Dichlorvos Exposure Results in Activation Induced Apoptotic Cell

Jul 20, 2012 - Dichlorvos [2,2-dichlorovinyl dimethyl phosphate] is one of the most common in-use organophosphate (OP) in developing nations. Previous...
0 downloads 0 Views 1MB Size
Download PDF
Article pubs.acs.org/crt

Dichlorvos Exposure Results in Activation Induced Apoptotic Cell Death in Primary Rat Microglia Aditya Sunkaria, Willayat Yousuf Wani, Deep Raj Sharma, and Kiran Dip Gill* Department of Biochemistry, Postgraduate Institute of Medical Education and Research, Chandigarh-160012, India ABSTRACT: Dichlorvos [2,2-dichlorovinyl dimethyl phosphate] is one of the most common in-use organophosphate (OP) in developing nations. Previous studies from our lab have shown chronic Dichlorvos exposure leads to neuronal cell death in rats. However, the extent of damage caused by Dichlorvos to other cells of the central nervous system (CNS) is still not clear. Microglial cells are the primary threat sensors of CNS which become activated in many pathological conditions. Activation of microglial cells results in reactive microgliosis, manifested by increased cellular damage in the affected regions. Using rat primary microglial cultures, here we show that Dichlorvos exposure can activate and induce apoptotic cell death in microglia. We observed significant up-regulation of pro-inflammatory molecules like nitric oxide, TNF-α, and IL-1β when microglia were treated with Dichlorvos (10 μM). Significant up-regulation of CD11b, microglial specific activation marker, was also observed after 24 h of Dichlorvos treatment. The activated microglial cells eventually undergo cell death after 48 h of Dichlorvos treatment. The DNA fragmentation pattern of Dichlorvos treated microglia along with increased expression of Bax in mitochondria, cytochrome c release from mitochondria, and caspase-3 activation led us to assume that microglia were undergoing apoptosis. Thus, the present study showed that Dichlorvos can induce microglial activation and ultimately apoptotic cell death. These findings gave new perspective to the current knowledge of Dichlorvos (OPs) mediated CNS damage and presents microglial activation as a potential therapeutic target for preventing the OP induced neuronal damage.

■

INTRODUCTION Microglia are firmly established as a key cellular element in the CNS, and they are recognized to serve as the innate immune system of the brain and spinal cord.1 Since their discovery, microglia are reported to be involved in almost all known CNS pathologies. However, strong emphasis on the role of microglia in disease conditions may distract from the fact that resting microglia are resident but not functionally silent cells. Microglial cells secrete various neurotrophic factors, which promote the survival of neurons. However, in response to neurotoxic chemicals, infection, or brain injury, they get activated and start migrating toward the affected area of the CNS.2 Till now, the precise mechanism underlying microglial activation is not fully understood. However, various proinflammatory molecules like nitric oxide (NO) and reactive oxygen species (ROS) secreted by local inflammatory cells have been reported to mediate the activation process.3 If the stimulus persists, the microglial cells become over activated and eventually undergo apoptosis by a process known as activationinduced cell death (AICD).4,5 Organophosphorus (OP) groups of pesticides have been used extensively across the world6 resulting in annual exposures to 2−3 million people.7 OPs are known to induce acute and chronic neurotoxicity in mammals primarily by inhibiting acetylcholinesterase (AChE) activity.8,9 However, OPs can have deleterious effects on the nervous system through a variety of other mechanisms as well.10,11 Dichlorvos, an OP, has been in use as a crop protectant as well as a general public health © XXXX American Chemical Society

insecticide for more than 40 years. Previous reports from our lab have shown that Dichlorvos can also impart its toxicity via an AChE inhibition independent mechanism.12 Moreover, being a primary stress or injury sensor of CNS, involvement of microglia in inducing OP mediated cellular damage cannot be ruled out. Once activated, microglial cells secrete various neurotoxic molecules such as NO and pro-inflammatory cytokines.13,14 Kim et al. have reported that the apoptotic injury of rat brain induced by OP poisoning might be mediated in part through NO production.15 Elevated NO generation during inflammation may cause host cell damage and induce alterations in host DNA. NO may also damage DNA by oxidation and cause protein nitrosylation.16 Several studies suggested that OP exposure has direct toxic effects on neurons, but recently, it has been postulated that the neurotoxic insult of OPs may be exacerbated by simultaneous microglial reactivity. Toxic exposure to isolated neurons caused the death of only ∼30% of the neurons, whereas all neurons died in cocultures of neurons with microglial cells.17 Recent studies have shown that persistent activation of microglia for extended periods of time may result in irreversible damage to neurons and contribute to the pathogenesis of neurological disorders.14,18 Moreover, toxic factors released from activated microglia have been shown to mediate activation induced cell death through the regulation of apoptotic proteins including Received: May 24, 2012

A

dx.doi.org/10.1021/tx300234n | Chem. Res. Toxicol. XXXX, XXX, XXX−XXX

Chemical Research in Toxicology

Article

Table 1. PCR Primer Information gene

forward primer

reverse primer

Tm (°C)

product size (bp)

iNOS CD11b TNF-α IL-1β GAPDH

GGTGCAGAAGCACAAAGTCA CTGCCTCAGGATCCGTAAAG GGGCTCAGAATTTCCAACAA GCAATGGTCGGGACATAGTT CACTGTGCCCATCTATGAGGG

GAACTGGGGGAAACCATTTT CCTCTGCCTCAGGAATGACAT GAGACAGCCTGATCCACTCC GAATGTGCCACGGTTTTCTT TCCACATCTGCTGGAAGGTGG

58.0 51.6 55.0 57.0 61.8

193 260 190 189 400

caspase-3 and Bcl-2 family proteins.19,20 Hence, it is important that the population of activated microglia should be strictly controlled to protect the CNS from their deleterious effects. One interesting possibility is that chronic microglial activation if extended over long periods could lead to microglial overactivation followed by microglial degeneration. Therefore, the aim of present study was to evaluate whether Dichlorvos can induce microglial activation in vitro. Our results show that in response to Dichlorvos treatment microglial cells produce significant amounts of NO and pro-inflammatory cytokines. In addition, Dichlorvos treated microglia also showed overexpression of CD11b, which was followed by caspase 3 dependent apoptotic cell death.

■

for 20 min in the dark. The cells were washed once and resuspended in 300 μL of PBS. Acquisition time was 45 s with the use of fluorescence-activated cell scanner technology and CELLQUEST software (Becton Dickinson). Dead cells were excluded by propidium iodide (PI) staining. Determination of Cell Viability. Cell viability was quantitated by the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] reduction assay. Briefly, after 24 h of Dichlorvos treatment (0 to 50 μM) the cells (∼2 × 104 cells/mL) were incubated with 0.5 mg/mL MTT for 1 h at 37 °C and then solubilized by adding a solution containing 50% dimethylformamide and 20% sodium dodecyl sulfate (pH 4.7). The amount of MTT formazan produced was determined by measuring its absorbance at a test wavelength of 570 nm and a reference wavelength of 655 nm. Experimental Design. The study was divided into two groups: (a) control group, primary microglial cells were cultured and maintained in minimum essential medium (MEM) supplemented with 10% FBS for 3 DIV; (b) Dichlorvos treated group, primary microglial cells were cultured and maintained in minimum essential medium (MEM) supplemented with 10% FBS for 3 DIV and then treated with 10 μM (1/3rd of IC50) of Dichlorvos for 24 and 48 h. Measurement of Nitrite Accumulation. The concentration of nitrite, a stable oxidation product of NO, was estimated by Griess assay. Microglial cells (2 × 104 cells/well) were grown in 96-well tissue culture plates in the presence or absence of 10 μM Dichlorvos. Using a micropipet, 50 μL of culture supernatant was transferred to 96-well microtiter plates and mixed with 50 μL of the Griess reagent (0.1% N-[1-naphthyl]ethylenediamine dihydrochloride and 1% sulfanilamide in 2% phosphate solution). After incubation for 10 min at room temperature, the absorbance was measured with a microplate reader at a test wavelength of 540 nm and a reference wavelength of 655 nm. The standard curve was constructed with the culture medium containing known concentrations of sodium nitrite and employed to calculate the concentration of nitrite in samples. Flow Cytometry. Microglial cells (2 × 106 cells/well) were cultured in 6-well tissue culture plates and subjected to Dichlorvos treatment for 24 h; after incubation, cells were carefully removed with trypsin-EDTA and washed twice with PBS and blocked with blocking buffer (PBS with 1% BSA) at room temperature for 45 min followed by incubation with mouse monoclonal CD11b IgG2a primary antibody (1:500) at room temperature for 2 h. Cells were again subjected to two PBS washes and then incubated for 45 min at room temperature with FITC labeled rabbit antimouse secondary antibodies (1:1000). Finally, cells (1 × 105) were analyzed by flow cytometry. Semiquantitative PCR. Microglial cells (2 × 106 cells/well) were cultured in 6-well tissue culture plates. Total RNA was extracted from control and Dichlorvos treated microglial cells using Total RNA extraction kit (Taurus Scientific, India). Extracts were assayed to determine the quality and concentration of the RNA using spectrophotometer. Extracts were stored at −20 °C. Isolated RNA was then digested by DNase (Promega, Germany) to destroy contaminating DNA, and cDNA was synthesized with RevertAid H Minus M-muLV Reverse Transcriptase (Fermentas, Germany). Ten nanograms of cDNA was subjected to Reverse Transcriptase PCR amplification. For primer sequences, PCR conditions and sizes of PCR-products are shown in Table 1. Cytokine ELISA Immunoassays. TNF-α and IL-1β gene expressions, estimated from semiquantitative PCR, were evaluated

EXPERIMENTAL PROCEDURES

Reagents and Antibodies. Minimum essential medium (MEM) was purchased from Hyclone (Utah, USA). Fetal bovine serum (FBS) and 0.25% trypsin were purchased from Invitrogen (California, USA), while 96- and 6-well tissue culture plates, 25 cm2 T-flasks, and cell scrapers were purchased from Greiner bio-one (St. Gallen, Switzerland). Syringe filters (0.2 μL) were purchased from Millipore (Massachusetts, USA). Griess reagent and Dichlorvos were procured from Sigma-Aldrich (Missouri, USA). iNOS, CD11b, Bax, cytochrome c, and caspase 3 primary antibodies were purchased from Santa Cruz Biotechnologies (California, USA), whereas secondary antibodies were purchased from Bangalore Genei (Bangalore, India). All other chemicals used in this study were of tissue culture grade. Microglial Cell Culture. Wistar rats were used for all experiments, which were bred and kept under constant conditions (12 h light/12 h dark cycle) in the central animal house of the Institute. Neonatal pups of 1 to 2 days were sacrificed as per the guide lines of Institutional Animal Ethical Committee. The Principles of Laboratory Animal Care (NIH publication No. 85−23, revised 1996) guidelines were strictly followed for all experiments. All efforts were made to minimize the number of animals used and their suffering. Microglial cells were obtained from the mixed brain cell culture of newborn pups as previously described with slight modifications.21 Briefly, cerebral tissue was isolated aseptically, and the meninges were removed. Each dissected brain was cut into small fragments and triturated with a pipet, followed by 5−10 passes through a 20 gauge needle. The dissociated cells, were seeded in 25 cm2 plastic flasks at the density of 2 × 106 cells in MEM, supplemented with 60 U/mL of penicillin, and 50 mg/mL of streptomycin and maintained at 37 °C in an atmosphere of 95% air and 5% CO2 for 7 days in vitro (DIV). After 7 DIV, flasks were shaken carefully, and the cells in suspension were collected by centrifugation. The cells were transferred to the tissue culture plates and incubated for 24 h. Microglia were found to be the predominant cellular population as analyzed by flow cytometry using antibodies against the CD11b marker. Determination of Microglial Culture Purity. Microglial culture purity was assessed by the method of Campanella et al. with slight modifications.22 In brief, microglial cells were first sorted according to their size using flowcytometry, which provided a probable population of microglial cells. To select specific microglial cells from this population, samples were incubated for 30 min at 4 °C with monoclonal antirat CD11b (Santa Cruz Biotechnology) and washed with PBS twice. Samples were again incubated with fluorescein isothiocyanate (FITC) conjugated secondary antibody (Bangalore Genei) B

dx.doi.org/10.1021/tx300234n | Chem. Res. Toxicol. XXXX, XXX, XXX−XXX

Chemical Research in Toxicology

Article

Figure 1. Purity of the primary microglia culture. Primary microglial cells were cultured in minimum essential medium supplemented with 10% fetal bovine serum and incubated under 5% CO2 at 37 °C for 3 DIV. (a) Probable microglial cells were gated according to their size. (b) CD11b positive cells were analyzed by flow cytometry, and one parameter histogram depicts the percentage of microglial cells. M1 represents the CD11b positive cells, whereas M2 represents the CD11b negative cells. Flow cytometry results showed that approximately 84% of CD11b positive microglia were present in the primary culture.

Figure 2. Effect of Dichlorvos exposure on viability of microglia. Primary microglial cells were cultured in minimum essential medium supplemented with 10% fetal bovine serum and incubated in 5% CO2 at 37 °C for 3 DIV. (a) To estimate the inhibitory concentration (IC50) of Dichlorvos, MTT assay was carried out after 24 h of Dichlorvos treatment. IC50 was calculated using Grafit 6 software and found to be 32 μM. In subsequent experiments, 10 μM (1/3rd IC50) of Dichlorvos was used to treat microglial cells. (b) At 10 μM, Dichlorvos showed ∼20% cell death at 24 h and ∼50% at 48 h. (c) Propidium iodide staining showed significant increase in the number of dead cells after 24 h of Dichlorvos treatment. Data were expressed as the mean ± SEM of three independent experiments. ***p < 0.001; *p < 0.05. for protein expression using ELISA. For ELISA, microglial cells (2 × 104 cells/well) were cultured in 96-well plates. The conditioned medium was collected from microglial cells treated with Dichlorvos for different time intervals. The levels of TNF-α and IL-1β were measured using conventional sandwich ELISA kits from R&D Systems (Minnesota, USA). Assays were performed according to the manufacturer’s instructions. DAPI Staining. DAPI, a DNA-binding fluorescent dye, was used to detect any abnormality in the architecture of chromatin. After treatment with Dichlorvos (10 μM) for 48 h, the cells were washed three times with PBS, fixed in 1:1 acetone/methanol solution for 10 min at −20 °C, then stained with 500 ng/mL DAPI for 10 min. Cells were observed under a fluorescent microscope, and images were analyzed by ImageJ Software (version 1.32, NIH, USA). Propidium Iodide Staining. Cells, treated as indicated, were carefully resuspended in PBS containing 0.1% Triton X-100 (Sigma)

and 100 units/mL RNase A (Sigma) were stained with 50 μg/mL PI (Sigma), incubated at 37 °C for 15 min, and analyzed by using FACS Calibur (BD Biosciences). Cell death was assessed by PI staining, and relative numbers were calculated by calculating the % increase in PI proportional to the untreated sample with the following equation: [(% treated PI+) − (% untreated PI+)]/(% untreated PI+ × 100). DNA Fragmentation. DNA was isolated from the control as well as Dichlorvos treated microglial cells grown in 6 well tissue culture plates (2 × 106 cells/well) using Apoptotic-Ladder Kit (G-Biosciences, Missouri, USA). Samples were processed according to the manufacturer’s instructions and were subjected to 1.8% agarose gel electrophoresis. Preparation of Mitochondrial and Cytosolic Fractions for Immunoblotting. The cytosolic and mitochondrial fractions were prepared by the method of Tang et al.23 At the time of fractionation, the integrity of mitochondria was checked by assessing the respiratory C

dx.doi.org/10.1021/tx300234n | Chem. Res. Toxicol. XXXX, XXX, XXX−XXX

Chemical Research in Toxicology

Article

Immunoblot Analysis. The protein was isolated from mitochondrial and cytoplasmic fractions of microglia from control as well as Dichlorvos treated (48 h) cells. Samples containing 75 μg of protein were boiled in Laemmli buffer for 5 min and subjected to electrophoresis (12% SDS−PAGE) followed by transfer to nitrocellulose membrane. The blots were blocked with 5% nonfat dry milk for 5 h, the membranes were then incubated with primary Bax/cytochrome c/caspase-3/β-actin (1:100) at room temperature for 3 h. After incubation, the nitrocellulose membrane was washed with PBS plus 0.1% Tween-20 for 30 at 5 min intervals. The membrane was again incubated for 1 h at 37 °C with horseradish peroxidase (HRP) conjugated secondary antibody. After 1 h of incubation, the blots were again washed with PBS plus 0.1% Tween-20 for 30 at 5 min interval of time. Immunoreactive proteins were visualized by a DAB (diaminobenzidine)-system. The densitometry analysis of the protein bands was carried out using AlphaEase FC software to compare the relative expression of proteins. Protein Estimation. Protein was determined by the method of Lowry et al. using bovine serum albumin as standard.24 Statistical Analysis. For all experiments, data were analyzed from at least three independent experiments, each with at least duplicate determinations. Student’s t-test was applied to compare the statistical difference between control and Dichlorvos treated cells. Statistical analysis of the data was performed using Sigma Stat 3.5 software with statistically significant values representing a p level of 0.05 or below. Error bars represent standard error of means (SEM).

control ratio and marker enzymes (data not shown). The microglia were homogenized (20 strokes) in 500 μL of buffer A (20 mM HEPES, pH 7.5, 50 mM KCl, 5 mM EGTA, 1 mM EDTA, 2 mM MgCl2, 220 mM mannitol, 68 mM sucrose, 1 mM leupeptin, 5 μg/mL pepstatin A, 5 μg/mL aprotinin, and 0.5 mM PMSF). The homogenate was then centrifuged at 1000g for 10 min at 4 °C. The resulting supernatant contained the cytosolic fractions, and the pellets contained enriched mitochondrial fractions. The cytosolic fractions were stored at −80 °C until further analysis. Pellets containing mitochondria were treated with the lysis buffer (1× PBS, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 250 mM sucrose, 20 mM Tris− HCl, pH 7.4, 1 mM DTT, and protease inhibitor) and were incubated on ice for 20 min. The lysate was centrifuged at 10,000g at 4 °C for 30 min. The resulting supernatant was kept as solubilized mitochondrial enriched fraction and stored at −80 °C until further use.

■

RESULTS Determination of Microglial Culture Purity. Microglial culture purity was assessed with the help of flowcytometry. Figure 1a shows the gating of probable microglial cells according to their size. To estimate the exact percentage of microglia in this population flowcytometry was done using a CD11b (microglia specific surface marker) monoclonal antibody. Figure 1b

Figure 3. Effect of Dichlorvos exposure on NO production. After Dichlorvos treatment, NO levels were estimated at different time intervals. Significant increase was observed after 24 h of Dichlorvos treatment (10 μM) and ∼4 fold increase after 48 h when compared with that of the control. Data were expressed as the mean ± SEM of three independent experiments. ***p < 0.001 and *p < 0.05, significantly different from the control group.

Figure 4. Effect of Dichlorvos exposure on iNOS and pro-inflammatory cytokine expression. Primary microglial cells were cultured in minimum essential medium supplemented with 10% fetal bovine serum and incubated in 5% CO2 at 37 °C for 3 DIV. (a) Semiquantitative PCR results show significant up-regulation of iNOS mRNA when treated with Dichlorvos. (b) Immunoblot results also show a significant increase in the iNOS protein levels when treated with Dichlorvos. (c and e) Total RNA was isolated and cDNA synthesized from control and Dichlorvos treated microglial cells. Semiquantitative PCR results show significant increase in mRNA levels of TNF-α at 24 h of Dichlorvos treatment. IL-1β and mRNA levels are also significantly high in Dichlorvos treated cells when compared to those of control cells. (d and f) Secreted TNF-α and IL-1β levels were checked at 12 h intervals of Dichlorvos treatment using sandwich ELISA. Dichlorvos treatment resulted in a slight but nonsignificant increase in TNF-α level during 0 to 12 h. However, a significant increase was observed after 24 h of treatment. The IL-1β shows significant increase in its level after 24 h of treatment when compared to that of the control. Data were expressed as the mean ± SEM of three independent experiments. ***p < 0.001, significantly different from the control group. D

dx.doi.org/10.1021/tx300234n | Chem. Res. Toxicol. XXXX, XXX, XXX−XXX

Chemical Research in Toxicology

Article

Figure 5. Effect of Dichlorvos exposure on CD11b expression. Primary microglial cells were cultured in minimum essential medium supplemented with 10% fetal bovine serum and incubated in 5% CO2 at 37 °C for 3 DIV. (a) Flow cytometry results show a significant increase in the CD11b expression on microglial cell surface when treated with Dichlorvos for 24 h. (b) Semiquantitative PCR results show significant increase in CD11b mRNA levels in the presence of Dichlorvos when compared with those of control cells. Data were expressed as the mean ± SEM of three independent experiments. **p < 0.01 and ***p < 0.001, significantly different from the control group.

Figure 6. DAPI staining of microglial cells after Dichlorvos exposure. Primary microglial cells were cultured in minimum essential medium supplemented with 10% fetal bovine serum and incubated in 5% CO2 at 37 °C for 3 DIV. (a) Fluorescent images of control and Dichlorvos treated microglial cells show marked increase in nuclear disintegration after treatment. (b) Surface plots of control and Dichlorvos treated microglial cells were constructed by using ImageJ software. A single peak represents an intact nucleus, whereas multifurcated peaks represent a fragmented nucleus. (c) The histogram shows the percentage of cells having fragmented nuclei after 48 h of Dichlorvos treatment. Data were expressed as the mean ± SEM of three independent experiments. ***p < 0.001, significantly different from the control group. Magnification, 100×.

represents the one parameter histogram (a graph of cell count on the y-axis and the measurement parameter on x-axis), wherein

M1 represents the CD11b positive cells, and M2 represents the CD11b negative cells. Results showed that the culture possesses E

dx.doi.org/10.1021/tx300234n | Chem. Res. Toxicol. XXXX, XXX, XXX−XXX

Chemical Research in Toxicology

Article

approximately 84% of CD11b positive microglial cells (Figure 1c). Only CD11b positive cells were considered as microglia, and dead cells were excluded. Dichlorvos Treatment Results in Decreased Viability of Primary Microglial Cells. The viability of primary microglial cells was determined by MTT assay after Dichlorvos treatment. Cells were treated with different concentrations of Dichlorvos for 24 h. The inhibitory concentration (IC50) of Dichlorvos was calculated and found to be ∼32 μM (Figure 2a). In subsequent experiments, 1/3rd IC50 concentration of Dichlorvos, i.e., 10 μM was used. At 10 μM, MTT assay results showed time dependent decrease in the microglial viability (Figure 2b). Flow cytometry results also showed significant increase in the number of propidium iodide (PI) stained microglial cells after Dichlorvos treatment (Figure 2c). Dichlorvos Treatment Results in Increased NO Production. We analyzed the media of control and Dichlorvos treated microglial cells at different time intervals (i.e., 12, 24, 36, and 48 h) and found significant increase (∼ 4 fold) in NO levels after 24 h of treatment when compared to those of control cells (Figure 3). Dichlorvos Mediated Up-Regulation of Inducible Nitric Oxide Synthase (iNOS) and Pro-Inflammatory Cytokines. Increased NO levels in microglial cells that we observed might be due to the up-regulation of iNOS. Results of semiquantitative PCR analysis showed significant (p < 0.001) increase in iNOS mRNA expression (∼3 fold) of Dichlorvos treated cells when compared to that of the control (Figure 4a). Immunoblot analysis further showed significant up-regulation of iNOS protein expression after Dichlorvos treatment when compared to that of control cells (Figure 4b). Next, we tried to find out whether Dichlorvos treatment brought any change in pro-inflammatory cytokine levels of microglial cells. Semiquantitative PCR results show significant (p < 0.001) upregulation of TNF-α (∼2.5 fold) and IL-1β (∼2 fold) mRNA levels in Dichlorvos treated microglial cells when compared to those in control cells (Figure 4c and 4e). In addition, ELISA results show a significant increase in secreted TNF-α and IL-1β levels up to 24 h of Dichlorvos treatment (Figure 4d and f). Dichlorvos Treatment Results in Microglial Activation. To check the role of Dichlorvos in activation of microglia, expression of CD11b was analyzed. The flowcytometry results showed a significant (p < 0.001) increase in the CD11b expression on Dichlorvos treated microglial cells after 24 h as compared to that in control cells (Figure 5a). In addition, semiquantitative PCR analysis showed significant increase (∼2fold) in the expression of CD11b mRNA after 24 h of Dichlorvos treatment (Figure 5b). Dichlorvos Treatment Induced Cellular Damage in Primary Microglia. After estimating the activation status of microglia, next we wanted to check whether Dichlorvos treatment mediates any damage to microglial cells. Results of DAPI staining showed significant increase (∼8-fold) in micro nuclei formation after 48 h of Dichlorvos treatment (Figure 6). Dichlorvos Treatment Induced DNA Fragmentation in Primary Microglia. Next, we checked the magnitude of damage caused by Dichlorvos treatment on genomic assembly. The DNA isolated from control and Dichlorvos treated microglial cells showed numerous oligonucleosomal fragments when subjected to agarose gel electrophoresis. As is evident from Figure 7, Dichlorvos exposure for 48 h (lane 3) resulted in DNA fragmentation in microglial cells when compared to control cells (lane 2).

Figure 7. DNA fragmentation analysis of microglial cells after Dichlorvos exposure. DNA was isolated from control as well as Dichlorvos treated microglial cells. The obtained DNA was subjected to agarose (1.8%) gel electrophoresis. Lane 1, 100 bp ladder; lane 2, DNA from control cells; lane 3, DNA from Dichlorvos treated cells. After 48 h of Dichlorvos treatment, DNA was broken into small fragments as evident in lane 3.

Extended Dichlorvos Exposure Mediates Apoptosis in Microglia. Finally, we analyzed the expression of key proteins involved in the apoptotic process, such as Bax, cytochrome c, and caspase-3. Western blot results showed significant increase in the Bax expression in mitochondrial fractions (Figure 8a), increased (∼2-fold) cytochrome c release from mitochondria into cytosol (Figure 8b), and significant increase (∼3-fold) in caspase-3 activation (Figure 8c) when treated with Dichlorvos for 48 h. However, these changes were not observed in control cells.

■

DISCUSSION The present study provides the following two important findings. First, Dichlorvos can activate microglial cells. Second, if the exposure extends for longer periods of time, then the microglia become over-activated and finally end up in apoptotic cell death. Recently, it has been reported that on receiving stress signals, microglia get activated before neuronal degeneration.25 Activated microglia are identified based on combined morphological and immunophenotypic changes which distinguish F

dx.doi.org/10.1021/tx300234n | Chem. Res. Toxicol. XXXX, XXX, XXX−XXX

Chemical Research in Toxicology

Article

Figure 8. Immunoblot analysis of Bax, cytochrome c, and caspase-3 in microglia after Dichlorvos exposure. To check whether microglia undergo caspase dependent apoptotic cell death, immunoblotting of apoptotic mediators like Bax, cytochrome c, and caspase-3 was carried out. (a) Results show significant increase in the expression of Bax in mitochondrial fraction, and (b) cytochrome c release in cytosolic fraction (c) increased the expression of active caspase-3 in cytosolic fractions of Dichlorvos treated cells when compared to those of control cells. Data were expressed as the mean ± SEM of three independent experiments. ***p < 0.001, **p < 0.01, and *p < 0.05 significantly different from the control group.

Dichlorvos was used to treat microglia in subsequent experiments. At 10 μM concentration of Dichlorvos, we observed time dependent decrease in the viability of microglial cells (Figure 2b). In parallel experiments, we found that the loss of viability was preceded by increased production of proinflammatory molecules. Studies have shown that these molecules are supposed to mediate the activation of microglia.28 It has been shown that concentration and source of NO can determine the response of the cell to NO exposure, and proapoptotic and antiapoptotic responses to NO appear to be specific to the type of cells that are involved. In many cell types including macrophages, pancreatic islets, neurons, and thymocytes, NO activates apoptosis.29 Therefore, we measured the NO levels in microglia and observed significant increase in the NO production after Dichlorvos treatment (Figure 3) asNO is synthesized by iNOS, and microglia are the major cellular source of iNOS in the CNS. Therefore, we wanted to check whether this increase in NO levels was due to any change in the expression of iNOS. Semiquantitative PCR and immunoblotting experiment results showed significant increase in the iNOS expression in microglial cells which were treated with Dichlorvos when compared to that of control cells (Figure 4a and b). These results are in line with the previous reports which also showed Mevinphos (OP) induced toxicity via NO produced by activated iNOS.30

them from their resting phenotype. The initial trigger for microglial activation are signals emitted by damaged cells of CNS that promote resting cells to divide, promote increased production of cytokines and growth factors, and change in surface antigen expression. A chronic inflammatory reaction occurs if damaged cells continue to send out stress signals and result in persistent microglial activation.26 Such prolonged over-activation will cause microglia to become senescent and undergo degenerative changes and eventually lead to widespread microglial degeneration. Once a critical number of microglia have undergone this type of accidental cell death, neurons will have lost all microglial support and are destined to follow a path of slow neurodegeneration, reflected morphologically by abnormal inclusions (e.g., Lewy bodies) and/or neurofibrillary degeneration.25 In the present study, we used Dichlorvos as a stressor in primary microglial culture. On the basis of pharmacokinetic models and biomonitoring data, Buratti et al. have recently proposed that OP concentrations around 10 μM (in vitro; corresponding to 2.6, 2.5, and 1.6 μg/mL of methyl Parathion, methyl Paraoxon, and Dimefox, respectively) reflect comparable conditions as observed in general humans OP exposure cases.27 Moreover, the concentrations higher than 100 μM reflect acute accidental intoxication. Therefore, in order to mimic the in vivo conditions, 1/3rd of IC50, i.e., 10 μM (2.21 μg/mL) G

dx.doi.org/10.1021/tx300234n | Chem. Res. Toxicol. XXXX, XXX, XXX−XXX

Chemical Research in Toxicology

Article

binding of procaspase-9 with Apaf-1 to form the apoptosome complex following the release of cytochrome c from damaged mitochondria.42 Moreover, Paraquat and Rotenone induce cytochrome c release43,43 and caspase-9 activation, which are preceded by the induction/activation of pro-apoptotic Bax and Bak.44,45 Thus, it is important to regulate the population of activated microglia in order to maintain a balance in normal microglial functioning. Our results suggest that microglia are first activated in the presence of Dichlorvos and eventually undergo apoptotic cell death if the exposure extends to longer time periods.

Increased expression of pro-inflammatory cytokines by microglial lineage cells is a well described phenomenon that occurs in response to numerous activating stimuli. We also observed an ∼2-fold increase in mRNA as well as protein levels of both TNF-α and IL-1β cytokines in primary microglia treated with Dichlorvos (Figure 4c−f). Next, we checked the expression of microglial activation marker CD11b. Results showed significant up-regulation of CD11b expression, both at mRNA as well as protein levels, after Dichlorvos treatment (Figure 5). These findings are in line with previous reports, which have shown that microglia in the brain regions are susceptible to OPs and rapidly become active on exposure.31,32 Together, these results suggest that Dichlorvos exposure could induce the activation of microglial cells in vitro. It has been found that Dichlorvos can induce DNA damage in mammalian cells at low concentrations, even after short exposure.33 In addition, excessive NO release on OP exposure has been found to play an important role in CNS damage.15 Meanwhile, NO has also been reported to induce apoptotic death of a variety of cells including, macrophages, 34 thymocytes,35 pancreatic islets,36 and certain neurons.37 Apoptosis is an active process of cell destruction with specifically defined morphological and molecular features. It is considered as a beneficial process whereby organisms eliminate unwanted, i.e. old, precancerous, or excessive, cells without the further nearby tissue injuries shown in necrosis.38 However, in central nervous tissues that have a limited capacity for selfrenewal, apoptotic cell death may result in physiological or pathological disorders, which may underlie the etiology of neurodegenerative diseases.38 Next, DAPI staining was performed to assess the extent of nuclear damage after Dichlorvos treatment. Results showed significant increase in nuclear fragmentation after Dichlorvos treatment (Figure 6). One of the hallmarks of apoptotic cell death is genomic disassembly and its breakdown into oligonucleosomal fragments. The DNA isolated from Dichlorvos treated microglial cells showed characteristic oligonucleosomal fragmentation, which was absent in the DNA isolated from control cells (Figure 7). Doherty et al. have demonstrated that the incidence of micro nuclei formation increases after exposure to Trichlorfon in human lymphoblastoid cells, which suggests that OPs are potentially genotoxic.39 Preliminary studies undertaken in primary lymphocytes showed that Dichlorvos caused similar levels of DNA damage measured by the alkaline comet assay. The findings were supported by Eroglu who reported that Dichlorvos was able to damage DNA in freshly isolated lymphocytes, at shorter exposure time and lower concentrations40 than the experiments conducted here. Till now, the molecular mechanism of Dichlorvos induced microglial cell death is not reported in the literature. On the basis of the results of DAPI staining and DNA fragmentation analysis, we propose that microglia might undergo apoptotic cell death when exposed to Dichlorvos for longer period of time. To confirm this, studies of proteins involved in the apoptotic pathway was carried out. We found a significant increase in accumulation of Bax in mitochondria, cytochrome c release from mitochondria, and caspase 3 activation in Dichlorvos treated microglia (Figure 8), which confirms the involvement of apoptosis in activation induced cell death of microglia. Investigation by Kashyap et al. showed that Monocortophos exposure altered the expressions of caspase 3 and caspase 9, genes involved in apoptosis signaling cascade, in PC12 cells.41 The caspase cascade activation involved the

■

CONCLUSIONS Taken together, the results of the present study suggest that Dichlorvos exposure results in increased production of proinflammatory molecules like TNF-α, IL-1β, and NO in primary microglial cells. We observed enhanced microglial activation after Dichlorvos treatment which ultimately culminates in apoptotic cell death. Still, much needs to be learned about the processes that lead to microglial degeneration as well as the consequences of microglial cell death in brain function.

■

AUTHOR INFORMATION

Corresponding Author

*Fax: 091-0172-2744401. E-mail: [email protected]. Funding

The financial assistance provided to A.S. by Council of Scientific and Industrial Research (CSIR), New Delhi, India, and to D.R.S. and W.Y.W. by Indian Council of Medical Research (ICMR), New Delhi, India, is greatly acknowledged. Notes

The authors declare no competing financial interest.

■

ABBREVATIONS OP, organophosphate; NO, nitric oxide; iNOS, inducible nitric oxide synthase; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; TNF-α, tumor necrosis factor-α; IL1β, interleukin-1β; FITC, fluorescein isothiocyanate; CNS, central nervous system, DAPI, 4′,6-diamidino-2-phenylindole

■

REFERENCES

(1) Streit, W. J., and Kincaid-Colton, C. A. (1995) The brain’s immune system. Sci. Am. 273 (54−5), 58−61. (2) Streit, W. J., Walter, S. A., and Pennell, N. A. (1999) Reactive microgliosis. Prog. Neurobiol. 57, 563−581. (3) Calabrese, V., Mancuso, C., Calvani, M., Rizzarelli, E., Butterfield, D. A., and Stella, A. M. (2007) Nitric oxide in the central nervous system: neuroprotection versus neurotoxicity. Nat. Rev. Neurosci. 8, 766−775. (4) Takeuchi, H., Wang, J., Kawanokuchi, J., Mitsuma, N., Mizuno, T., and Suzumura, A. (2006) Interferon-gamma induces microglialactivation-induced cell death: a hypothetical mechanism of relapse and remission in multiple sclerosis. Neurobiol. Dis. 22, 33−39. (5) Mayo, L., Jacob-Hirsch, J., Amariglio, N., Rechavi, G., Moutin, M. J., Lund, F. E., and Stein, R. (2008) Dual role of CD38 in microglial activation and activation-induced cell death. J. Immunol. 181, 92−103. (6) Costa, L. G. (2006) Current issues in organophosphate toxicology. Clin. Chim. Acta 366, 1−13. (7) Perera, P. M., Jayamanna, S. F., Hettiarachchi, R., Abeysinghe, C., Karunatilake, H., Dawson, A. H., and Buckley, N. A. (2009) A phase II clinical trial to assess the safety of clonidine in acute organophosphorus pesticide poisoning. Trials. 10, 73.

H

dx.doi.org/10.1021/tx300234n | Chem. Res. Toxicol. XXXX, XXX, XXX−XXX

Chemical Research in Toxicology

Article

(8) Sarabia, L., Maurer, I., and Bustos-Obregon, E. (2009) Melatonin prevents damage elicited by the organophosphorous pesticide diazinon on mouse sperm DNA. Ecotoxicol. Environ. Saf. 72, 663−668. (9) Shenouda, J., Green, P., and Sultatos, L. (2009) An evaluation of the inhibition of human butyrylcholinesterase and acetylcholinesterase by the organophosphate chlorpyrifos oxon. Toxicol. Appl. Pharmacol. 241, 135−142. (10) Howard, A. S., Bucelli, R., Jett, D. A., Bruun, D., Yang, D., and Lein, P. J. (2005) Chlorpyrifos exerts opposing effects on axonal and dendritic growth in primary neuronal cultures. Toxicol. Appl. Pharmacol. 207, 112−124. (11) Giordano, G., Afsharinejad, Z., Guizzetti, M., Vitalone, A., Kavanagh, T. J., and Costa, L. G. (2007) Organophosphorus insecticides chlorpyrifos and diazinon and oxidative stress in neuronal cells in a genetic model of glutathione deficiency. Toxicol. Appl. Pharmacol. 219, 181−189. (12) Verma, S. K., Kumar, V., and Gill, K. D. (2009) An acetylcholinesterase-independent mechanism for neurobehavioral impairments after chronic low level exposure to Dichlorvos in rats. Pharmacol., Biochem. Behav. 92, 173−181. (13) Boje, K. M., and Arora, P. K. (1992) Microglial-produced nitric oxide and reactive nitrogen oxides mediate neuronal cell death. Brain Res. 587, 250−256. (14) Block, M. L., and Hong, J. S. (2007) Chronic microglial activation and progressive dopaminergic neurotoxicity. Biochem. Soc. Trans. 35, 1127−1132. (15) Kim, Y. B., Hur, G. H., Shin, S., Sok, D. E., Kang, J. K., and Lee, Y. S. (1999) Organophosphate-induced brain injuries: delayed apoptosis mediated by nitric oxide. Environ. Toxicol. Pharmacol. 7, 147−152. (16) Kawanishi, S., Hiraku, Y., Pinlaor, S., and Ma, N. (2006) Oxidative and nitrative DNA damage in animals and patients with inflammatory diseases in relation to inflammation-related carcinogenesis. Biol. Chem. 387, 365−372. (17) Monnet-Tschudi, F., Zurich, M. G., and Honegger, P. (2007) Neurotoxicant-induced inflammatory response in three-dimensional brain cell cultures. Hum. Exp. Toxicol. 26, 339−346. (18) Rogers, J., Mastroeni, D., Leonard, B., Joyce, J., and Grover, A. (2007) Neuroinflammation in Alzheimer’s disease and Parkinson’s disease: are microglia pathogenic in either disorder? Int. Rev. Neurobiol. 82, 235−246. (19) Lee, J., Hur, J., Lee, P., Kim, J. Y., Cho, N., Kim, S. Y., Kim, H., Lee, M. S., and Suk, K. (2001) Dual role of inflammatory stimuli in activation-induced cell death of mouse microglial cells. Initiation of two separate apoptotic pathways via induction of interferon regulatory factor-1 and caspase-11. J. Biol. Chem. 276, 32956−32965. (20) Mayo, L., and Stein, R. (2007) Characterization of LPS and interferon-gamma triggered activation-induced cell death in N9 and primary microglial cells: induction of the mitochondrial gateway by nitric oxide. Cell Death Differ. 14, 183−186. (21) Giulian, D., and Baker, T. J. (1986) Characterization of ameboid microglia isolated from developing mammalian brain. J. Neurosci. 6, 2163−2178. (22) Campanella, M., Sciorati, C., Tarozzo, G., and Beltramo, M. (2002) Flow cytometric analysis of inflammatory cells in ischemic rat brain. Stroke 33, 586−592. (23) Tang, D. G., Li, L., Zhu, Z., and Joshi, B. (1998) Apoptosis in the absence of cytochrome c accumulation in the cytosol. Biochem. Biophys. Res. Commun. 242, 380−384. (24) Lowry, O. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951) Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265−275. (25) Graeber, M. B., and Streit, W. J. (2010) Microglia: biology and pathology. Acta Neuropathol. 119, 89−105. (26) Block, M. L., and Hong, J. S. (2005) Microglia and inflammation-mediated neurodegeneration: multiple triggers with a common mechanism. Prog. Neurobiol. 76, 77−98.

(27) Buratti, F. M., Leoni, C., and Testai, E. (2007) The Human Metabolism of Organophosphorothionate Pesticides: Consequences for Toxicological Risk Assesment. J. Verbr. Lebensm. 2, 37−44. (28) Hanisch, U. K., and Kettenmann, H. (2007) Microglia: active sensor and versatile effector cells in the normal and pathologic brain. Nat. Neurosci. 10, 1387−1394. (29) Zhou, L., and Zhu, D. Y. (2009) Neuronal nitric oxide synthase: structure, subcellular localization, regulation, and clinical implications. Nitric Oxide 20, 223−230. (30) Chang, A. Y., Chan, J. Y., Kao, F. J., Huang, C. M., and Chan, S. H. (2001) Engagement of inducible nitric oxide synthase at the rostral ventrolateral medulla during mevinphos intoxication in the rat. J. Biomed. Sci. 8, 475−483. (31) Zimmer, L. A., Ennis, M., and Shipley, M. T. (1997) Somaninduced seizures rapidly activate astrocytes and microglia in discrete brain regions. J. Comp. Neurol. 378, 482−492. (32) Schori, H., Robenshtok, E., Schwartz, M., and Hourvitz, A. (2005) Post-intoxication vaccination for protection of neurons against the toxicity of nerve agents. Toxicol. Sci. 87, 163−168. (33) Benford, D. J., Price, S. C., Lawrence, J. N., Grasso, P., and Bremmer, J. N. (1994) Investigations of the genotoxicity and cell proliferative activity of Dichlorvos in mouse forestomach. Toxicology 92, 203−215. (34) Messmer, U. K., and Brune, B. (1996) Nitric oxide-induced apoptosis: p53-dependent and p53-independent signalling pathways. Biochem. J. 319, 299−305. (35) Fehsel, K., Kroncke, K. D., Meyer, K. L., Huber, H., Wahn, V., and Kolb-Bachofen, V. (1995) Nitric oxide induces apoptosis in mouse thymocytes. J. Immunol. 155, 2858−2865. (36) McDaniel, M. L., Corbett, J. A., Kwon, G., and Hill, J. R. (1997) A role for nitric oxide and other inflammatory mediators in cytokineinduced pancreatic beta-cell dysfunction and destruction. Adv. Exp. Med. Biol. 426, 313−319. (37) Heneka, M. T., Loschmann, P. A., Gleichmann, M., Weller, M., Schulz, J. B., Wullner, U., and Klockgether, T. (1998) Induction of nitric oxide synthase and nitric oxide-mediated apoptosis in neuronal PC12 cells after stimulation with tumor necrosis factor-alpha/ lipopolysaccharide. J. Neurochem. 71, 88−94. (38) Thompson, C. B. (1995) Apoptosis in the pathogenesis and treatment of disease. Science 267, 1456−1462. (39) Doherty, A. T., Ellard, S., Parry, E. M., and Parry, J. M. (1996) A study of the aneugenic activity of trichlorfon detected by centromerespecific probes in human lymphoblastoid cell lines. Mutat. Res. 372, 221−231. (40) Eroglu, H. E. (2009) Toxic nuclear effects of the organophosphorus insecticide Dichlorvos (DDVP) in human peripheral blood lymphocytes. Acta Biol. Hung. 60, 409−416. (41) Kashyap, M. P., Singh, A. K., Kumar, V., Tripathi, V. K., Srivastava, R. K., Agrawal, M., Khanna, V. K., Yadav, S., Jain, S. K., and Pant, A. B. (2011) Monocrotophos induced apoptosis in PC12 cells: role of xenobiotic metabolizing cytochrome P450s. PLoS One 6, e17757. (42) Saraste, A. (1999) Morphologic criteria and detection of apoptosis. Herz 24, 189−195. (43) Ahmadi, F. A., Linseman, D. A., Grammatopoulos, T. N., Jones, S. M., Bouchard, R. J., Freed, C. R., Heidenreich, K. A., and Zawada, W. M. (2003) The pesticide rotenone induces caspase-3-mediated apoptosis in ventral mesencephalic dopaminergic neurons. J. Neurochem. 87, 914−921. (44) Fei, Q., McCormack, A. L., Di Monte, D. A., and Ethell, D. W. (2008) Paraquat neurotoxicity is mediated by a Bak-dependent mechanism. J. Biol. Chem. 283, 3357−3364. (45) Yang, W., and Tiffany-Castiglioni, E. (2008) Paraquat-induced apoptosis in human neuroblastoma SH-SY5Y cells: involvement of p53 and mitochondria. J. Toxicol. Environ. Health A 71, 289−299.

I

dx.doi.org/10.1021/tx300234n | Chem. Res. Toxicol. XXXX, XXX, XXX−XXX