5) Kulkosky, J.; Jones, K. S.; Katz, R. A.; Mack, J. P. G.; Skalka, A. M. Residues critical for retroviral integrative recombination in a region that is highly conserved among retroviral/retrotransposon integrases and bacterial insertion sequence transposases. Mol. Cell. Biol. 1992, 12, 2331-2338.
3682
Journal of Medicinal Chemistry, 2002, Vol. 45, No. 17
(6) LaFemina, R. L.; Schneider, C. L.; Robbins, H. L.; Callahan, P. L.; LeGrow, K.; Roth, E.; Schleif, W. A.; Emini, E. A. Requirement of active human immunodeficiency virus type 1 integrase enzyme for productive infection of human T-lymphoid cells. J. Virol. 1992, 66, 7414-7419. (7) Stevenson, M.; Haggerty, S.; Lamonica, C. A.; Meier, C. M.; Welch, S. K.; Wasiak, A. J. Integration is not necessary for expression of human immunodeficiency virus type 1 protein products. J. Virol. 1990, 64, 2421-2425. (8) Taddeo, B.; Haseltine, W. A.; Farnet, C. M. Integrase mutants of human immunodeficiency virus type 1 with a specific defect in integration. J. Virol. 1994, 68, 8401-8405. (9) Melek, M.; Jones, J. M.; O’Dea, M. H.; Pais, G.; Burke, T. R., Jr.; Pommier, Y.; Neamati, N.; Gellert, M. Effect of HIV integrase inhibitors on the RAG1/2 recombinase. Proc. Natl. Acad. Sci. U.S.A. 2001, 99, 134-137. (10) Robinson, W. E., Jr. L-Chicoric acid, an inhibitor of human immunodeficiency virus type 1 (HIV-1) integrase, improves on the in vitro anti-HIV-1 effect of zidovudine plus a protease inhibitor (AG1350). Antiviral Res. 1998, 39, 101-111. (11) Beale, K.; Robinson, W. E., Jr. Combinations of reverse transcriptase, protease, and integrase inhibitors can be synergistic in vitro against drug-sensitive and RT inhibitor-resistant molecular clones of HIV-1. Antiviral Res. 2000, 46, 223-232. (12) Varmus, H. E.; Brown, P. O. Retroviruses. In Mobile DNA; American Society for Microbiology: Washington, DC, 1989; pp 53-108. (13) Goff, S. P. Genetics of Retroviral Integration. Annu. Rev. Genet. 1992, 26, 527-544. (14) Asante-Appiah, E.; Skalka, A. M. Molecular mechanisms in retrovirus DNA integration. Antiviral Res. 1997, 36, 139-156. (15) Brown, P. O.; Bowerman, B.; Varmus, H. E.; Bishop, J. M. Retroviral integration: structure of the initial covalent product and its precursor, and a role for the viral IN protein. Proc. Natl. Acad. Sci. U.S.A. 1989, 86, 2525-2529. (16) Fujiwara, T.; Mizuuchi, K. Retroviral DNA integration: structure of an integration intermediate. Cell 1988, 54, 497-504. (17) Roth, M. J.; Schwartzberg, P.; Tanese, N.; Goff, S. P. Analysis of mutations in the integration function of Moloney murine leukemia virus: effect on DNA binding and cutting. J. Virol. 1990, 64, 4709-4717. (18) Bushman, F. D.; Craigie, R. Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA. Proc. Natl. Acad. Sci. U.S.A. 1991, 88, 1339-1343. (19) Daniel, R.; Katz, R. A.; Skalka, A. M. A role for DNA-PK in retroviral DNA integration. Science 1999, 284, 644-647. (20) Miller, M. D.; Wang, B.; Bushman, F. D. Human immunodeficiency virus type 1 preintegration complexes containing discontinuous plus strands are competent to integrate in vitro. J. Virol. 1995, 69, 3938-3944. (21) Sherman, P. A.; Fyfe, J. A. Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity. Proc. Natl. Acad. Sci. U.S.A. 1990, 87, 5119-5123. (22) Chow, S. A.; Vincent, K. A.; Ellison, V.; Brown, P. O. Reversal of integration and DNA splicing mediated by integrase of human immunodeficiency virus. Science 1992, 255, 723-726. (23) Chow, S. A. In vitro assays for activities of retroviral integrase. In Methods (a companion to Methods in Enzymology); Academic Press: San Diego, CA, 1997; Vol. 12, pp 306-317. (24) Chow, S. A.; Brown, P. O. Substrate features important for recognition and catalysis by human immunodeficiency virus type 1 integrase identified by using novel DNA substrates. J. Virol. 1994, 68, 3896-3907. (25) Sherman, P. A.; Dickson, M. L.; Fyfe, J. A. Human immunodeficiency virus type 1 integration protein: DNA sequence requirements for cleaving and joining reactions. J. Virol. 1992, 66, 3593-3601. (26) Vincent, K. A.; Ellison, V.; Chow, S. A.; Brown, P. O. Characterization of human immunodeficiency virus type 1 integrase expressed in Escherichia coli and analysis of variants with amino-terminal mutations. J. Virol. 1993, 67, 425-437. (27) Pommier, Y.; Neamati, N. Inhibitors of human immunodeficiency virus integrase. Adv. Virus Res. 1999, 52, 427-458. (28) Robinson, W. E., Jr. HIV integrase: the next target? Infect. Med. 1998, 15, 129-137. (29) Robinson, W. E., Jr.; Reinecke, M. G.; Abdel-Malek, S.; Jia, Q.; Chow, S. A. Inhibitors of HIV-1 replication that inhibit HIV integrase. Proc. Natl. Acad. Sci. U.S.A. 1996, 93, 6326-6331. (30) Robinson, W. E., Jr.; Cordeiro, M.; Abdel-Malek, S.; Jia, Q.; Chow, S. A.; Reinecke, M. G.; Mitchell, W. M. Dicaffeoylquinic acid inhibitors of human immunodeficiency virus integrase: Inhibition of the core catalytic domain of human immunodeficiency virus integrase. Mol. Pharmacol. 1996, 50, 846-855.
Reinke et al. (31) McDougall, B.; King, P. J.; Wu, B. W.; Hostomsky, Z.; Reinecke, M. G.; Robinson, W. E., Jr. Dicaffeoylquinic and dicaffeoyltartaric acids are selective inhibitors of human immunodeficiency virus type 1 integrase. Antimicrob. Agents Chemother. 1998, 42, 140146. (32) Zhu, K.; Cordeiro, M. L.; Atienza, J.; Robinson, W. E., Jr.; Chow, S. A. Irreversible inhibition of human immunodeficiency virus type 1 integrase by dicaffeoylquinic acids. J. Virol. 1999, 73, 3309-3316. (33) King, P. J.; Ma, G.; Miao, W.; Jia, Q.; McDougall, B. R.; Reinecke, M. G.; Cornell, C.; Kuan, J.; Kim, T. R.; Robinson, W. E., Jr. Structure-activity relationships: analogues of the dicaffeoylquinic and dicaffeoyltartaric acids as potent inhibitors of human immunodeficiency virus type 1 integrase and replication. J. Med. Chem. 1999, 42, 497-509. (34) Lin, Z.; Neamati, N.; Zhao, H.; Kiryu, Y.; Turpin, J. A.; Aberham, C.; Strebel, K.; Kohn, K.; Witvrouw, M.; Pannecouque, C.; Debyser, Z.; DeClercq, E.; Rice, W. G.; Pommier, Y.; Burke, T. R., Jr. Chicoric acid analogues as HIV-1 integrase inhibitors. J. Med. Chem. 1999, 42, 1401-1414. (35) Sotriffer, C. A.; Ni, H.; McCammon, A. Active site binding modes of HIV-1 integrase inhibitors. J. Med. Chem. 2000, 43, 41094117. (36) Artico, M.; Di Santo, R.; Costi, R.; Novellino, E.; Greco, G.; Massa, S.; Tramontano, E.; Marongiu, M. E.; De Montis, A.; La Colla, P. Geometrically and conformationally restrained cinnamoyl compounds as inhibitors of HIV-1 integrase: synthesis, biological evaluation, and molecular modeling. J. Med. Chem. 1998, 41, 3948-3960. (37) Schrecker, A. W. Meso dihydroguaietic acid and its derivatives. J. Am. Chem. Soc. 1957, 79, 3823-3827. (38) Haworth, R. D.; Woodcock, D. The constituents of natural phenolic resins. Part XIV. The synthesis of dl, d, and lmatairesinol dimethyl ether. J. Chem. Soc. 1939, 154. (39) Montefiori, D. C.; Robinson, W. E., Jr.; Schuffman, S. S.; Mitchell, W. M. Evaluation of antiviral drugs and neutralizing antibodies against human immunodeficiency virus by a rapid and sensitive microtiter infection assay. J. Clin. Microbiol. 1988, 26, 231235. (40) Robinson, W. E., Jr.; Montefiori, D. C.; Gillespie, D. H.; Mitchell, W. M. Complement-mediated, antibody-dependent enhancement of human immunodeficiency virus type 1 (HIV-1) infection in vitro increases HIV-1 RNA and protein synthesis and infectious virus production. J. Acquired Immune Defic. Syndr. 1989, 2, 3342. (41) Pluymers, W.; Neamati, N.; Pannecouque, C.; Fikkert, V.; Marchand, C.; Burke, T. R., Jr.; Pommier, Y.; Schols, D.; De Clercq, E.; Debyser, Z.; Witvrouw, M. Viral entry as the primary target for the anti-HIV activity of chicoric acid and its tetraacetyl esters. Mol. Pharmacol. 2000, 58, 641-648. (42) Hazuda, D. J.; Pelock, P.; Witmer, M.; Wolfe, A.; Stillmock, K.; Grobler, J. A.; Espeseth, A.; Gabryelski, L.; Schleif, W.; Blau, C.; Miller, M. D. Inhibitors of strand transfer that prevent integration and inhibit HIV-1 replication in cells. Science 2000, 287, 646-650. (43) Butler, S. L.; Hansen, M. S. T.; Bushman, F. D. A quantitative assay for HIV DNA integration in vivo. Nat. Med. 2001, 7, 631634. (44) Farnet, C. M.; Wang, B.; Hansen, M.; Lipford, J. R.; Zalkow, L.; Robinson, W. E., Jr.; Siegel, J.; Bushman, F. Human immunodeficiency virus type 1 cDNA integration: new aromatic hydroxylated inhibitors and studies of the inhibition mechanism. Antimicrob. Agents Chemother. 1998, 42, 2245-2253. (45) King, P. J.; Robinson, W. E., Jr. Resistance to the anti-human immunodeficiency virus type 1 compound L-chicoric acid results from a single mutation at amino acid 140 of integrase. J. Virol. 1998, 72, 8420-8424. (46) Farnet, C. M.; Wang, B.; Lipford, J. R.; Bushman, F. D. Differential inhibition of HIV-1 preintegration complexes and purified integrase protein by small molecules. Proc. Natl. Acad. Sci. U.S.A. 1996, 93, 9742-9747. (47) Hazuda, D. J.; Felock, P. J.; Hastings, J. C.; Pramanik, B.; Wolfe, A. L. Differential divalent cation requirements uncouple the assembly and catalytic reactions of human immunodeficiency virus type 1 integrase. J. Virol. 1997, 71, 7005-7011. (48) Goldgur, Y.; Craigie, R.; Cohen, G. H.; Fujiwara, T.; Tomokazu, Y.; Fujishita, T.; Sugimoto, H.; Endo, T.; Murai, H.; Davies, D. R. Structure of the HIV-1 integrase catalytic domain complexed with an inhibitor: a platform for antiviral drug design. Proc. Natl. Acad. Sci. U.S.A. 1999, 96, 13040-13043. (49) Akita, H.; Nozawa, M.; Mitsuda, A.; Ohsawa, H. A convenient synthesis of (+)-albicanol based on enzymatic function: total synthesis of (+)-albicanyl acetate, (-)-albicanyl 3,4-dihydroxycinnamate, (-)-drimenol, (-)-drimenin and (-)-ambrox. Tetrahedron: Asymmetry 2000, 11, 1375-1388. (50) Zhao, H.; Burke, T. R., Jr. Facile Synthesis of (2R,3R)-(-)- and (2S,3S)-(+)-Chicoric Acids. Synth. Commun. 1998, 28, 737-740.
Dicaffeoyltartaric Acid Analogues (51) Kellogg, D. E.; Kwok, S. Detection of human immunodeficiency virus. PCR Protocols: A Guide to Methods and Applications; Academic Press: San Diego, CA, 1990; pp 337-347. (52) Zack, J. A.; Arrigo, S. J.; Weitsman, S. R.; Go, A. S.; Haislip, A.; Chen, I. S. Y. HIV-1 entry into quiescent primary lympho-
Journal of Medicinal Chemistry, 2002, Vol. 45, No. 17 3683 cytes: molecular analysis reveals a labile, latent viral structure. Cell 1990, 61, 213-222.
JM010359D
