Different Lipopolysaccharide Branched-Chain Amino Acids Modulate

Article pubs.acs.org/JAFC

Different Lipopolysaccharide Branched-Chain Amino Acids Modulate Porcine Intestinal Endogenous β‑Defensin Expression through the Sirt1/ERK/90RSK Pathway Man Ren,†,‡,∥ Shihai Zhang,†,∥ Xutong Liu,† Shenghe Li,‡ Xiangbing Mao,§ Xiangfang Zeng,*,† and Shiyan Qiao*,† †

State Key Laboratory of Animal Nutrition, China Agricultural University, No. 2 Yuanmingyuan West Road, Beijing 100193, China College of Animal Science, Anhui Science & Technology University, No. 9 Donghua Road, Fengyang, Anhui 233100, China § Animal Nutrition Institute, Sichuan Agricultural University, No. 46 Xinkang Road, Yucheng, Ya’an 625014, China ‡

S Supporting Information *

ABSTRACT: Nutritional induction of endogenous antimicrobial peptide expression is considered a promising approach to inhibit the outgrowth and infection of pathogenic microbes in mammals. The present study investigated possible regulation of porcine epithelial β-defensins in response to branched-chain amino acids (BCAA) in vivo and in vitro. BCAA treatment increased relative mRNA expression of jejunal and ileal β-defensins in weaned piglets. In IPEC-J2 cells, isoleucine, leucine, and valine could stimulate β-defensin expression, possibly associated with stimulation of ERK1/2 phosphorylation. Inhibition of Sirt1 and ERK completely blocked the activation of ERK and 90RSK protein by isoleucine, simultaneously decreasing defensin expression. BCAA stimulate expression of porcine intestinal epithelial β-defensins with isoleucine the most, potent possibly through activation of the Sirt1/ERK/90RSK signaling pathway. The β-defensins regulation of lipopolysaccharide was related with an ERK-independent pathway. BCAA modulation of endogenous defensin might be a promising approach to enhance disease resistance and intestinal health in young animals and children. KEYWORDS: porcine, defensin, intestine, Sirt1, ERK1/2, 90RSK

■

INTRODUCTION The mucosal immune system of the gastrointestinal tract plays a primary role in the interaction between the host and commensal and potentially pathogenic microorganisms. As an adult-type, highly complex microbiota is established during the first two years after birth, the development of a neonatal gastrointestinal immune system is crucial to maintain tolerance to harmless antigens and commensal bacteria.1 Inadequate immune responses to pathogens or inappropriate active reaction against harmless antigens can impair children’s development and health.2 Pigs and humans share parallel mucosal barrier physiology, food intake, enteric microbe composition, and similar metabolic and intestinal physiologic processes. Compared to rats, a greater correlation between humans and pigs had been demonstrated by a mucosal permeability study.3 It has been demonstrated that pigs represent a more physiologically relevant model of neonatal necrotizing enterocolitis, intestinal ischemia−reperfusion injury, short bowel syndrome, and stress-induced intestinal dysfunction. Thus, the porcine model is one of the best models for researchers in gastrointestinal immune function and nutrition.4,5 Liberal antibiotic use combined with the rapid and widespread emergence of pig and human pathogens that are resistant to multiple antibiotics has fueled a potential global public health crisis.6 The research has proved that the abundance and diversity of antibiotic resistance genes in gut microbes of pigs was increased even using a low,7 short dose of © 2016 American Chemical Society

antibiotics in pig diet. Consequently, novel methods of inhibiting microbial outgrowth and infection are needed. Stimulating the innate immune system by nutritional modulation was suggested as a possible method.8 Secretion of an endogenous broad-spectrum antimicrobial peptide (AMP) is one of the essential elements in innate immune system of mammals. The epithelial cells lining the gut produce a rich arsenal of AMP, including defensins and cathelicidins (two families of cationic AMP), for reflecting the complexity of the microbial challenges faced by these tissues and the continuous threat of microbial invasion at these sites.9 Defensins are divided into three subfamilies, α, β, and θ, that differ in the position of their disulfide bridge, and 13 different β-defensins have been reported in pigs until now.10 Porcine β-defensin 1 (pBD-1), pBD-2, pBD-3, pBD-129, and epididymis protein 2 splicing variant C (pEP2C) are expressed in a wide range of tissues, whereas pBD-4, pBD-123, and pBD-125 are restricted in the male reproductive tissue.11,12 Recently, increasing evidence indicates that AMP can function as a potent immune regulator by chemokine receptor pathway and/or by inhibiting or enhancing Toll-like receptor (TLR) signaling instead of directing kill microorganisms.13,14 Thus, the capacity of microbes to develop antimicrobial resistance might be Received: Revised: Accepted: Published: 3371

February April 12, April 15, April 15,

29, 2016 2016 2016 2016 DOI: 10.1021/acs.jafc.6b00968 J. Agric. Food Chem. 2016, 64, 3371−3379

Article

Journal of Agricultural and Food Chemistry Table 1. Primer Sequences for qPT-PCR in Experiment primer sequence

product length (bp)

Tm (°C)

pBD1

396819

5′TGCCACAGGTGCCGATCT3′ 5′CTGTTAGCTGCTTAAGGAATAAAGGC3′

81

60

pBD2

404699

5′ACCTGCTTACGGGTCTTG3′ 5′CTCTGCTGTGGCTTCTGG3′

168

60

pBD3

404703

5′ACCAAGCACGCCTTCCTATC3′ 5′GCATTTTCGGCCACTCACAG3′

236

60

pBD114

100170135

5′TGTACCTTGGTGGATCCTGAACGA3′ 5′CGCCCTCTGAATGCAGCATATCTT3′

240

62

pBD129

100170137

5′CAAAGACCACTGTGCCGTGAATGA3′ 5′TTGATGCTGGCGAAAGGGTTGGTA3′

131

62

pEP2C

100188900

5′ACTGCTTGTTCTCCAGAGCC3′ 5′TGGCACAGATGACAAAGCCT3′

92

58

β-actin

397563

5′TGCGGGACATCAAGGAGAAG3′ 5′AGTTGAAGGTGGTCTCGTGG3′

176

58

GADPH

396823

5′ACCACAGTCCATGCCATCAC3′ 5′TCCACCACCCTGTTGCTG3′

452

60

gene

gene ID

anti-rabbit IgG was purchased from Cell Signaling Technology. The ERK inhibitor PD98059 and the Sirt1 inhibitor splitomocin were purchased from Sigma-Aldrich (St. Louis, MO, USA). Alanine, isoleucine, leucine, and valine were purchased from Sigma-Aldrich. MEM vitamin solution (M 6895) and Earle’s balanced salts were purchased from Sigma-Aldrich. DMEM/F12, phosphate-buffered saline (PBS) (0.01 M) and 0.05% trypsin was purchased from Hyclone (Logan, UT, USA). Fetal bovine serum (FBS) was purchased from Gibco (Carlsbad, CA, USA). Insulin transferrin selenium (ITS) and endothelial growth factor (EGF) were purchased from Sciencell (Carlsbad, CA, USA) and Sigma-Aldrich, respectively. Animals and Experimental Design. Twenty-four male pigs (Landrace × Yorkshire × Duroc barrows) weaned at 28 days of age were obtained. The initial body weight of piglets was 7.96 ± 0.26 kg. The experiment was conducted at the experimental farm of China Agricultural University, with the protocol for animal use approved by the Animal Care and Use Committee of China Agricultural University. All piglets had ad libitum access to feed and water throughout the 14 day experiment period. The average temperature during the experiment was 26 °C. The experiment was designed as a single-factor arrangement, including three dietary treatments (Supporting Information Table 1). The control treatment (CON) was the base corn−soybean meal diet (21% CP). The protein-restricted treatment (PR) was a diet with a lower content of protein (17%CP), and four essential amino acids (lysine, methionine, threonine, and tryptophan) were supplemented in it to the NRC swine requirements.20 The BCAA diet was supplemented with valine, isoleucine, and leucine in the PR diet according to the NRC swine requirement.20 Cell Culture and Treatment. The porcine intestinal epithelial cell line IPEC-J2, originally derived from jejunal epithelium of the neonatal piglet, was kindly provided by Dr. Guoyao Wu (Texas A&M University). Cell monolayers were cultured in 6-well plates (Nunc, Thermo Fisher Scientific) in a humidified atmosphere with 5% CO2 at 37 °C. Standard media for feeding cells consisted of DMEM/F12, 5% FBS, 1% ITS, and 5 μg/mL EGF. In stimulation experiments, cells were seeded in 6-well tissue culture plates (8 cm2/well; Nunc, Thermo Fisher Scientific) and used at 70−80% confluence. Before the start of the experiment, the cells were starved for 2 h in serum and amino acidfree EBSS medium, which was mixed by Earle’s balanced salts and 1%

invaluable to the overall physiological effectiveness of many types of AMPs in this situation.9 However, presumably due to issues regarding cell toxicity and susceptibility to degradation, the majority of host antimicrobial peptide therapies were designed for experimental use only.15 Inducing host animicrobial peptide expression by nutrients (such as isoleucine, vitamin D, and short-chain fatty acids (SCFA)), as a safety therapy is studied currently and parts of the mechanism are revealed in vitro. The expression, secretion, and activity of AMP are controlled by development, damage, bacteria, or nutrients.9 Research has found LPS and some probiotic bacteria can stimulate AMP expression. Recently, a surprising observation came with the recognition that the human AMP gene CAMP is stimulated by vitamin D3.16 Meanwhile, Zeng et al. revealed that in porcine intestinal epithelial cells, 3D4/31 macrophages, and primary monocytes, pBD2, pBD3, pEP2C, and protegrins were induced markedly in response to SCFA and their analogues.17 As essential amino acid of mammalians, deficiency of branchedchain amino acids (BCAA) could decrease innate immunity.18 In human research, isoleucine can induce the expression of βdefensin in kinds of epithelial cells.19 However, there is little known about the cell pathway of isoleucine, leucine, and valine and regulation of porcine β-defensin expression in intestinal epithelium. In this study, we examined whether BCAA have the capacity to stimulate the expression of porcine epithelial βdefensin in vivo and in vitro. Weaned pigs and intestinal IPECJ2 cells were used to evaluate possible regulation mechanisms of porcine β-defensin in response to BCAA. Furthermore, the possible signaling pathway of BCAA and LPS modulation of defensin expression was investigated.

■

MATERIALS AND METHODS

Antibodies and Reagents. Anti-ERK1/2, anti-phosphate-ERK1/ 2, anti-Sirt1, anti-phosphate-90RSK, and anti-β-actin were used from Cell Signaling Technology (Danvers, MA, USA). HRK-conjugated 3372

DOI: 10.1021/acs.jafc.6b00968 J. Agric. Food Chem. 2016, 64, 3371−3379

Article

Journal of Agricultural and Food Chemistry

Figure 1. Relative gene expression of pBD-1, pBD-2, pBD-114, and pBD-129 in the duodenum (A, B), jejunum (C, D), ileum (E, F), and mesenteric lymph node (G, H) of pigs offered the CON, PR, or BCAA diet for 2 weeks, as determined by qRT-PCR. Messenger RNA levels were standardized to β-actin (A, C, E, G) and GADPH (B, D, F, H). White bars, gray bars, or black bars represent CON, PR, or BCAA treatment, respectively. Values are presented as the mean ± SEM, n = 6 pigs per treatment. P value of each gene expression in difference treatment is shown in each pattern. Mean values with unlike letters (a, b) were significantly different (P < 0.05). CON, control treatment with corn−soybean-based diet; PR, protein-restricted treatment with protein-restricted diet; BCAA, branched-chain amino acid treatment with supplement of BCAA in the PR diet. isoleucine for different times (0, 6, 12, or 24 h) or 1.0 μg/mL LPS (24 h). After different hours of incubation, the cell protein was collected for Western blot analysis. For signal inhibition experiment, IPEC-J2 cells (starved following the above-mentioned method) were pretreated

vitamin solution. Following starvation, the cells were cultured for 24 h in the presence of different treatment solutions. To test the cell pathway, IPEC-J2 cells were starved in EBSS medium for 2 h and then cultured in new EBSS medium with 0.8 mM 3373


Article


Figure 2. Relative gene expression of β-defensin in porcine intestinal epithelial cell line IPEC-J2 after different amino acid treatments for 24 h (triplicates). Messenger RNA levels were standardized to β-actin. White bars, gray bars, or black bars represent porcine β-defensin pBD-2, pBD-3, or pEP2C, respectively. Values are presented as the mean ± SEM, n = 6. (∗) Different from DMEM (A), 0 h (B), 0 mM (C, D, E), or alanin (F), respectively. (A) DMEM (including essential amino acids) and EBSS medium (no essential amino acids) affect the expression of defensin in IPECJ2. (B) Defensin stimulation in IPEC-J2 cell is related to the time of exposure to isoleucine. Isoleucine (C), leucine (D), or valine (E) affects the defensin expression in different concentration. (F) Interaction among the three BCAAs was observed in defensin expression of IPEC-J2. (Millipore) at 90 V and 4 °C for 40−100 min. After being blocked in TBS-T containing 5% milk for 2 h, the membrane was incubated at 4 °C overnight with primary antibodies (1:1000). After being washed, the membrane was incubated with anti-rabbit IgG-conjugated horseradish peroxidase (1:5000) and reacted with ECL-Plus chemiluminescent reagent (Amersham Biosciences, Piscataway, NJ, USA). Image on the membrane was exposed and captured by AlphaImager 2200 (Alpha Innotech, San Leandro, CA, USA) automatically. Band densities were quantified using AlphaImager 2200 (Alpha Innotech,). Finally, the densitometry of protein abundance was normalized by the loading control (namely, β-actin). Statistical Analysis. All of the statistical analyses were performed using Prism software, version 5 (Graphpad, San Diego, CA, USA). Statistical significance of different treatments was determined by GLM procedure using the statistical software SAS version 9.3 (SAS Institute). The minimal level of confidence at which experimental results were considered significant was P < 0.05.

for 1 h with PD98059 (20 or 100 ng/mL) or splitomicin (30 or 150 μM). Then, these cells were cocultured in the presence of 0.8 mM isoleucine or 1.0 μg/mL LPS and inhibitors (above-mentioned) for 24 h to examine the mRNA expression or for 6 h to examine protein abundance. Sample Preparation. In animal tests, at the 14th day of the trial, one segment of 5−8 cm of the middle of the duodenum, the jejunum, and the ileum was first rinsed with ice-cold normal saline solution (0.9% w/v) and then stored at −80 °C until assay. After stimulation, cells were washed twice with PBS and harvested. RNA of tissues or cells was collected with RNAzol RT (Molecular Research Center, Cincinnati, OH, USA) according to the supplier’s instructions for RTPCR. For collecting protein, tissues or cells were lysed with radioimmunoprecipitation assay buffer (50 mM Tris·HCl at pH 7.4, 1% NP-40, 150 nM NaCl, 1 mM EDTA, 1 mM phenylmethanesulfonyl fluoride, 1 mM MaF, 1 mM Na3VO4, and 1% protease inhibitors) on ice and centrifuged at 13000 rpm for 15 min at 4 °C. After determination of the protein concentration using the BCA protein assay (Pierce, Rockford, IL, USA), samples were boiled at 100 °C for 10 min in 4× sample buffer for a following Western assay. Quantitative Real-Time PCR. Total RNA quality and quantity were determined by Nanodrop. Subsequently, 1 μg of total RNA was reverse transcribed in cDNA with RT reagents (TaKaRa Biotechnology Co., Ltd., Dalian, China) according to routine procedure. Primers for quantitative real-time PCR were designed using Primer Premier 5.0 software (Table 1). Real-time quantitative PCR was conducted using a SYBR Premix Ex TaqII kit (TaKaRa Biotechnology Co., Ltd.) and performed in an ABI5700 system (Applied Biosystems, Singapore). The following conditions were used: 95 °C for 30 s, then 45 cycles at 95 °C for 5 s, and 60 °C for 34 s. Melt curve analysis was performed to confirm the presence of a single PCR product for each reaction, and agarose gel electrophoresis was used to confirm that PCR products were the expected sizes. Each sample was measured in triplicate. The ΔΔCt method was used to analyze and quantify samples. Data are presented as the means of triplicate samples ± SD. To ensure the accuracy of animal test qRT-PCR date, we chose two classical housekeeping genes, β-actin and GADPH, as the reference genes. Western Blot. Proteins (30 μg/lane) were separated through a 10% sodium dodecyl sulfate−polyacrylamide electrophoresis gel (BioRad) and transferred to a methanol-presoaked PVDF membrane

■

RESULTS Expression of Intestinal β-Defensins Was Stimulated by Branched-Chain Amino Acids in Vivo. To inspect whether BCAA in pig diet affect β-defensin expression of intestinal tissues, three treatments of weaned piglets were designed. Four porcine β-defensins (pBD-1, pBD-2, pBD-114, and pBD-129) were screened for qRT-PCR analysis (Figure 1). Only mRNA expression of pBD-2, pBD-114, and pBD-129 was analyzed in the duodenum and mesenteric lymph node as we found that transcription of the pBD-1 gene in the two tissues was so low that it could not be tested in this study (Supporting Information Figure 1). No significant effect was found on mRNA expression of β-defensins in the duodenum and mesenteric lymph node relative to either β-actin or GADPH (Figure 1A,B,G,H). The intragroup difference of the defensins mRNA expression in the above two tissues was greater than the intergroup difference. The PR and CON groups had similar mRNA expressions of β-defensins in the small intestine (Figure 1A−F) except pBD-1 in the jejunum. Compared with pigs 3374


Article


Figure 3. Western-blotting analysis of phosphorylated ERK1/2 and 90RSK and inhibitors function on defensin expression in IPEC-J2 cells (triplicates). (A) Isoleucine phosphorylated ERK1/2 beginning from 0 to 6 h after the start of treatment. The relative abundance of phosphorylated ERK1/2 is presented as the mean ± SEM, n = 3. (B) Expression of defensins with exposure of inhibitors and/or isoleucine in IPEC-J2 for 24 h. White bars, gray bars, or black bars represent porcine β-defensin pBD-2, pBD-3, or pEP2C, respectively. Messenger RNA levels were standardized to β-actin. (C) Western-blotting analysis of ERK1/2 and 90RSK in inhibitor treatments of IPEC-J2 for 6 h. The relative abundance of phosphorylated ERK1/2 and 90RSK is presented as the mean ± SEM p-p42/p44: p-ERR1/2. (∗) Different from 0 h (A) or alanine (B, C), respectively.

offered the CON and PR diets, pigs offered the BCAA diet had a significantly higher expression of the four defensins in the jejunum and ileum (Figure 1C−F) (P < 0.05), except the expression of pBD-1 and pBD-2 in the jejunum relative to the housekeeping GADPH (Figure 1D). Branched-Chain Amino Acids Were Potent Activators of β-Defensin Gene Expression in Epithelial Cell IPEC-J2 in Vitro. To analyze the influence of BCAA on β-defensin expression in porcine intestinal epithelial cells, we treated IPEC-J2 cells with amino acids and analyzed three types of βdefensin gene expressions by real-time quantitive PCR. First, to define the effect of amino acids in DMEM/F12 medium for epithelial cell β-defensin expression, IPEC-J2 cells were cultured in serum-free DMEM/F12 (including valine, leucine, isoleucine, phenylalanine, tryptophan, lysine, threonine, methionine, and glutamine) or serum- and amino acid-free EBSS medium for 24 h. Not surprisingly, removal of the essential amino acids, which cannot be synthesized by mammalian cells, decreased all three β-defensin expressions

for the scarcity of nutrition (Figure 2A). However, the effect of isoleucine stimulation on β-defensin expression was more obvious in EBSS medium than in DMEM/F12. After removal of essential amino acids from the medium, a higher defensin expression was observed in IPEC-J2 cells after exposure in 1.0 mM L-isoleucine and EBSS medium for 24 h (Figure 2A). To confirm the specificity of defensin production by each factor, IPEC-J2 cells were incubated with EBSS medium in the following tests. It has been demonstrated that L-isoleucine induces the production of β-defensin in bovine kidney epithelial cells and human lung epithelial cells in vitro.21,22 At first, in IPEC-J2, the expression of three β-defensins, pBD-2, pBD-3, and pEP2C, was related to the time of exposure to isoleucine (Figure 2B). After exposure to 1.0 mM L-isoleucine,that the expressions of pBD-2, pBD-3, and pEP2C were highest at 24 h than at other times illustrates defensin stimulation of nutrient needs enough time (P < 0.05). Following the expression of pBD-2, pBD-3, and pEP2C in IPEC-J2 after exposure, different concentrations 3375


Article


LPS Affect β-Defensin Gene Expression in Epithelial Cell IPEC-J2. To analyze the influence of LPS on defensin expression in pig intestinal epithelial cells, we treated IPEC-J2 cells with 1.0 μg/mL LPS for 24 h and analyzed pBD-2, pBD-3, and pEP2C gene expression by the use of real-time PCR. Basal constitutive gene expression of pEP2C was not affected by LPS (Figure 4A). In contrast, expression of the pBD-2 and pBD-3 genes in IPEC-J2 was clearly induced upon LPS treatment. Under the LPS treatment with 1.0 μg/mL LPS, the induction of pBD-2 and pBD-3 was tested at 7.4- and 10.3-fold, respectively (Figure 4A). However, more research is needed for whether the LPS stimulation is influenced by time or dose. There is no

of amino acids for 24 h were tested, and the result showed isoleucine, leucine, and valine can stimulate β-defensin expression (Figure 2C,D,E). Of the three BCAAs, isoleucine was the strongest promoter of β-defensins in IPEC-J2, and the highest β-defensin expression was seen in 0.8 mM L-isoleucine (Figure 2C). pEP2C expression was more sensitive to valine and leucine than pBD-2 and pBD-3. The strongest effect of leucine and valine for stimulating β-defensin expression was shown at the concentrations of 0.1 and 0.2 mM, respectively (Figure 2D,E). To confirm the specificity of β-defensin production by BCAA, IPEC-J2 cells were incubated during 24 h with different concentrations of alanine, and alanine in any concentration (0−1.6 mM) did not induce the expression of βdefensin genes (Supporting Information Figure 2). Alanine was used to equal nitrogen in the following signaling tests. The interaction among the three BCAAs was observed in IPEC-J2. Three different combinations of BCAA were designed as 0.6 mM isoleucine + 0.1 mM leucine + 0.2 mM valine (I), 0.8 mM isoleucin + 0.1 mM leucine + 0.2 mM valine (II), and 1.0 mM isoleucine + 1.0 mM leucine + 1.0 mM valine (III). After 24 h, β-defensin expression was tested, and there was a synergistic action of the three amino acids in treatment II; the expression of three β-defensins stimulated by combination II was surprisingly higher than the sum stimulated by each single amino acid (Figure 2F). BCAA-Induced β-Defensins Expression Was Regulated by ERK1/2 and Sirt1 Signaling Pathways in IPECJ2. The data above demonstrate that BCAAs stimulate expression of β-defensins in porcine intestinal epithelial cells. To further understand the molecular mechanisms regulating the expression of β-defensins in IPEC-J2, we used inhibitors that inhibit the activity of signaling factor and asked which cell signal was necessary and sufficient to induce β-defensin promoter activation. The phosphorylation of ERK1/2 protein by isoleucine, leucine, or valine in IPEC-J2 was examined using a Western blot analysis. Isoleucine, leucine, or valine phosphorylated p44/42 (ERK1/2) beginning from 1 to 6 h after the start of treatment (Figure 3A; Supporting Information Figure 3). To confirm the involvement of the ERK signaling pathway in the induction of β-defensin mRNA expression, an ERK inhibitor (PD98059) was added to IPEC-J2 cells for 1 h before exposure in isoleucine or alanine treatment. The PD98059 treatment reduced the induction of defensins by isoleucine (Figure 3B). We also investigated if the transcript factor 90RSK was activated by isoleucine, and this pathway was blocked by PD98059 (Figure 3C), indicating the significant involvement of the ERK/90RSK signaling pathway in isoleucine induction. While the above results strongly suggest an inductional act via activation of ERK1/2, there have been conflicting reports suggesting that isoleucine produces its effect by activation of Sirt1, a NAD-dependent deacetylase.23 To assess whether Sirt1 may play a role in the process of isoleucine-induced β-defensin expression, we utilized a Sirt1 inhibitor to determine whether it would block the effect of isoleucine on defensin-expression signaling. IPEC-J2 cells were pretreated for 1 h and then cotreated with splitomicin (30 or 150 μM), which inhibits Sirt1, in the presence of isoleucine (0.8 mM) for 24 h. Splitomicin, either 30 or 150 μM, co-incubation had a negative effect on the isoleucine-induced defensin expression (Figure 3B) and blocked isoleucine-stimulated ERK/90RSK signaling (Figure 3C), even though the Sirt1 protein was not affected (Supporting Information Figure 4).

Figure 4. Regulation of LPS on defensin expression in IPEC-J2 for 24 h (A) and Western-blotting analysis of phosphorylated ERK1/2 (B) and 90RSK (C) after stimulating LPS (triplicates). (A) White bars, gray bars, or black bars represent porcine β-defensin pBD-2, pBD-3, or pEP2C, respectively. Messenger RNA levels were standardized to βactin. (∗) Different from the nontreated control group. (B, C) The relative abundance of phosphorylated ERK1/2 and 90RSK is presented as the mean ± SEM. LPS, lipopolysaccharide; Con, nontreated control group; p-p42/p44, p-ERR1/2. 3376


Article


been proposed that activation of the ERK signaling pathway by isoleucine mediated the expression of human β-defensin 2 (hBD2),32 and the current study proved that BCAA activated ERK1/2 and its downstream target 90RSK (a transcript factor) and induced the porcine epithelial β-defensin expression. Moreover, some nutrients had been reported to activate ERK signaling; for example, SCFA induced cathelicidin LL-37 expression through ERK1/2 signaling in colon cells,33 and amino acids interfere with ERK1/2-dependent control of macro-autophagy in intestinal cells.34 Thus, the ERK1/2 cell signaling might be associated with stimulating gut AMP and immune defense function of nutrients.35,36 Sirt1, the mammalian homologue of Sir2 in Saccharomyces cerevisiae, is an NADdependent deacetylase and widely described as a mediator of lifespan.37,38 Recently, more studies proved Sirt1 also can act as a nutrient-sensitive growth mediator.39 The first research conducted on BCAA and Sirt1 was a long-term dietary supplementation with a BCAA-enriched amino acid mixture, which increased the average lifespan of male mice. This was accompanied by increased mitochondrial biogenesis and Sirt1 expression.40 Although Sirt1 expression was not affected by isoleucine in porcine epithelial cell IPEC-J2 (Supporting Information Figure 4), it played a role in the signaling pathway of defensin induction by isoleucine in the current study. The inhibition of Sirt1 blocked activation of ERK1/2 and its downstream target p-90RSK and reduced the increase of defensin expression induced by isoleucine. Our data are the first to show that the induction of porcine β-defensin by BCAA was mediated by Sirt1; however, the actions of Sirt1 on ERK1/2 are not clear. From Western-blotting results (Figure 3), the inhibitors splitomicin and PD98059 completely blocked the activation of ERK/90RSK by isoleucine and decreased the mostly increasing defensins. However, expression of defensins in isoleucine and inhibitor treatments was higher than that of alanine control treatment (Figure 3B), which illustrated besides Sirt1/ERK/90RSK, isoleucine had other signaling pathways to induce expression of defensin (Figure 4). The infected bacteria were the first discovered AMP regulator,40 then research found LPS and some probiotic bacteria also can stimulate AMP expression and they worked dependent on nuclear factor-κB (NF-κB).41,42 The current study also observed the effect of LPS on the expression of defensins that pBD2 and pBD3 were clearly induced upon LPS treatment in IPEC-J2. Different from former research,32,34 not all tested porcine epithelial β-defensins were induced by LPS in the IPEC-J2 experiment. Until now, all known porcine defensins are constitutively expressed in porcine tissue; in other words, induced defensins were not found in swine as they were detected under the normal physiology of pigs. The βdefensin type affected by LPS might be limited, and more studies are needed to reveal this. In 2008, an observation recognized that the human AMP gene CAMP is under transcriptional control of a vitamin D response element (VDRE).43 Following skin injury or infection, 25-OH vitamin D3 is hydroxylated to 1,25-OH vitamin D3, and this is stimulated locally by activation of TLR2 or local cytokines. CAMP expression is rapidly induced by binding of 1,25-OH vitamin D3 to the VDRE.11,38 Zeng et al.12 and Sunkara et al.44 reported that cathelicidins and defensins were induced by SCFA and their analogues in kinds of porcine and chicken cells through the MEK-ERK signaling pathway,28 similar to BCAA (current study). Becker et al.45 reported the AMP gene can be activated under normal physiological conditions in response to

evidence about the relationship of LPS induction and ERK signaling. The phosphorylated ERK1/2 and 90RSK in IPEC-J2 exposed to 1.0 μg/mL LPS for 0, 1, 3, or 6 h was determined. The results showed that LPS reduced phosphorylated ERK1/2 (Figure 4B) and has no effect on the phosphorylation of 90RSK (Figure 4C). In other words, the induction of LPS on βdefensin expression has no relationship with ERK signaling.

■

DISCUSSION The intestinal surface is faced with the enormous challenge of defending a large surface area to maintain homeostasis with abundant communities of commensal microorganisms and to prevent pathogen invasion. Epithelial AMP plays an essential role in allowing epithelial surfaces to cope with microbial challenge. These natural antibiotics are evolutionarily ancient innate immune effectors that are produced by almost all plants and animals.24 Besides direct bactericidal activity, AMPs also have immunoregulatory functions, such as chemotaxis13 and immature immune cell activation.25,26 Recent evidence reveals that many dietary compounds (such as vitamin D, SCFA, and amino acids) process the AMP-stimulating activity, and speciesspecific differences clearly exist.27,28 Recent research has revealed that pig intestine could express kinds of β-defensin.29 The IPEC-J2 line, as a nontransformed intestinal cell line originally derived from jejunal epithelium of the neonatal piglet,30 maintains some native characteristics including βdefensin expression.17,31 Therefore, weaned piglets and IPECJ2 cells were utilized as in vivo and in vitro models to investigate the effect of BCAA on β-defensin expression of porcine intestine. The expression of pBD-1 in the duodenum and mesenteric lymph node was hard to detect, whereas it was highly expressed in the jejunum and ileum (Supporting Information Figure 1). The result proved a former observation that the expression of porcine β-defensins is tissue-specific.11,28,30 Our results, that no difference of relative mRNA quantity of pBD-1, pBD-2, pBD114, and pBD-129 in the jejunum and ileum between CON and PR groups was observed, indicated expression of these four porcine β-defensins was not affected by the level of dietary protein and supplementation of lysine, methionine, threonine, and tryptophan. However, compared with the CON and PR groups, the BCAA group had a significantly higher relative mRNA quantity of porcine β-defensins in the jejunum and ileum of weaned piglets, which illustrated crystalline BCAA stimulated the expression of epithelial β-defensins in vivo. It also illustrated that effects of BCAA on defensin expression were not related to the higher amino acids or protein. In vitro experiment, isoleucine, leucine, and valine stimulated expression of porcine β-defensin pBD-2, pBD-3, and pEP2c in IPEC-J2 and isoleucine was the strongest promoter. However, the gene expression of pBD-1, pBD-114, and pBD-129 in IPEC-J2 was not regulated by BCAA (results not shown). The difference between in vivo and in vitro β-defensin induction by BCAA might be gene- and cell-type specific in porcine intestine.17 Although it has been suggested that isoleucine induces the transcription of the promoter of the AMP gene,21 the current study is the first to confirm the effect of essential amino acids, isoleucine, leucine, and valine, on the induction of porcine β-defensins in vivo and in vitro, as well as to observe a synergy among the three amino acids on this induction. ERK1 and ERK2 are related protein-serine/threonine kinases that participate in the regulation of a variety of processes including cell survival, metabolism, and transcription.31 It had 3377



■

the oscillating energy status of cells and tissues, and this regulation related with FOXO pathways independent of the NF-κB-derived innate immune pathways, which are essential after an acute infection.46 This mechanism ensures the sparse production of AMPs to maintain and strengthen the defense barrier and no tissue damage and repair by NF-κB-related inflammation in normal physiology. The ERK-dependent signaling pathway of BCAA and the ERK-independent induction of LPS on AMP expression seem to show the mechanisms of nutritional regulators and bacteria or infection on AMP expression are different. More research is needed to confirm (1) the relationship between the AMP-induced signaling of nutrition and infection, (2) the process of isoleucine, leucine, or valine signaling through the Sirt1/ ERK/90RSK pathway, and (3) the effects of intestinal βdefensins induced by isoleucine, leucine, or valine in vivo, and our further work is focused on these fields. In conclusion, the present study reveals that BCAAs have the ability to stimulate the expression of porcine epithelial βdefensins in vivo and in vitro. The inhibitor tests demonstrated that the essential amino acids, isoleucine, valine, and leucine, augmented the expression of porcine intestinal β-defensins through activation of the Sirt1/ERK/90RSK signaling pathway. Furthermore, different from BCAAs, the β-defensin regulation of LPS is an ERK-independentl pathway even though the LPS decreased the phosphorylation of ERK1/2.

■

ASSOCIATED CONTENT

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jafc.6b00968. Ingredients and chemical compositions of experiment diets; representative agarose gel electrophoresis of PCR products; alanine effects on defensin expressions; leucine and valine phosphorylation of ERK1/2; Western-blotting analysis of Sirt1 protein (PDF)

AUTHOR INFORMATION

Corresponding Author

*(X.Z.) Phone: +86 10 6273 1456. Fax: +86 10 6273 3688. Email: zengxf@mafic.ac.cn. Author Contributions ∥

REFERENCES

(1) Wang, M.; Radlowski, E.; Monaco, M.; Fahey, G.; Gaskins, H.; Donovan, S. Mode of delivery and early nutrition modulate microbial colonization and fermentation. J. Nutr. 2013, 143, 795−803. (2) Burkey, T.; Skjolaas, K.; Minton, J. Board-invited review: porcine mucosal immunity of the gastrointestinal tract. J. Anim. Sci. 2009, 87, 1493−1501. (3) Gonzalez, L.; Williamson, I.; Piedrahita, J.; Blikslager, A.; Magness, S. Cell lineage identification and stem cell culture in a porcine model for the study of intestinal epithelial regeneration. PLoS One 2013, 8, e66465. (4) Meurens, F.; Summerfield, A.; Nauwynck, H.; Saif, L.; Gerdts, V. The pig: a model for human infectious diseases. Trends Microbiol. 2012, 20, 50−57. (5) Zhang, Q.; Widmer, G.; Tzipori, S. A pig model of the human gastrointestinal tract. Gut Microbes. 2013, 4, 193−200. (6) Zhu, Y.; Johnson, T.; Su, J.; Qiao, M.; Guo, G.; Stedtfeld, R.; Hashsham, S.; Tiedje, H. Diverse and abundant antibiotic resistance genes in Chinese swine farms. Proc. Natl. Acad. Sci. U.S.A. 2013, 110, 3435−3440. (7) Looft, T.; Johnson, T.; Allen, H.; Bayles, D.; Alt, D.; Stedtfeld, R.; Sul, W.; Stedtfeld, T.; Chai, B.; Cole, J.; Hashsham, S.; Tiedje, J.; Stanton, T. In-feed antibiotic effects on the swine intestinal microbiome. Proc. Natl. Acad. Sci. U.S.A. 2012, 109, 1691−1696. (8) Veldhuizen, E.; Claassen, M.; van Dijk, A.; Haagsman, H. Porcine β-defensin 2 displays broad antimicrobial activity against pathogenic intestinal bacteria. Mol. Immunol. 2008, 45, 386−394. (9) Gallo, R.; Hooper, L. Epithelial antimicrobial defence of the skin and intestine. Nat. Rev. Immunol. 2012, 12, 503−516. (10) Zhang, G.; Wu, H.; Shi, J.; Ganz, T.; Ross, C.; Blecha, F. Molecular cloning and tissue expression of porcine beta-defensin-1. FEBS Lett. 1998, 424, 37−40. (11) Zhang, G.; Ross, C.; Blecha, F. Porcine antimicrobial peptides: new prospects for ancient molecules of host defense. Vet. Res. 2000, 31, 277−296. (12) Sang, Y.; Blecha, F. Porcine host defense peptides: expanding repertoire and functions. Dev. Comp. Immunol. 2009, 33, 334−343. (13) Niyonsaba, F.; Iwabuchi, K.; Someya, A.; Hirata, M.; Matsuda, H.; Ogawa, H.; Nagaoka, I. A cathelicidin family of human antibacterial peptied Ll-37 induces mast cell chemotaxis. Immunology 2002, 106, 20−26. (14) Di Nardo, A.; Braff, M.; Taylor, K.; Na, C.; Granstein, R.; Mclnturff, J.; Krutzik, S.; Modlin, R.; Gallo, R. Cathelicidin antimicrobial peptides block dendritic cell TLR4 actication and allergic contact sensitization. J. Immunol. 2007, 178, 1829−1834. (15) Mansour, C.; Pena, M.; Hancock, E. Host defense peptides: front-line immunomodulators. Trends Immunol. 2014, 35, 443−450. (16) Liu, P.; Stenger, S.; Li, H.; Wenzel, L.; Tan, B.; Krutzik, S.; Ochoa, M.; Schauber, J.; Wu, K.; Meinken, C.; Kamen, D.; Wagner, M.; Bals, R.; Steinmeyer, A.; Zügel, U.; Gallo, T.; Eisenberg, D.; Hewison, M.; Hollis, B.; Adams, J.; Bloom, B.; Modlin, R. Toll-like receptor triggering of a vitamin D-mediated human antimicrobial response. Science 2006, 311, 1770−1773. (17) Zeng, X.; Sumkara, L.; Jiang, W.; Bible, M.; Carter, S.; Ma, X.; Qiao, S.; Zhang, G. Induction of porcine host defense peptide gene expression by short-chain fatty acids and their analogs. PLoS One 2013, 8, e72922. (18) Wintergerst, E.; Maggini, S.; Hornig, D. Contribution of selected vitamins and trace elements to immune function. Ann. Nutr. Metab. 2007, 51, 301−323. (19) Sherman, H.; Chapnik, N.; Froy, O. Albumin and amino acids upregulate the expression of human beta-defensin 1. Mol. Immunol. 2006, 43, 1617−1623. (20) NRC. Nutrient Requirements of Swine, 11th ed.; National Academy Press: Washington, DC, USA, 201210.17226/13298. (21) Fehlbanum, P.; Rao, M.; Zasloff, M.; Anderson, G. An essential amino acids induces epithelial beta-defensin expression. Proc. Natl. Acad. Sci. U.S.A. 2000, 97, 12723−12728.

S Supporting Information *

■

Article

M.R. and S.Z. contributed equally to this work.

Funding

Supported by the National Key Basic Research Program (2012CB124704 and 2013CB127305), National Natural Science Foundation of China (Grant 31501968), University Research Project of Anhui Province (Grant KJ2015A296), Anhui Provincial Natural Science Foundation (Grant 1608085QC72), Foundation of Anhui Science & Technology University (ZRC2014453), and Foundation of Anhui Province 115 Industrial Innovative Team (seventh Batch). Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We thank the workers of the experimental farm of China Agricultural University for supporting the animal procedures. We appreciate Dr. Guoyao Wu for kindly providing the IPECJ2 cell line. Finally, we thank Xiangbing Mao and Guolong Zhang for providing some ideas during conversations. 3378


Article

Journal of Agricultural and Food Chemistry (22) Rivas-Santiago, C.; Rivas-Santiago, B.; León, D.; CastañedaDelgado, J.; Hernández, P. Induction of β-defensins by L-isoleucine as novel immunotherapy in experimental murine tuberculosis. Clin. Exp. Immunol. 2011, 164, 80−89. (23) D’Antona, G.; Ragni, M.; Cardile, A.; Tedesco, L.; Dossena, M.; Bruttini, F.; Caliaro, F.; Corsetti, G.; Bottinelli, R.; Carruba, M.; Valerio, A.; Nisoli, E. Branched-chain amino acids supplementation promotes survival and supports cardiac and skeletal muscle mitochondrial biogenesis in middle-aged mice. Cell Metab. 2010, 12, 362−372. (24) Zasloff, M. Antimicrobial peptides of multicellular organisms. Nature 2002, 415, 389−395. (25) Hancock, E.; Brown, L.; Mookherjee, N. Host defence peptides from invertebrates-emerging antimicrobial strategies. Immunobiology 2006, 211, 315−322. (26) Mookherjee, N.; Hancock, E. Cationic host defence peptides: innate immune regulatory peptides as a novel approach for treating infections. Cell. Mol. Life Sci. 2007, 64, 922−933. (27) Mao, X.; Qi, S.; Yu, B.; Huang, Z.; Chen, H.; Mao, Q.; Han, G.; Chen, D. Dietary L-arginine supplementation enhances porcine βdefensins gene expression in some tissues of weaned pigs. Livest. Sci. 2012, 148, 103−108. (28) Gombart, A.; Borregaard, N.; Koeffler, H. Human cathelicidin antimicrobial peptide (CAMP) gene is a direct target of the vitamin D receptor and is strongly up-regulated in myeloid cells by 1,25dihydroxyvitamin D3. FASEB J. 2005, 19, 1067−1077. (29) Schierack, P.; Nordhoff, M.; Pollmann, M.; Weyrauch, D.; Amasheh, S.; Lodemann, U.; Jores, J.; Tachu, B.; Kleta, S.; Blikslager, A.; Tedin, K.; Wieler, H. Characterization of a porcine intestinal epithelial cell line for in vitro studies of microbial pathogenesis in swine. Histochem. Cell Biol. 2006, 125, 293−305. (30) Mao, X.; Qi, S.; Yu, B.; He, J.; Yu, J.; Chen, D. Zn2+ and Lisoleucine induce the expression of porcine β-defensins in IPEC-J2 cells. Mol. Biol. Rep. 2013, 40, 1547−1552. (31) Liao, Y.; Shih, Y.; Chao, C.; Lee, X.; Chiang, T. Involvement of the ERK signaling pathway in fisetin reduces invasion and migration in the human lung cancer cell ling A549. J. Agric. Food Chem. 2009, 57, 8933−8941. (32) Konno, Y.; Ashida, T.; Inaba, Y.; Tanabe, H.; Maemoto, A.; Ayabe, T.; Mizukami, Y.; Fujiya, M.; Kohgo, Y. Isoleucine, an essential amino acid, induces the expression of human β-defensin 2 through the activation of the G-protein coupled receptor ERK patheay in the intestinal epithelia. Food Nutr. Sci. 2012, 3, 548−555. (33) Schauber, J.; Svanholm, C.; Termén, S.; Iffland, K.; Scheppach, W.; Melcher, R.; Agerberth, B.; Lührs, H.; Gudmundsson, G. Expression of the cathelicidin LL-37 is modulated by short chain fatty acids in colonocytes: relevance of signalling pathways. Gut 2003, 52, 735−741. (34) Pattingre, S.; Bauvy, C.; Codogno, P. Amino acids interfere with the ERK1/2-dependent control of macroautophagy by controlling the activation of Raf-1 in human colon cancer HT-29 cells. J. Biol. Chem. 2003, 278, 16667−16674. (35) Xu, J.; Hopkins, K.; Sabin, L.; Yasunaga, A.; Subramanian, H.; Lamborn, I.; Gordesky-Gold, B.; Cherry, S. ERK signaling couples nutrient status to antiviral defense in the insect gut. Proc. Natl. Acad. Sci. U.S.A. 2013, 110, 15025−15030. (36) Mieulet, V.; Yan, L.; Choisy, C.; Sully, K.; Procter, J.; Kouroumalis, A.; Krywawych, S.; Pende, M.; Ley, S.; Moinard, C.; Lamb, R. TPL-2-mediated activation of MAPK downstream of TLR4 signaling is coupled to arginine availability. Sci. Signaling 2010, 3, ra61. (37) Tanno, M.; Sakamoto, J.; Miura, T.; Shimamoto, K.; Horio, Y. Nucleocytoplasmic shuttling of the NAD+-dependent histone deacetylase SIRT1. J. Biol. Chem. 2006, 282, 6823−6832. (38) Michishita, E.; Park, J.; Burneskis, J.; Barrett, J.; Horikava, I. Evolutionarily conserved and nonconserved cellular localizations and functions of human SIRT proteins. Mol. Biol. Cell 2005, 16, 4623− 4635. (39) Choi, Y.; Bae, J.; Chae, H.; Kim, Y.; Sreymom, Y.; Han, L.; Jang, H.; Chin, Y. α-Mangostin regulates hepatic steatosis and obesity

through SirT1-AMPK and PPARγ pathways in high-fat diet-induced obese mice. J. Agric. Food Chem. 2015, 63, 8399−8406. (40) O’Neil, D.; Porter, E.; Elewaut, D.; Anderson, G.; Eckmann, L.; Ganz, T.; Kagnoff, M. Expression and regulation of the human βdefensins hBD-1 and hBD-2 in intestinal epithelium. J. Immunol. 1999, 163, 6718−6724. (41) Tsutsumi-Ishii, Y.; Nagaoka, I. NF-κB-mediated transcriptional regulation of human β-defensin-2 gene following lipopolysaccharide stimulation. J. Leukoc. Biol. 2002, 71, 154−162. (42) Wehkamp, J.; Harder, J.; Wehkamp, K.; Meissner, B.; Schlee, M.; Enders, C.; Sonnenborn, U.; Nuding, S.; Bengmark, S.; Fellermann, K.; Schröder, J.; Stange, E. NF-κB- and AP-1-mediated induction of human beta defensin-2 in intestinal epithelial cells by Escherichia coli nissle 1917: a novel effect of a probiotic bacterium. Infect. Immun. 2004, 72, 5750−5758. (43) Hata, T.; Kotol, P.; Gallo, R. Administration of oral vitamin D induces cathelicidin production in atopic indiciduals. J. Allergy Clin. Immunol. 2008, 122, 829−831. (44) Sunkara, L.; Achanta, M.; Schreiber, N.; Bommineni, Y.; Dai, G.; Jiang, W.; Lamont, S.; Lillehoj, H.; Beker, A.; Teeter, R.; Zhang, G. Butyrate enhances disease resistance of chickens by inducing antimicrobial host defense peptide gene expression. PLoS One 2011, 6, e27225. (45) Becker, T.; Loch, G.; Beyer, M.; Zinke, I.; Aschenbrenner, A.; Carrera, P.; Inhester, T.; Schultze, J.; Hoch, M. FOXO-dependent regulation of innate immune homeostasis. Nature 2010, 463, 369−373. (46) Dionne, M.; Pham, L.; Shirasu-Hiza, M.; Schneider, D. Akt and foxo dysregulation contribute to infection-induced wasting in drosophila. Curr. Biol. 2006, 16, 1977−1985.

3379


Different Lipopolysaccharide Branched-Chain Amino Acids Modulate

Recommend Documents