Dimerization through the RING-Finger Domain ... - ACS Publications

The movement of the piggyBac transposon is mediated through its cognate transposase. The piggyBac transposase binds to the terminal repeats present at...
1 downloads 0 Views 3MB Size
Download PDF
Article Cite This: Biochemistry XXXX, XXX, XXX−XXX

pubs.acs.org/biochemistry

Dimerization through the RING-Finger Domain Attenuates Excision Activity of the piggyBac Transposase Rahul Sharma,†,‡ Shivlee Nirwal,†,‡ Naveen Narayanan,†,‡ and Deepak T. Nair*,† †

Regional Centre for Biotechnology, NCR Biotech Science Cluster, 3rd Milestone, Faridabad-Gurgaon Expressway, Faridabad 121001, Haryana, India ‡ Manipal Academy of Higher Education, Manipal 576104, Karnataka, India S Supporting Information *

ABSTRACT: The movement of the piggyBac transposon is mediated through its cognate transposase. The piggyBac transposase binds to the terminal repeats present at the ends of the transposon. This is followed by excision of the transposon and release of the nucleoprotein complex. The complex translocates, followed by integration of the transposon at the target site. Here, we show that the RING-finger domain (RFD) present toward the C-terminus of the transposase is vital for dimerization of this enzyme. The deletion of the RFD or the last seven residues of the RFD results in a monomeric protein that binds the terminal end of the transposon with nearly the same affinity as wild type piggyBac transposase. Surprisingly, the monomeric constructs exhibit >2-fold enhancement in the excision activity of the enzyme. Overall, our studies suggest that dimerization attenuates the excision activity of the piggyBac transposase. This attribute of the piggyBac transposase may serve to prevent excessive transposition of the piggyBac transposon that might be catastrophic for the host cell.

T

polypeptide of corresponding transposases can be divided into three functional domains: N-terminal domain (NTD), catalytic domain (CatD), and C-terminal region (CTR).10 In the case of piggyBac transposase, the NTD extends from residue 1 to 129, the CatD from residue 130 to 522, and the CTR from residue 523 to 594. The N-terminal region shows divergence among various members of the piggyBac family and is predicted to be involved in binding to the LE and RE.10 The catalytic domain is the conserved core region and contains several highly conserved amino acids, including the predicted catalytic residues. The piggyBac transposase is included in the DDE superfamily of recombinases, and three aspartate residues (D268, D346, and D447) present in the CatD have been shown to be important for enzyme activity.9,11,12 Alignment of many piggyBac-like sequences shows that cysteine residues in the CTR are conserved and even the spacing between these residues is relatively well conserved.9−14 The arrangement of cysteine residues is characteristic of a RING-finger domain (RFD), and these motifs are known to participate in protein−protein interactions.15−18 In the piggyBac transposase, the RING-finger domain extends from residue 559 to 594 at the C-terminus and exhibits a C2C2CHC2 arrangement that is distinct from the C2CHC2C2 and

ransposons move from one location to another in the genome. These mobile genetic elements give rise to variation in the genome and can be responsible for horizontal gene transfer.1,2 Broadly, transposons are classified into two classes on the basis of transposition mechanism. Class I includes retrotransposons, which move via a RNA intermediate and follow a copy and paste mechanism. Class II includes DNA transposons that move via a cut and paste mechanism.3,4 Many DNA transposons are used to create libraries of mutants and as vectors for genome editing.5,6 The piggyBac transposon is a class II DNA transposon and was isolated from the cabbage looper moth, Trichoplusia ni.7,8 This transposon has a length of 2476 bp and is flanked by characteristic left end (LE, 35 bp) and right end (RE, 63 bp) sequences. Between these two ends, a single open reading frame (ORF) that encodes a 594-amino acid (68 kDa) transposase enzyme exists. The piggyBac transposase is the primary enzyme responsible for the movement of the piggyBac transposon. The transposase first binds to the two terminal LE and RE and then excises the transposon. The target site for this transposon is the TTAA sequence that flanks the terminal LE and RE and is duplicated after reinsertion of the element.7 The transposition mechanism involves formation of a hairpin intermediate at the end of the transposon DNA.9 The piggyBac and homologous mobile elements together constitute the piggyBac family of transposons. On the basis of sequence homology and secondary structure predictions, the © XXXX American Chemical Society

Received: November 27, 2017 Revised: April 30, 2018

A

DOI: 10.1021/acs.biochem.7b01191 Biochemistry XXXX, XXX, XXX−XXX

Article

Biochemistry C2C2HCC2 motifs seen before.19 The C2C2CHC2 arrangement has been observed before in a RING type E3 ubiquitin ligase.20 The RFD overlaps with a nuclear localization signal (NLS) that extends from residue 551 to 571.10,21 A recent structure of the RFD from piggyBac transposase shows that one Zn2+ ion is coordinated by residues C559, C562, C582, and H585 and the other Zn2+ ion is coordinated by residues C574, C577, C590, and C593.22 In the study presented here, we show that the RFD, especially the last seven residues of this domain, is important for dimerization. A computational model of the dimeric form of the RFD from piggyBac transposase suggested that the last seven residues were important for dimerization. Consequently, constructs in which the complete RFD and the C-terminal seven residues are deleted, termed ΔRFD and Δ7del, respectively, were prepared. Gel-filtration analysis, glutaraldehyde cross-linking, and dynamic light scattering studies showed that the ΔRFD and Δ7del proteins exist in the form of a monomer. However, these proteins can bind the LE of the piggyBac transposon with high specificity. An additional construct named 4CysAla in which the Zn coordination sites were disrupted was prepared, and this protein also exists in the form of a dimer. Surprisingly, the monomeric constructs ΔRFD and Δ7del protein show excision activity higher than that of the dimeric wild type piggyBac transposase and the 4CysAla construct. Overall, our studies reveal that dimerization through the RFD is vital for autoregulation of the excision activity of the piggyBac transposase. This property of the transposase may serve to optimize the frequency of transposition of the piggyBac transposon and prevent adventitious and unwarranted transposition.

The cells were lysed by sonication followed by centrifugation at 40000g RCF for 45 min and 4 °C. The filtered supernatant was loaded onto 10 mL of GST-Sepharose beads (GE Healthcare) pre-equilibrated with buffer A [25 mM sodium phosphate (pH 7.5), 5% glycerol, 0.25 M NaCl, and 2 mM DTT] and incubated for 3 h at 4 °C. The protein was released from the tag by incubation with PreScission protease (1 mg/ mL), and the eluted protein was concentrated and loaded onto a HiLoad 16/600 Superdex 200 size exclusion column (GE Healthcare). The recombinant protein was eluted in 25 mM HEPES (pH 7.5), 5% glycerol, 0.5 M NaCl, and 2 mM DTT. The purity of the protein was confirmed on a 12% sodium dodecyl sulfate−polyacrylamide gel electrophoresis (SDS− PAGE) gel. Finally, the protein was concentrated, and the concentration was estimated using a Micro BCA Protein Assay Kit (Thermo Scientific). The Δ7del, 4CysAla, and ΔRFD proteins were also purified using the same protocol utilized for wt-piggyBac transposase. Computational Model of the Dimeric Form of the RFD from piggyBac Transposase. The structure of the RFD from piggyBac transposase was determined recently, and the coordinates (Protein Data Bank entry 5LME) were utilized to obtain the possible structure of the homodimer using HADDOCK.22−26 The computational model of the homodimer provided by HADDOCK was subjected to conjugate gradient minimization. The interaction between the two chains was optimized by energy minimization using the CHARMM force field in DISCOVERY STUDIO (ACCELRYS). The complex reached the lowest potential energy from 3563.7 to −4438.9 kJ/mol in 3498 steps, and the minimized model of the homodimer was utilized for further analysis. The interactions between the monomers were identified using the CONTACT program of the CCP4 suite.27 Analytical Gel-Filtration Chromatography. The apparent molecular weights of wt-piggyBac transposase, Δ7del, 4CysAla, and ΔRFD were determined by gel-filtration chromatography using a Superdex 200 10/300 GL Column (GE Healthcare). The column was equilibrated with 25 mM HEPES (pH 7.5), 5% glycerol, 0.5 M NaCl, and 2 mM DTT at a flow rate of 0.3 mL/min. The column was first calibrated using different known molecular weight marker proteins. The void volume (Vo) was determined using blue dextran (2 MDa). A standard plot of log10(molecular mass) versus Ve/Vo was prepared and showed the characteristic linear correlation. After equilibration, 200 μg portions of wt-piggyBac transposase, Δ7del, 4CysAla, and ΔRFD were loaded separately onto the column, and the retention volume was noted to calculate the molecular weight and oligomeric state of the protein. Glutaraldehyde Cross-Linking. A glutaraldehyde solution (Sigma-Aldrich) was used for the chemical cross-linking reaction; 0.8 μM protein was incubated with 0.001% glutaraldehyde at room temperature for different periods of time. The reaction was stopped by adding 4 μL of Laemelli buffer [0.1% 2-mercaptoethanol, 0.0005% bromophenol blue, 2% SDS, 10% glycerol, and 63 mM Tris-HCl (pH 6.8)] and heating the sample at 90 °C for 10 min. All the samples were run on a 10% denaturing PAGE gel. The resolved proteins bands were detected by silver staining.28 Dynamic Light Scattering. Dynamic light scattering (DLS) experiments were performed using a Zetasizer Nano ZS90 (Malvern Instruments). All measurements were taken using a 12 μL cuvette at 298 K. DLS measurements were taken for wt-piggyBac transposase, Δ7del, 4CysAla, and ΔRFD.

■

MATERIALS AND METHODS Cloning, Expression, and Purification of wt piggyBac Transposase, Δ7del, 4CysAla, and ΔRFD. The chemically synthesized gene for wild type piggyBac transposase (wtpiggyBac transposase, 1785 bp) was obtained from Genscript and subcloned into expression vector pGEX-6P1 (GE Healthcare). This gene construct gives rise to a fusion protein of wtpiggyBac transposase with a GST tag at the N-terminus. The codons corresponding to the 559th residue and 588th residue were modified to stop codons by site-directed mutagenesis. These constructs give rise to a truncated version of wt-piggyBac transposase lacking the RFD and the last seven residues named ΔRFD and Δ7del, respectively, with N-terminal GST tags. One more construct (4CysAla) in which four cysteine residues at positions 559, 562, 574, and 576 were mutated to alanine was prepared. Competent cells of the Escherichia coli Rosetta gami (DE3) strain were transformed with 100 ng of the wt-piggyBac transposase plasmid. A single colony was inoculated into a 50 mL starter culture and grown overnight at 37 °C with 180 rpm shaking. The next day, a secondary culture was prepared by inoculating 5 L of LB (Luria-Bertani) medium with a 50 mL starter culture and the mixture incubated at 37 °C with 180 rpm shaking. The secondary culture was induced with 0.5 mM isopropyl β-D-1-thiogalactopyranoside at an OD of 0.8 and incubated at 18 °C for 18 h with 150 rpm shaking. Postincubation, the cells were harvested by centrifugation at 8000g RCF for 30 min at 4 °C, and the cell pellet was resuspended in buffer [25 mM sodium phosphate (pH 7.5), 0.5 M NaCl, 5% glycerol, 2 mM DTT, 0.01% IGEPAL, and 1 mM PMSF]. B

DOI: 10.1021/acs.biochem.7b01191 Biochemistry XXXX, XXX, XXX−XXX

Article

Biochemistry

Figure 1. RFD of the piggyBac transposase is critical for dimerization: (a) The wild type enzyme elutes with a retention volume (Rv) of 12.3 mL, which corresponds to a molecular weight of 121 kDa. (b) The ΔRFD construct elutes with an Rv of 13.4 mL, which corresponds to a molecular weight of 86 kDa. The wild type enzyme and the ΔRFD protein were incubated with 0.001% glutaraldehyde for different periods of time. As the incubation time increases (0 s, 30 s, 1 min, 2 min, 10 min, 15 min, and 30 min), the intensity of the band corresponding to a dimer (D) increases for the wild type enzyme (c), while no similar band is observed for the ΔRFD construct as it remains in the monomer (M) state (d). (e) Dynamic light scattering studies show that the ΔRFD construct shows a significantly reduced Rh value compared to that of the wild type enzyme, and this observation is in line with the inference that RFD is responsible for dimerization.

(5 nM) was titrated against a protein concentration range of 0− 5000 nM. Three independent measurements were recorded for each protein concentration, and average anisotropy values were calculated. Reduced anisotropy values were calculated by subtracting the average anisotropy value for a particular protein concentration from the average anisotropy value for the reaction without protein. The reduced anisotropy values were divided by the maximum value of reduced anisotropy to obtain the fraction bound. This fraction bound was plotted versus protein concentration. The graph was fitted using the Hill equation to calculate the Kd values for wt-piggyBac transposase, Δ7del, 4CysAla, and ΔRFD. We observed that the ΔRFD construct bound the 39mer LE with significant affinity unlike Morellet et al., who did not observe any binding in an electrophoretic-mobility shift assay for a construct equivalent to ΔRFD with 35mer DNA lacking the target TTAA site.22 Excision Assay. A plasmid bearing a version of the piggyBac transposon without the transposase ORF was employed for excision assays; 200 ng of the substrate plasmid was incubated with 100 nM wt-piggyBac transposase, Δ7del, 4CysAla, and ΔRFD separately. The reaction buffer included 10% glycerol, 100 mM NaCl, 25 mM HEPES (pH 7.5), 2 mM DTT, and 10 mM MgCl2. The reactions with appropriate controls were performed at 37 °C for 30 min and terminated by incubation in 1% SDS and 20 mM EDTA for 20 min at 65 °C. The reaction products were precipitated with ethanol and sodium acetate, solubilized in distilled H2O, and resolved on 1.0% native agarose 1× TBE gel to detect the different products

Proteins were diluted from the respective stock solution to a concentration of 1 mg/mL in 25 mM HEPES (pH 7.5), 0.5 M NaCl, 5% glycerol, and 2 mM dithiothreitol. The buffer and protein solutions were centrifuged at 18626g RCF for 45 min immediately before measurements. The data were acquired, processed, and analyzed using Zetasizer software associated with the instrument to calculate hydrodynamic radii (Rh) (using the Stokes−Einstein equation) for all the proteins. PAR Assay for Detecting Zn2+ Ions. PAR [4-(2pyridylazo)resorcinol], which is a metallochormic indicator, was used to detect the Zn2+ ions released from the proteins after formaldehyde treatment.29 Different concentrations of proteins (wt-piggyBac transposase, Δ7del, 4CysAla, and ΔRFD) ranging from 0 to 100 μM were incubated with 1 mM formaldehyde (HCHO) in the presence of 200 μM PAR for 12 h at room temperature. After incubation, the absorbance at 500 nm was measured using an ELISA plate reader, and the absorbance at 500 nm versus protein concentrations was plotted for different constructs. Binding Affinity of wt-piggyBac Transposase, Δ7del, 4CysAla, and ΔRFD. Fluorescence anisotropy was measured using a SpectraMax i3x microplate reader (Molecular Devices). The LE (5′XTTAACCCTAGAAAGATAGTCTGCGTAAAATTGACGCATG3′, where X is a 6FAM label) was annealed with an unlabeled 39mer complementary sequence. The double-stranded 39mer labeled oligonucleotide was mixed with wt-piggyBac transposase, Δ7del, 4CysAla, and ΔRFD separately and incubated at room temperature for 30 min. DNA C

DOI: 10.1021/acs.biochem.7b01191 Biochemistry XXXX, XXX, XXX−XXX

Article

Biochemistry

Figure 2. 588DMCQSCF594 at the C-terminus of piggyBac transposase is critical for dimerization. (a) Computational model of the homodimer formed by the RFD. This model suggests that the last seven residues of the enzyme are critical for dimerization. (b) The Δ7del construct in which the 588DMCQSCF594 stretch is removed elutes as a monomer. (c) The incubation of the Δ7del construct with 0.001% glutaraldehyde did not give rise to a band corresponding to a dimer. (d) Dynamic light scattering studies show that Δ7del shows a significantly reduced Rh value compared to that of the wild type enzyme.

monomer (Figure 1b). Cross-linking experiments show that in the presence of glutaraldehyde, wt-piggyBac transposase forms a dimer and the intensity of the dimer band increases with time (Figure 1c) while ΔRFD is not affected by the presence of glutaraldehyde even with longer incubation times of ≤30 min (Figure 1d). This result shows that RFD is important for protein dimerization. Overall, these experiments show that wtpiggyBac transposase exists as a dimer and that the deletion of the RFD abolishes dimer formation. In line with the gel-filtration analysis and cross-linking experiment, dynamic light scattering (DLS) studies showed that the deletion of RFD leads to significant reduction of the hydrodynamic radius of wt-piggyBac transposase (Figure 1e). The hydrodynamic radii for wt-piggyBac transposase and ΔRFD are 6.1 and 5.1 nm, respectively. Overall, the gelfiltration analysis, cross-linking experiments, and DLS studies show that the RFD is important for dimerization of the wtpiggyBac transposase. The C-Terminal Seven Residues of the RFD Are Critical for Dimer Formation. The computational model of the RFD homodimer suggested that the last seven residues (588DMCQSCF594) of the wt-piggyBac transposase form the interactions that are important for homodimerization (Figure 2a). This stretch also includes the last two cysteines (Cys590 and Cys593) that participate in the coordination of the second Zn2+ ion in the RFD. A construct wherein the 588DMCQSCF594 stretch is deleted was prepared (named Δ7del), and the corresponding protein was purified to high homogeneity. Gelfiltration analysis showed that the protein eluted as a monomer and the retention volume and calculated molecular weight are similar to those of ΔRFD (Figure 2b). In addition, cross-linking studies showed that the protein is incapable of dimerization and exists in the form of a monomer (Figure 2c). The hydrodynamic radius of the protein, as obtained from DLS, is

of the excision reaction. Full excision of the transposon leads to the appearance of two bands wherein the transposon is cut at both ends. The longer fragment (2905 bp) is termed the plasmid backbone (PB), and the shorter fragment (2775 bp) is termed the excised transposon (ET). The transposase also gives rise to a linear product in which the transposon is cut at only one end, and this product is termed Linear. The reaction products were resolved on a 1% agarose gel that was stained with an EtBr solution, and the image was recorded using the ChemiDoc MP System (Bio-Rad). We obtained clear excision activity for all the constructs on plasmid substrates unlike Morellet et al., who did not observe any excision activity on a linear DNA substrate for a construct equivalent to ΔRFD.22 A linear DNA fragment (1425 bp) was employed as a loading control (LC) for the purpose of quantification. The intensity values corresponding to PB, ET, and Linear products were divided by the intensity of the corresponding LC for quantification of the excision activity. The assay was performed in triplicate, and the standard deviation was calculated. The data are shown in the form of a bar diagram. The excision activity was also assessed in the presence of different concentrations of the wild type enzyme, Δ7del, 4CysAla, and ΔRFD. Varying concentrations of this enzyme (0−500 nM) were incubated with 5.7 nM substrate plasmid for 30 min, and the reaction products were processed as described above.

■

RESULTS RFD Is Important for Dimerization of wt-piggyBac Transposase. In gel-filtration analysis, the wt-piggyBac transposase elutes as a dimer (Figure 1a) with an observed molecular weight of 121 kDa, which is close to the actual molecular weight of a dimer (136 kDa). In contrast, ΔRFD elutes as a peak corresponding to a molecular weight of 86 kDa, and this is closer to the molecular weight (64 kDa) of a D

DOI: 10.1021/acs.biochem.7b01191 Biochemistry XXXX, XXX, XXX−XXX

Article

Biochemistry

ΔRFD construct is marginally lower than those of wt-piggyBac transposase and Δ7del. It has recently been shown that the RFD may contribute to DNA binding, and the results obtained here are consistent with this observation.22 Effect of Dimerization on the Excision Activity of piggyBac Transposase. The transposition process can be divided into two stages, excision and integration. The excision step involves recognition of the terminal repeats (TRs) by the transposase followed by cleavage of the phosphodiester bonds flanking the transposon to release the transposon. The plasmid substrate utilized is such that complete excision of the transposon by wt-piggyBac transposase results in the appearance of the plasmid backbone (PB) and excised transposon (ET) fragments. In addition, partial excision leads to the appearance of a linearized plasmid (5680 bp) simply termed Linear. An excision assay conducted on wt-piggyBac transposase, Δ7del, and ΔRFD showed that these proteins are active (Figure 6). Surprisingly, the activity of Δ7del and ΔRFD was higher than that of wt-piggyBac transposase as the former produced nearly 2.5 times more PB and ET than the latter did. In addition, it was seen that wt-piggyBac transposase produced more Linear product than ΔRFD or Δ7del did. These observations show that dimerization through the C-terminus of RFD resulted in a decrease in the excision activity of the wtpiggyBac transposase. The effect of increasing concentrations of different constructs of the piggyBac transposase on the excision activity was assessed (Figure 7). The results show that the monomeric constructs (Δ7del and ΔRFD) produce more of PB and ET than the dimeric constructs do (wt-piggyBac transposase and 4CysAla). With an increasing concentration, the dimeric constructs also showed greater production of the linear product. The differences in the levels of excision activities of monomeric and dimeric constructs appear early in the assessed concentration range (∼20 nM). Overall, these experiments show that monomerization of the piggyBac transposase enhances the ability of the enzyme to excise the transposon (Figure 8).

significantly smaller than that of wt-piggyBac transposase and similar to that of ΔRFD (Figure 2d). These observations show that last seven residues of the RFD are critical for dimerization of the wt-piggyBac transposase. Role of Zn2+ Ions in Dimerization of the piggyBac Transposase. RFD binds two Zn2+ ions through the C2C2CHC2 motif in a cross-brace arrangement.22 The PAR assay shows the presence of Zn2+ ions in the wt-piggyBac transposase construct. The ΔRFD construct did not show the presence of Zn2+ ions. The Δ7del construct shows the partial presence of Zn2+ ions as compared to the wt-piggyBac transposase. This is in line with the fact that only one Zn2+ coordination site is intact as this construct is missing the last two cysteines of the C2C2CHC2 motif (Figure 3). These results

Figure 3. Ability of different constructs of the piggyBac transposase to bind Zn2+ ions. The PAR assay shows that the ΔRFD construct is devoid of the ability to bind Zn2+ as compared to the wild type enzyme. In addition, the Δ7del construct exhibits only partial ability to bind Zn2+.

show that, even though Zn2+ was not added to purification buffers, the C2C2CHC2 motif can bind endogenous Zn2+ from the expression host and the structural integrity of this motif is maintained in the wt-piggyBac transposase. In line with this inference, circular dichroism spectra of wt-piggyBac transposase are nearly identical in the presence or absence of Zn2+ (Supplementary Figure 1) To disrupt the ability of the protein to bind Zn2+, we made a construct named 4CysAla in which C1C2 (Cys559 and Cys562, respectively) from the first pair and C3C4 (Cys574 and Cys576, respectively) from second pair were mutated to alanine. A Zn2+ release assay showed that this construct cannot bind to Zn2+ ions (Figure 4a). Gel-filtration analysis (Figure 4b), crosslinking studies (Figure 4c), and DLS (Figure 4d) showed that this construct (4CysAla) exists in the form of a dimer. The results show that disruption of the ability of the enzyme to bind Zn2+ did not affect the ability of the enzyme to form a dimer. wt-piggyBac Transposase, Δ7del, 4CysAla, and ΔRFD Bind Left End (LE) DNA with High Affinity. The binding affinity of Δ7del, 4CysAla, and ΔRFD for duplex DNA corresponding to the LE was compared with that of wtpiggyBac transposase (Figure 5). The change in fluorescence anisotropy on binding of wt-piggyBac transposase, Δ7del, 4CysAla, and ΔRFD to fluorescently labeled (5′ 6FAM) LE was measured. The calculated Kd values for wt:LE, Δ7del:LE, 4CysAla:LE, and ΔRFD:LE are 240, 194, 250, and 280 nM, respectively. These experiments show that wt-piggyBac transposase, Δ7del, and 4CysAla can bind to its cognate DNA substrate with high affinities, while the binding affinity of the

■

DISCUSSION Transposases have to bind to each TR (terminal repeat) at the two ends of the transposon and excise the transposon for translocation. Dimerization or oligomerization through protein−protein interactions between transposase molecules is critical to hold the two cleaved ends of the transposon into a compact transpososome. This paired end complex (PEC) can assume a compact shape, and the two active sites can perform multiple hydrolysis and transesterification reactions to facilitate transposition. Consequently, all known transposases appear to dimerize or oligomerize to achieve function.4 It has been shown that formation of PEC follows different assembly pathways depending on the oligomeric state of the transposase enzyme. The prokaryotic Tn5 transposase exists as a monomer in solution, and eukaryotic mariner transposase Mos1 forms a dimer in solution. Both these enzymes form a dimer in the PEC and dimerize through different pathways.30−32 The MuA transposase is a monomer, but upon binding to DNA, it becomes a tetramer.33,34 Hermes (hAT superfamily member) is an octamer even in the absence of DNA.35 Different domains are required for dimerization in different transposase enzymes. Tn5 dimerizes through the C-terminal αE

DOI: 10.1021/acs.biochem.7b01191 Biochemistry XXXX, XXX, XXX−XXX

Article

Biochemistry

Figure 4. Disruption of the ability of the RFD to bind Zn2+ does not affect dimerization of the piggyBac transposase: (a) A PAR assay shows that the 4CysAla construct cannot bind Zn2+ ions. (b) This construct elutes with an Rv of 12.4 mL, which corresponds to a molecular weight of 121 kDa. (c) The Δ7del protein was incubated with 0.001% glutaraldehyde for 30 min, and a band corresponding to a dimer was observed for the 4CysAla construct. (d) Dynamic light scattering studies show that the 4CysAla construct shows the same Rh value as the wild type enzyme.

two N terminal HTH DNA binding domains and some part of the catalytic domain.37 The monomeric MuA transposase tetramerizes in the presence of DNA through its central/ catalytic and C-terminal domains.33 In Hermes, the N-terminal DNA binding domain helps in making a tightly intertwined dimer.38 In summary, in all the transposases studied previously, oligomerization is important for excision activity and transposition.4 Our studies show that wt-piggyBac transposase exists as a dimer in solution and that the C-terminal seven residues that are part of the RFD are critical for homodimerization. Structural studies conducted on the RFD from piggyBac transposase suggest that this domain exists as a monomer.22 It is therefore, possible that either the C-terminal seven residues may act as the point of primary engagement followed by a stronger interaction involving the rest of the protein or the two RFD domains in the homodimer do not interact with each other but with the other domains of the piggyBac transposase. The removal of the last seven residues results in a monomeric protein that exhibits enhanced excision activity compared to that of the wt-piggyBac transposase protein (Figure 8). Our observations reveal that dimerization serves to attenuate the excision activity of wt-piggyBac transposase. In the homodimer formed by the wild type enzyme, the interaction between the two monomers may lead to occlusion of the catalytic site and thus reduce excision activity. Because the RFD is conserved among transposases of the piggyBac family, autoregulation of excision activity through dimerization may be a common feature of these enzymes.9 In the case of many other transposases such as Tn5 and Mos1, catalysis/first nick begins only after synaptic complex

Figure 5. Wild type enzyme, ΔRFD, Δ7del, and 4CysAla constructs bind the left end of the transposon with similar affinities. Fluorescence anisotropy experiments show that there is an only slight difference in the ability of the wild type enzyme, ΔRFD, Δ7del, and 4CysAla to bind to DNA corresponding to the left end of the piggyBac transposon.

helix to achieve synaptic complex formation.36 In Mos1, dimerization occurs through interactions between one of the F

DOI: 10.1021/acs.biochem.7b01191 Biochemistry XXXX, XXX, XXX−XXX

Article

Biochemistry

Figure 6. Monomeric constructs of the piggyBac transposase exhibit excision activity higher than that of dimeric constructs. The amount of fully excised transposon generated is ∼2.5 times higher for ΔRFD and Δ7del constructs than for wild type and 4CysAla constructs. The dimeric constructs give rise to levels of the linear product higher than those of the monomeric constructs.

Figure 7. Effect of increasing concentrations of the enzyme on excision activity. The amount of product formed increased with an increasing concentration of the enzyme, and the level stabilized around 300 nM enzyme. The ΔRFD and Δ7del constructs gave higher levels of the PB and ET products, and the wild type and 4CysAla constructs gave higher levels of the linear product. The monomeric constructs, therefore, exhibited a higher level of excision activity even at low concentrations of the enzyme (∼20 nM).

is possible that the dimeric wt-piggyBac transposase binds to the RE first through one monomer and then the other monomer has to seek and bind the LE to form the PEC that will lead to the complete excision of the transposon. If this monomer fails to engage with the LE, then the enzyme is

formation. The observation that the dimeric constructs produce more linear product than the monomeric constructs do show that the dimerization inhibits the complete excision of the transposon. Also, wt-piggyBac transposase has been shown to preferentially nick the right end (RE) over the left end (LE).9 It G

DOI: 10.1021/acs.biochem.7b01191 Biochemistry XXXX, XXX, XXX−XXX

Article

Biochemistry

Figure 8. Dimerization attenuates the excision activity of the piggyBac transposase. According to the studies presented here, dimerization through the last seven residues of the RFD results in a dimeric protein that exhibits a weakened ability to excise the transposon. Deletion of the RFD or the terminal seven residues results in an enhancement of the ability to excise the transposon.

cellular physiology.2,42 It is believed that the piggyBac transposon has been retained in the genome of Trichoplusia as it can translocate and integrate into the genome of infecting viruses and thus reduce their virulence.7 However, adventitious and uncontrolled activity of wt-piggyBac transposase can lead to death of the host cell, which is not beneficial to the survival of selfish elements such as transposons in the host genome.43 The decrease in the activity of transposases may be one of the strategies utilized to lower the frequency of transposition. In the case of wt-piggyBac transposase, dimerization through the Cterminal seven residues of the RFD serves to autoregulate the excision activity and thus prevents adventitious and frequent transposition that may be catastrophic for the host cell. Also, it is known that a number of proteins with RING-finger domains serve as E3 ubiquitin ligases, and further studies are required to ascertain if the RFD of piggyBac transposase aids selfubiquitination of the enzyme to regulate its activity.44−47

released after creation of a break at one end. The singlestranded breaks generated by the partial activity of the wtpiggyBac transposase may be repaired, and transposition will not occur. In the case of ΔRFD and Δ7del, the monomers would be free to bind the LE and RE separately and make cuts at each end to achieve complete excision. Claeys et al. suggest that binding of transposase dimers at both the LE and the RE may inhibit formation of the PEC, and this mode of inhibition was termed the dimerization end occlusion (DEO) model.39 Dimerization through the RFD, therefore, presents a barrier for complete excision of the transposon. This attribute may serve as a checkpoint to autoregulate the excision activity of the wt-piggyBac transposase and reduce its effective concentration. The STATOC (saturated transposition activity by transposase overconcentration) concept posits that the transposition activity remains unchanged above a particular transposase concentration.40 On the basis of the excision assays, both the monomeric constructs and the wild type enzyme may subscribe to STATOC. However, dimerization serves to substantially reduce the level at which transposase activity plateaus. The piggyBac transposase has been shown to exhibit the phenomenon of overproduction inhibition (OPI) in vivo, wherein higher concentrations of transposase lead to sequestered or aggregated protein and result in a reduced transposition frequency.41 These observations and our studies suggest that the activity of the piggyBac transposase may be controlled at two levels. Initially, dimerization will take place to regulate activity, and if the concentration increases, OPI will occur to reduce the active fraction of the protein present in the cell. These strategies for controlling transposition frequency will be particularly important if the transposon integrates in the proximity of a strong promoter that results in enhanced expression of the transposase. Overall, homodimerization and OPI may offer two different levels of control, which are independent of strategies employed to control activity through modulation of expression levels or utilization of post-translational modifications. Integration of transposons at target sites can distort the integrity of genomic information and have profound effects on

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.biochem.7b01191. Supplementary Figure 1 (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Telephone: +91-128-2848844. ORCID

Deepak T. Nair: 0000-0002-0677-9444 Funding

R.S. and S.N. were recipients of Senior Research Fellowships (SRFs) from UGC (Government of India) and the Council of Scientific and Industrial Research, respectively. N.N. was the recipient of an SRF from the Indian Council of Medical Research. This work was performed with funds provided by the Department of Biotechnology (Government of India) to the Regional Centre for Biotechnology (Faridabad, India). H

DOI: 10.1021/acs.biochem.7b01191 Biochemistry XXXX, XXX, XXX−XXX

Article

Biochemistry Notes

(17) Matthews, J. M., and Sunde, M. (2002) Zinc fingers–folds for many occasions. IUBMB Life 54, 351−355. (18) Borden, K. L. (1998) RING fingers and B-boxes: zinc-binding protein-protein interaction domains. Biochem. Cell Biol. 76, 351−358. (19) Aravind, L., Iyer, L. M., and Koonin, E. V. (2003) Scores of RINGS but no PHDs in ubiquitin signaling. Cell Cycle 2, 123−126. (20) Song, X. J., Huang, W., Shi, M., Zhu, M. Z., and Lin, H. X. (2007) A QTL for rice grain width and weight encodes a previously unknown RING-type E3 ubiquitin ligase. Nat. Genet. 39, 623−630. (21) Keith, J. H., Fraser, T. S., and Fraser, M. J., Jr. (2008) Analysis of the piggyBac transposase reveals a functional nuclear targeting signal in the 94 c-terminal residues. BMC Mol. Biol. 9, 72. (22) Morellet, N., Li, X., Wieninger, S. A., Taylor, J. L., Bischerour, J., Moriau, S., Lescop, E., Bardiaux, B., Mathy, N., Assrir, N., Betermier, M., Nilges, M., Hickman, A. B., Dyda, F., Craig, N. L., and Guittet, E. (2018) Sequence-specific DNA binding activity of the cross-brace zinc finger motif of the piggyBac transposase. Nucleic Acids Res. 46 (5), 2660−2677. (23) de Vries, S. J., van Dijk, M., and Bonvin, A. M. (2010) The HADDOCK web server for data-driven biomolecular docking. Nat. Protoc. 5, 883−897. (24) Dominguez, C., Boelens, R., and Bonvin, A. M. (2003) HADDOCK: a protein-protein docking approach based on biochemical or biophysical information. J. Am. Chem. Soc. 125, 1731− 1737. (25) van Zundert, G. C., and Bonvin, A. M. (2014) Modeling protein-protein complexes using the HADDOCK webserver ″modeling protein complexes with HADDOCK″. Methods Mol. Biol. 1137, 163−179. (26) van Zundert, G. C. P., Rodrigues, J., Trellet, M., Schmitz, C., Kastritis, P. L., Karaca, E., Melquiond, A. S. J., van Dijk, M., de Vries, S. J., and Bonvin, A. (2016) The HADDOCK2.2 Web Server: UserFriendly Integrative Modeling of Biomolecular Complexes. J. Mol. Biol. 428, 720−725. (27) Winn, M. D., Ballard, C. C., Cowtan, K. D., Dodson, E. J., Emsley, P., Evans, P. R., Keegan, R. M., Krissinel, E. B., Leslie, A. G., McCoy, A., McNicholas, S. J., Murshudov, G. N., Pannu, N. S., Potterton, E. A., Powell, H. R., Read, R. J., Vagin, A., and Wilson, K. S. (2011) Overview of the CCP4 suite and current developments. Acta Crystallogr., Sect. D: Biol. Crystallogr. 67, 235−242. (28) Merril, C. R., Goldman, D., and Van Keuren, M. L. (1984) Gel protein stains: silver stain. Methods Enzymol. 104, 441−447. (29) Hao, Q., and Maret, W. (2006) Aldehydes release zinc from proteins. A pathway from oxidative stress/lipid peroxidation to cellular functions of zinc. FEBS J. 273, 4300−4310. (30) Davies, D. R., Goryshin, I. Y., Reznikoff, W. S., and Rayment, I. (2000) Three-dimensional structure of the Tn5 synaptic complex transposition intermediate. Science 289, 77−85. (31) Auge-Gouillou, C., Brillet, B., Germon, S., Hamelin, M. H., and Bigot, Y. (2005) Mariner Mos1 transposase dimerizes prior to ITR binding. J. Mol. Biol. 351, 117−130. (32) York, D., and Reznikoff, W. S. (1996) Purification and biochemical analyses of a monomeric form of Tn5 transposase. Nucleic Acids Res. 24, 3790−3796. (33) Montano, S. P., Pigli, Y. Z., and Rice, P. A. (2012) The mu transpososome structure sheds light on DDE recombinase evolution. Nature 491, 413−417. (34) Mizuuchi, K. (1992) Transpositional recombination: mechanistic insights from studies of mu and other elements. Annu. Rev. Biochem. 61, 1011−1051. (35) Hickman, A. B., Ewis, H. E., Li, X., Knapp, J. A., Laver, T., Doss, A. L., Tolun, G., Steven, A. C., Grishaev, A., Bax, A., Atkinson, P. W., Craig, N. L., and Dyda, F. (2014) Structural basis of hAT transposon end recognition by Hermes, an octameric DNA transposase from Musca domestica. Cell 158, 353−367. (36) Steiniger-White, M., and Reznikoff, W. S. (2000) The Cterminal alpha helix of Tn5 transposase is required for synaptic complex formation. J. Biol. Chem. 275, 23127−23133.

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors thank the Central Instrumentation Facility at the Regional Centre for Biotechnology.

■

ABBREVIATIONS TR, terminal repeat; LE, left end; RE, right end; RFD, RINGfinger domain; CTR, C-terminal region; DLS, dynamic light scattering; PEC, paired end complex; PB, plasmid backbone; ET, excised transposon.

■

REFERENCES

(1) Kidwell, M. G. (1992) Horizontal transfer of P elements and other short inverted repeat transposons. Genetica 86, 275−286. (2) Craig, N. L., Chandler, M., Gellert, M., Lambowitz, A. M., Rice, P. A., and Sandmeyer, S. B. (2015) Mobile DNA, 3rd ed., American Society for Microbiology Press, Washington, DC. (3) Kapitonov, V. V., and Jurka, J. (2008) A universal classification of eukaryotic transposable elements implemented in Repbase. Nat. Rev. Genet. 9, 411−412. (4) Montano, S. P., and Rice, P. A. (2011) Moving DNA around: DNA transposition and retroviral integration. Curr. Opin. Struct. Biol. 21, 370−378. (5) Singh, A. M., Adjan Steffey, V. V., Yeshi, T., and Allison, D. W. (2015) Gene Editing in Human Pluripotent Stem Cells: Choosing the Correct Path. Journal of Stem Cell and Regenerative Biology 1 (1), 1. (6) Woodard, L. E., and Wilson, M. H. (2015) piggyBac-ing models and new therapeutic strategies. Trends Biotechnol. 33, 525−533. (7) Cary, L. C., Goebel, M., Corsaro, B. G., Wang, H. G., Rosen, E., and Fraser, M. J. (1989) Transposon mutagenesis of baculoviruses: analysis of Trichoplusia ni transposon IFP2 insertions within the FPlocus of nuclear polyhedrosis viruses. Virology 172, 156−169. (8) Fraser, M. J., Smith, G. E., and Summers, M. D. (1983) Acquisition of Host Cell DNA Sequences by Baculoviruses: Relationship Between Host DNA Insertions and FP Mutants of Autographa californica and Galleria mellonella Nuclear Polyhedrosis Viruses. J. Virol. 47, 287−300. (9) Mitra, R., Fain-Thornton, J., and Craig, N. L. (2008) piggyBac can bypass DNA synthesis during cut and paste transposition. EMBO J. 27, 1097−1109. (10) Sarkar, A., Sim, C., Hong, Y. S., Hogan, J. R., Fraser, M. J., Robertson, H. M., and Collins, F. H. (2003) Molecular evolutionary analysis of the widespread piggyBac transposon family and related ″domesticated″ sequences. Mol. Genet. Genomics 270, 173−180. (11) Keith, J. H., Schaeper, C. A., Fraser, T. S., and Fraser, M. J., Jr. (2008) Mutational analysis of highly conserved aspartate residues essential to the catalytic core of the piggyBac transposase. BMC Mol. Biol. 9, 73. (12) Bouallegue, M., Rouault, J. D., Hua-Van, A., Makni, M., and Capy, P. (2017) Molecular Evolution of piggyBac Superfamily: From Selfishness to Domestication. Genome Biol. Evol. 9, 323−339. (13) Wang, J., Du, Y., Wang, S., Brown, S. J., and Park, Y. (2008) Large diversity of the piggyBac-like elements in the genome of Tribolium castaneum. Insect Biochem. Mol. Biol. 38, 490−498. (14) Daimon, T., Mitsuhiro, M., Katsuma, S., Abe, H., Mita, K., and Shimada, T. (2010) Recent transposition of yabusame, a novel piggyBac-like transposable element in the genome of the silkworm, Bombyx mori. Genome 53, 585−593. (15) Freemont, P. S. (1993) The RING finger. A novel protein sequence motif related to the zinc finger. Ann. N. Y. Acad. Sci. 684, 174−192. (16) Gamsjaeger, R., Liew, C. K., Loughlin, F. E., Crossley, M., and Mackay, J. P. (2007) Sticky fingers: zinc-fingers as protein-recognition motifs. Trends Biochem. Sci. 32, 63−70. I

DOI: 10.1021/acs.biochem.7b01191 Biochemistry XXXX, XXX, XXX−XXX

Article

Biochemistry (37) Richardson, J. M., Colloms, S. D., Finnegan, D. J., and Walkinshaw, M. D. (2009) Molecular architecture of the Mos1 pairedend complex: the structural basis of DNA transposition in a eukaryote. Cell 138, 1096−1108. (38) Hickman, A. B., Perez, Z. N., Zhou, L., Musingarimi, P., Ghirlando, R., Hinshaw, J. E., Craig, N. L., and Dyda, F. (2005) Molecular architecture of a eukaryotic DNA transposase. Nat. Struct. Mol. Biol. 12, 715−721. (39) Claeys Bouuaert, C., Lipkow, K., Andrews, S. S., Liu, D., and Chalmers, R. (2013) The autoregulation of a eukaryotic DNA transposon. eLife 2, e00668. (40) Bire, S., Casteret, S., Arnaoty, A., Piegu, B., Lecomte, T., and Bigot, Y. (2013) Transposase concentration controls transposition activity: myth or reality? Gene 530, 165−171. (41) Woodard, L. E., Downes, L. M., Lee, Y. C., Kaja, A., Terefe, E. S., and Wilson, M. H. (2017) Temporal self-regulation of transposition through host-independent transposase rodlet formation. Nucleic Acids Res. 45, 353−366. (42) Chenais, B. (2015) Transposable elements in cancer and other human diseases. Curr. Cancer Drug Targets 15, 227−242. (43) Doolittle, W. F., Kirkwood, T. B., and Dempster, M. A. (1984) Selfish DNAs with self-restraint. Nature 307, 501−502. (44) de Bie, P., and Ciechanover, A. (2011) Ubiquitination of E3 ligases: self-regulation of the ubiquitin system via proteolytic and nonproteolytic mechanisms. Cell Death Differ. 18, 1393−1402. (45) Hu, G., and Fearon, E. R. (1999) Siah-1 N-terminal RING domain is required for proteolysis function, and C-terminal sequences regulate oligomerization and binding to target proteins. Mol. Cell. Biol. 19, 724−732. (46) Yin, Q., Lin, S. C., Lamothe, B., Lu, M., Lo, Y. C., Hura, G., Zheng, L., Rich, R. L., Campos, A. D., Myszka, D. G., Lenardo, M. J., Darnay, B. G., and Wu, H. (2009) E2 interaction and dimerization in the crystal structure of TRAF6. Nat. Struct. Mol. Biol. 16, 658−666. (47) Joazeiro, C. A., and Weissman, A. M. (2000) RING finger proteins: mediators of ubiquitin ligase activity. Cell 102, 549−552.

J

DOI: 10.1021/acs.biochem.7b01191 Biochemistry XXXX, XXX, XXX−XXX