dimethylchalcone Protects the Impaired Insulin Secretion Induced by

Jan 20, 2014 - Department of Anus & Intestine Surgery, Tianjin Union Medical Centre, 190 Jieyuan Road, Tianjin 300121, P. R. China. ABSTRACT: 2′ ...
0 downloads 0 Views 1MB Size
Download PDF
Article pubs.acs.org/JAFC

2′,4′-Dihydroxy-6′-methoxy-3′,5′-dimethylchalcone Protects the Impaired Insulin Secretion Induced by Glucotoxicity in Pancreatic β‑Cells Ying-Chun Hu,†,‡ Dong-Ming Hao,§ Lu-Xian Zhou,‡ Zhe Zhang,‡ Nan Huang,‡ Michael Hoptroff,‡ and Yan-Hua Lu*,† †

State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, 130 Meilong Road, Shanghai 200237, P. R. China ‡ Unilever R&D Shanghai, 5/F, 66 Linxin Road, Shanghai 200335, P. R. China § Department of Anus & Intestine Surgery, Tianjin Union Medical Centre, 190 Jieyuan Road, Tianjin 300121, P. R. China ABSTRACT: 2′,4′-Dihydroxy-6′-methoxy-3′,5′-dimethylchalcone (DMC), which is isolated and purified from the dried flower buds of Cleistocalyx operculatus (Roxb.) Merr. et Perry (Myrtaceae), was investigated for its insulinotropic benefits against glucotoxicity using in vitro methods. When exposed to high glucose at the cytotoxicity level for 48 h, RIN-5F β-cells experienced a significant viability loss and impaired insulin secretion function, whereas cotreating with DMC could protect β-cells against glucotoxicity-induced decrease in glucose-stimulated insulin secretion in a dose-dependent manner without affecting basal insulin secretion. It was demonstrated that DMC increased insulin secretion against glucotoxicity by simulating the effect of GLP-1 and enhancing the expression of GLP-1R, followed by activating the signal pathway of PDX-1, PRE-INS, and GLUT2-GCK. Another mechanism was that DMC avoided the pancreatic islet dysfunction resulting from cellular damage by suppressing the production of nitric oxide (NO) by iNOS, and the expression of MCP-1. The results indicated the potential application of DMC in the intervention against glucotoxicity-induced hyperglycemia. KEYWORDS: 2′,4′-dihydroxy-6′-methoxy-3′,5′-dimethylchalcone, glucotoxicity, insulin secretion, PDX-1, oxidative stress

■

mic,19,20 and preservation of pancreatic islets.14 Flavonoids (flavanone and chalcone), triterpene acids, sterols, and essential oils are major constituents in Cleistocalyx operculatus flower buds.13,15 2′,4′-Dihydroxy-6′-methoxy-3′,5′-dimethylchalcone (DMC) (Figure 1A), one of the flavonoids isolated from the dried flower buds of Cleistocalyx operculatus,15 has been shown to have the effects of antitumor,21−27 antidrug efflux,28−30 antiinflammation,31,32 antioxidant,16,33−35 anti-acute liver injury,36 antidiarrhea,37,38 antimicrobe,39,40 antivirus,41 and as a prolyl endopeptidase inhibitor.42 In addition to the effects listed above, DMC, at 1 mg/20 g body weight by oral administration, has been shown to lower blood glucose level in alloxan-induced diabetic mice, which the authors attributed to its structure of C-5′-CH3 and the olefinic moiety next to the −CO group.43 DMC has been shown to enhance glucose uptake in differentiated adipocyte of 3T3-L1 cells by stimulating the expression of peroxisome proliferatoractivated receptor-γ (PPAR-γ).44 In a previous study, we demonstrated that DMC protected against H2O2-induced toxicity in PC12 cells.45,46 Recently, we showed that DMC had the benefits of glycemic control via inhibition of pancreatic α-amylase (IC50 of 43 μM), and suppression of glucose transport in intestine.47

INTRODUCTION Hyperglycemia and ineffective usage or secretion of insulin, insulin resistance, and a progressive loss of β-cell function are major characteristics of diabetes. The detrimental effect of excessive glucose concentrations over a prolonged period is referred to as “glucotoxicity”.1 Glucotoxicity-induced oxidative stress is recognized as one of many classic risk factors,2 which damages the function of pancreatic islets and reduces insulin secretion by overproduction of reactive oxygen species (ROS) and nitric oxide (NO).3 Pancreatic β-cells are central to the development of type 2 diabetes,4 as pancreatic islets are the most vulnerable cells producing less antioxidant enzymes compared with cells in other organs.5 Protecting the function of pancreatic β-cells6 and expanding its mass become the most feasible therapeutic strategies to control hyperglycemia in both physiological and pathological states of nutrient excess.7 Recent studies on supplementation with certain natural products have demonstrated the effects on alleviation of hyperglycemic status by protecting the function of pancreatic β-cells.8−12 Cleistocalyx operculatus (Roxb.) Merr. et Perry (Myrtaceae) is a well-known medicinal plant, which is widely distributed in Vietnam, China, and some other tropical countries.13 Its leaves and flower buds have been used as herbal tea materials to treat gastrointestinal and respiratory disturbances, and as an antiinflammatory medicine in Vietnam.14 Also, its dried flower buds have been commonly consumed in tonic drinks in southern China for thousands of years.15 Extracts from Cleistocalyx operculatus flower buds exhibited the activities of antihyperlipidemic,16 anti-Alzheimer,17 cardiotonic, 18 antihyperglyce© 2014 American Chemical Society

Received: Revised: Accepted: Published: 1602

November 28, 2013 January 19, 2014 January 19, 2014 January 20, 2014 dx.doi.org/10.1021/jf405365d | J. Agric. Food Chem. 2014, 62, 1602−1608

Journal of Agricultural and Food Chemistry

Article

analytical reagent grade acquired from Sigma Aldrich (St. Louis, MO, USA). Cell Culture. RIN-5F cells derived from rat pancreatic β-cells were purchased from American Type Culture Collection (ATCC, Manassas, VA). RIN-5F cells were maintained in RPMI-1640 containing 11 mM glucose, supplemented with 10% fetal bovine serum (FBS), and 1% penicillin/streptomycin under a condition of saturated humidity atmosphere containing 5% CO2 at 37 °C. The medium was renewed every 3 days. Measurements of Insulin Secretion and Cell Viability. RIN5F cells (from 8 to 13 passages) were seeded in 24-well plates at a density of 2 × 105 cells/well. After 2 days, the cells were preincubated in RPMI-1640 medium at either a maintenance glucose condition (11 mM) or a high glucose condition (33 mM) for 48 h, and then the cells were used for insulin stimulation experiment. In detail, RIN-5F cells were washed twice with Krebs−Ringer bicarbonate buffer (KRB buffer, pH 7.4) containing 25 mM HEPES, 115 mM NaCl, 24 mM NaHCO3, 5 mM KCl, 2.5 mM CaCl2, and 1 mM MgCl2 supplemented with 0.1% bovine serum albumin (BSA). Subsequently, the medium was replaced by 0.5 mL of KRB containing 5 mM glucose (simulated fasting state with basal insulin secretion) or 25 mM glucose (simulated fed state with glucose-stimulated insulin secretion) with or without DMC (2 μM and 20 μM), and the cells were incubated for 2 h at 37 °C as indicated respectively (Figure 1B). The supernatant was collected for measurement of secreted insulin using a high range rat insulin ELISA kit (Mercodia Inc., Uppsala, Sweden), and the attached cells were used for viability test by CCK-8 according to the manufacturer’s instructions. RNA Isolation and Quantitative RT-PCR. Total RNA from each well was extracted from RIN-5F cells using the RNeasy mini kit (Qiagen NV, Venlo, The Netherlands), and complementary DNAs (cDNAs) were synthesized using PrimeScript first strand DNA synthesis kit (TaKaRa Biotech, Japan) according to the manufacturer’s instructions. Quantitative reverse transcription PCR (qRT-PCR) was done using SYBR Premix ExTaq kit (Takara Biotech, Dalian, China) and the ABI Prism 7500 sequence detection system (Applied Biosystems, Foster City, CA, USA) to determine the gene expression level. Each PCR was performed in a 20 μL solution containing 0.8 μL (10 μM) of each pair of forward and reverse primers, 10 μL of Premix Ex Taq DNA polymerase, 0.4 μL of ROX reference dye, 6 μL of dH2O, and 2 μL of reverse transcription reaction products. The qRTPCR primers used in the experiment are shown in Table 1. All experiments were done in triplicate. Relative expression was determined by the 2−ΔCt method using GAPDH as the internal control, and fold change was calculated in comparison with the corresponding control group. Determination of PDX-1 Protein Expression by Western Blotting. Pancreatic duodenum homeobox-1 (PDX-1) protein expression in RIN-5F cells was examined using Western blotting. Cells were seeded in 12-well plates at a density of 4 × 105 cells/well. Following the treatment with 11 and 33 mM glucose, with or without DMC (at 2 μM and 20 μM) for 48 h, cells were washed with ice-cold PBS before lysis in 200 μL of CelLytic-M cell lysis reagents (Sigma Aldrich). Then, samples were centrifuged at 14000 g for 15 min at 4

Figure 1. (A) Chemical structure of DMC. (B) Experiment design of insulin stimulation assay.

Although the hypoglycemic effects of Cleistocalyx operculatus flower bud aqueous extracts and DMC have been demonstrated in in vitro and animal models in the literature, and the mechanism of insulin enhancement has been illustrated in H2O2-damaged pancreatic cells, the effects and underlying mechanism of DMC against more physiologically relevant glucotoxicity conditions remains unclear. In this study, the effects of DMC on glucotoxicity induced insulin secretion impairment of RIN-5F cells and its corresponding mechanism were investigated.

■

MATERIALS AND METHODS

Reagents. DMC was isolated from the dried flower buds of Cleistocalyx operculatus as previous described.16 Cell counting kit 8 (CCK-8) was purchased from Dojindo Molecular Technologies, Inc. (Tabaru, Japan), and dimethyl sulfoxide (DMSO) from Merck (Gibbstown, NJ, USA). All the primers were synthesized by Life Technologies (Carlsbad, CA, USA). Cell culture reagents were acquired from Life Technologies as well. All other chemicals were

Table 1. Primer Sequences of the Selected Genes Involved in Key Pathways of Insulin Secretion in Rat Pancreatic β-Cells RIN5F primer gene

full name

forward

reverse

GAPDH PRE-INS GLP-1R GLUT2 PDX-1 GCK iNOS MCP-1

glyceraldehyde-3-phosphate dehydrogenase preinsulin glucagon-like peptide-1 receptor glucose transporter type 2 pancreatic duodenum homeobox-1 glucokinase inducible nitric oxide synthase monocyte chemoattractant protein-1

GGCAAGTTCAATGGCACAGT TCTTCTACACACCCATGTCCC GGGTCTCTGGCTACATAAGGACAAC TTAGCAACTGGGTCTGCAAT AAACGCCACACACCAAGGAGAA GCTTTTGAGACCCGTTTCGT CACCTTGGAGTTCACCCAGT GCAATCAATGCCCCAGTCA

TGGTGAAGACGCCAGTAGACTC GGTGCAGCACTGATCCAC AAGGATGGCTGAAGCGATGAC GGTGTAGTCCTACACTCATG AGACCTGGCGGTTCACATG CGCACAATGTCGCAGTCG ACCACTCGTACTTGGGATGC GCCTCTGCACTGAGATCTTCCT

1603

dx.doi.org/10.1021/jf405365d | J. Agric. Food Chem. 2014, 62, 1602−1608

Journal of Agricultural and Food Chemistry

Article

°C, the supernatant was collected, and the total protein was determined using a BCA assay (Pierce, Rockford, IL, USA). For Western blotting, equal amounts of total cellular protein (8 μg) were resolved by SDS−PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes (Bio-Rad, Hercules, CA, USA) with a Bio-Rad Transblot apparatus, and probed with a primary antibody against PDX-1 overnight at 4 °C, followed by incubation with a horseradish peroxidase (HRP)-conjugated secondary antibody (all antibodies were from Cell Signaling Technologies, Beverly, MA, USA) for 1 h. The immune complexes of bound antibody were visualized with an enhanced chemiluminescence (ECL) system according to the manufacturer’s instructions (GE Healthcare, Piscataway, NJ, USA). Equal loading was confirmed by analysis of the internal control of GAPDH, and bands were quantified using densitometry by the Image J Software (NIH, Bethesda, MD, USA). Measurement of NO Release by Griess Assay. The quantity of NO produced during the experiment was estimated spectrophotometrically as formed nitrite (NO2−). After the 48 h treatment with 11 and 33 mM glucose, with or without DMC (at 2 μM and 20 μM), culture medium was collected for NO measurement. In brief, 50 μL of the culture medium and 50 μL of the sulfanilamide solution reagent (1% sulfanilamide in 5% phosphoric acid) were sequentially added to a 96-well microplate (Corning, Corning, NY, USA) in triplicate. After 10 min of incubation at room temperature, 50 μL of the NED solution (0.1% N-1-naphthylethylenediamine dihydrochloride in water) was added to all wells for another 10 min of incubation. Then, the optical density (OD) of the reaction mixture was determined by a Safire 2 microplate reader (Tecan, Mannedorf, Switzerland) at 540 nm. The nitrite content was calculated based on a standard curve constructed with sodium nitrite (Promega, Madison, WI, USA). Statistics. Results were expressed as mean ± SEM. The data were analyzed by one-way analysis of variance (ANOVA) followed by Tukey’s or Dunnett’s post hoc comparisons to determine the significant differences between groups. Differences with P < 0.05 were considered statistically significant.

■

Figure 2. The effect of DMC on basal (5 mM glucose) and glucosestimulated (25 mM glucose) (A) insulin secretion and (B) cell viability under maintenance glucose (11 mM) and glucotoxicity (33 mM) status. Values are presented as mean ± SEM (n = 6), duplicate by means of three independent experiments. The data values were analyzed by one-way ANOVA followed by Tukey’s post hoc multiple comparison tests, and significant differences between groups are indicated by the lack of common letter annotations of a, b, c, d at P < 0.05.

RESULTS Glucose-Stimulated Insulin Secretion and Cell Viability of RIN-5F Cells. RIN-5F cells were exposed to 33 mM glucose for a sustained period of 48 h to induce impaired glucose-stimulated insulin secretion (GSIS). As shown in Figure 2A, high glucose-exposed RIN-5F cells had a blunted insulin secretory response when glucose was raised from 5 to 25 mM, with a 1.2-fold increase of insulin secretion compared with a 1.6-fold increase in normal control RIN-5F cells maintained in 11 mM glucose. Culturing RIN-5F cells at high glucose concentration of 33 mM decreased insulin content (3.05 vs 7.57 ng/mL insulin for RIN-5F cells cultured at 33 and 11 mM glucose, respectively; P < 0.05) when stimulated with 25 mM glucose. And, DMC improved the impaired insulin secretion (33 mM glucose for 48 h) with glucose stimulation (25 mM glucose for 2 h) in a concentration-dependent manner (P < 0.05 vs control group); it increased insulin secretion by 1.94 and 4.38 ng/mL (63 and 143%, respectively) at the concentration of 2 and 20 μM, respectively. However, DMC did not show significant insulin secretion enhancing effect at basal insulin secretion condition under 5 mM glucose. Under the condition of normal status of 11 mM glucose, the addition of DMC did not increase insulin secretion without glucose stimulation. When responding to an acute stimulation of 25 mM glucose, the insulin secretion rose from 7.57 to 9.30 and 9.94 ng/mL with the treatment of 2 and 20 μM DMC, respectively (P < 0.05). Thus, DMC maintained the GSIS potential of RIN-5F cells chronically exposed to high glucose levels.

To test the effects of high glucose and various concentrations of DMC on the viability of RIN-5F cells, CCK-8 assay was performed after the glucose stimulated insulin secretion assay. The results showed that the viability of RIN-5F cells treated with 33 mM glucose was reduced by 28% when compared with that of the control group with 11 mM glucose (Figure 2B). DMC, applied at different concentrations, did not affect the viability of RIN-5F cells compared with the corresponding controls (Figure 2B). DMC Regulated β-Cell Function via GLP-1R, PDX-1, PRE-INS, GLUT2, and GCK at Gene Expression Level. In order to determine which step, from glucose sensing to insulin exocytosis, is impaired in glucotoxicity status in RIN-5F cells and the effect of DMC on glucotoxicity, we compared the gene expression levels of a series of regulators of insulin secretion process in pancreatic β-cells. The mRNA levels of glucagon-like peptide-1 receptor (GLP-1R), insulin transcription factor PDX1, preinsulin (PRE-INS), glucose transport 2 (GLUT2), and glucokinase (GCK) were determined by qPCR. As shown in Figure 3, semiquantitative RT-PCR analysis showed that 33 mM glucose significantly downregulated the transcription levels of the tested genes compared with the normal glucose level of 1604

dx.doi.org/10.1021/jf405365d | J. Agric. Food Chem. 2014, 62, 1602−1608

Journal of Agricultural and Food Chemistry

Article

Figure 3. Relative mRNA expression of GLUT2, PRE-INS, PDX-1, GLP-1R, and GCK at glucose dose of 11 and 33 mM with or without the treatment of 2 μM DMC, fold change compared with 33 mM glucose control group. Values are shown as mean ± SEM (n = 3), triplicate by means of three independent experiments. The data values were analyzed by one-way ANOVA followed by Tukey’s post hoc multiple comparison tests, and significant differences between groups are indicated by different letters of a, b, c at P < 0.05.

11 mM (P < 0.05). Under the treatment of 11 mM glucose, none of the tested target gene expression was statistically altered by 2 μM DMC. Under the condition of 33 mM glucose, 2 μM DMC significantly increased the expression levels of GLP-1R, PDX-1, PRE-INS, GLUT2, and GCK (P < 0.05) to a level beyond those at 11 mM glucose status (Figure 3). PDX-1 Was Involved in Insulin Release at Protein Level. PDX-1 is involved in β-cell differentiation and functional maintenance and regulates the transcription of insulin and other insulin secretion related genes.49 To confirm whether DMC stimulates the expression of PDX-1 at the protein level based on the results of mRNA investigation, Western blotting analysis was employed upon RIN-5F cells cultured at 11 and 33 mM glucose for 48 h. The high glucose control (33 mM) reduced the protein expression of PDX-1 compared with the maintenance glucose (11 mM) condition (P < 0.05). Application of 20 μM DMC effectively reversed the suppression of PDX-1 after prolonged high glucose incubation (Figure 4A,B) (P < 0.01), and resulted in ∼3.3-fold enhancement in PDX-1 expression which was even stronger than that under maintenance glucose condition, whereas, 2 μM of DMC was not effective in regulating PDX-1 expression at the protein level, but it significantly increased its gene expression level; the possible reason was that 2 μM DMC induced PDX-1 mRNA changes were not strong enough to alter its protein expression level or needed more time to see the alteration. DMC Inhibited NO Release under Glucotoxicity Condition. Since the half-life of NO is very short, the concentration of nitrite was measured using Griess reagents. As shown in Figure 5A, 33 mM glucose treatment significantly enhanced nitrite content compared with the treatment of maintenance glucose concentration of 11 mM (P < 0.05). Under the condition of glucotoxicity (33 mM glucose), DMC remarkably suppressed the increase of nitrite content dosedependently (P < 0.05). Meanwhile, there was no significant difference among control and DMC treatment groups under the 11 mM glucose maintenance level. The results indicated that DMC could protect β-cells from damage caused by overproduction of NO. DMC Suppressed the Expression of iNOS and MCP-1 at mRNA Level. As shown in Figure 5B, under conditions of glucotoxicity (33 mM glucose), the mRNA levels of iNOS and

Figure 4. Effect of DMC on the glucose induced PDX-1 expression in RIN-5F cells. (A) A representative image of protein expression of GAPDH and PDX-1 measured by Western blot. (B) Quantification of PDX-1 protein expression. The level of PDX-1 expression was normalized against GAPDH, and the results were expressed as relative fold change compare to 33 mM glucose control. Values are shown as mean ± SEM (n = 3) by means of three independent experiments. The data values were analyzed by one-way ANOVA followed by Dunnett’s post hoc: compare all columns vs 33 mM glucose control column tests, and significant differences between groups are indicated by * at P < 0.05 and ** at P < 0.01.

MCP-1 reached 2- and 2.8-fold of the maintenance level. At the glucotoxicity state, treatment with DMC at 2 and 20 μM decreased the mRNA level of iNOS by 86 and 88%, respectively (P < 0.05 vs control group), but did not show significant difference between these two concentrations (P > 0.05). With the concentration of 2 and 20 μM DMC, the mRNA levels of MCP-1 were decreased by 77 and 96%, respectively (P < 0.05 vs control group). While at the maintenance condition of 11 mM glucose, treatment with DMC at 2 and 20 μM did not cause a significant reduction of the mRNA level of iNOS and MCP-1.

■

DISCUSSION Pancreatic islet cells are more susceptible to oxidative stress than cells in other tissue as they produce less antioxidant enzymes.5 Damage of pancreatic islets leads to decreased insulin secretion, resulting in hyperglycemic condition and continuous generation of additional oxidative stress, forming a vicious cycle. Pretreatment of aqueous extract of Cleistocalyx operculatus flower buds has been demonstrated to restore the pancreatic islets insulin secretion injury of streptozotocininduced diabetic rats.14 Also, pretreatment of DMC was shown to protect the damage of H2O2-induced glucose responded insulin secretion of MIN6 cells47 by conferring antioxidant and antiapoptotic effects through improved mitochondrial function in our previous work.48 In the present study, we investigated the effect of DMC on RIN-5F cells under glucotoxicity condition and its underlying mechanism. Induction of glucotoxicity was achieved by incubating cells with 33 mM glucose for a duration of time, as previously reported.50 Our 1605

dx.doi.org/10.1021/jf405365d | J. Agric. Food Chem. 2014, 62, 1602−1608

Journal of Agricultural and Food Chemistry

Article

Figure 5. Effect of various concentrations of DMC on (A) NO release and (B) relative mRNA expression of iNOS and MCP-1 in RIN-5F cells under the maintenance and glucotoxicity conditions. Values are expressed as mean ± SEM (n = 3), triplicate by means of three independent experiments. The data values were analyzed by one-way ANOVA followed by Tukey’s post hoc multiple comparison tests, and significant differences between groups are indicated by different letters of a, b at P < 0.05.

current study showed that incubation with 33 mM glucose for 48 h significantly impaired the basal and glucose-induced insulin secretion in RIN-5F cells. Treatment with DMC (2 and 20 μM) caused a significant increase of glucose-induced insulin secretion in a dose-dependent manner compared with control under conditions of glucotoxicity. As no impact on cell viability was observed, such effect could, at least in part, be attributed to the enhanced insulin secretion capacity. There are two main signaling pathways impacting insulin secretion. In the first pathway glucose is transported into pancreatic β-cells by GLUT2, and then metabolized by GCK to glucose-6-phosphate, resulting in ATP production, which in turn induces Ca2+ influx, followed by the release of insulin (Figure 6).51 Under simulated chronic glucotoxicity, the expression of GLUT2 and GCK in RIN-5F cells was decreased in the present study, accompanied with a reduction of insulin secretion, an observation which was in line with the existing literature.52 In the present study, DMC was observed to reverse the decrease in glucose-stimulated insulin secretion by RIN-5F cells under glucotoxic conditions and to boost glucosestimulated insulin secretion under normal conditions. At the same time, the mRNA levels of GLUT2 and GCK were

Figure 6. Schematic representation of the major intracellular steps that lead to insulin secretion. The signal pathways include glucose-induced and GLP-1-induced insulin secretion. The targets written in white color were tested in the present study.

1606

dx.doi.org/10.1021/jf405365d | J. Agric. Food Chem. 2014, 62, 1602−1608

Journal of Agricultural and Food Chemistry elevated by DMC, suggesting that the entire glucose-stimulated insulin release pathway was affected. The second recognized signaling route affecting insulin secretion is mediated by GLP-1. GLP-1 is produced in the intestine and binds to a specific receptor (GLP-1R) located on the membrane of pancreatic β-cells. The interaction between GLP-1 and GLP-1R leads to activation of adenylate cyclase (AC) and production of cAMP as a secondary messenger. Followed by protein kinase A (PKA) activation and PDX-1 translocation to the nucleus, PRE-INS expression is induced (Figure 6).51 In our study, DMC enhanced the gene expression of GLP-1R compared with control in the glucotoxicity assay. Thus, we concluded that DMC might mimic the effect of GLP1, enhance the expression of GLP-1R, and promote insulin secretion. As GLP-1 stimulates the expression of GLUT2 and GCK to help to confer glucose sensitivity to β-cells,53 DMC may mimic GLP-1 and stimulate GLP-1R to increase the expression of GLUT2 and GCK. The gene expression levels of GLP-1R, PDX-1, PRE-INS, GLUT2, and GCK were only significantly elevated by DMC under glucotoxic conditions in the study, but not at normal conditions, suggesting that pancreatic cells might only be susceptible to DMC under the condition of elevated glucose (33 mM in this study). The upregulation of multiple genes by DMC may indicate potentiated glucose stimulation of multiple elements of the insulin secretion pathway. PDX-1 is recognized as a key regulation factor in the cascade regulating insulin secretion49 (Figure 6); therefore, we quantified the impact of DMC on increasing the protein expression via Western blotting analysis, with results showing increased PDX-1 level as well. Since PDX-1 is a transcription factor that acts by translocation into the nucleus, we hypothesized that increased amount of PDX-1 would also enable stronger downstream gene expression activation. We addressed the potential protective effect of DMC against oxidative and inflammatory damage induced by glucotoxicity. The incubation of RIN-5F cells with 33 mM glucose led to elevated levels of NO production and MCP-1 expression, contributing to oxidative stress and inflammatory damage. DMC treatment dramatically alleviated such impact, which could partially explain the restored insulin secretion ability observed in RIN-5F cells. In conclusion, the present study provided evidence that DMC could ameliorate glucotoxicity-induced impairment of insulin secretion by RIN-5F cells. The mechanism was likely to involve potentiating GLP-1R mediated PDX-1 translocation, the elevated expression of GLUT2 and GCK, and protection against detrimental oxidative and inflammatory damage by DMC.

■

■

ABBREVIATIONS USED

■

REFERENCES

Article

DMC, 2′,4′-dihydroxy-6′-methoxy-3′,5′-dimethylchalcone; PKA, protein kinase A; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GLP-1R, glucagon-like peptide-1 receptor; PDX-1, pancreatic duodenum homeobox-1; GLUT2, glucose transporter 2; PPAR-γ, peroxisome proliferator-activated receptor-γ; GCK, glucokinase; GSIS, glucose-stimulated insulin secretion; iNOS, inducible nitric oxide synthase; PRE-INS, preinsulin; MCP-1, monocyte chemoattractant protein-1; CCK-8, cell counting kit-8

(1) Kaiser, N.; Leibowitz, G.; Nesher, R. Glucotoxicity and beta-cell failure in type 2 diabetes mellitus. J. Pediatr. Endocrinol. Metab. 2003, 16, 5−22. (2) Solomon, T. P. J.; Knudsen, S. H.; Karstoft, K.; Winding, K.; Holst, J. J.; Pedersen, B. K. Examining the effects of hyperglycemia on pancreatic endocrine function in humans: evidence for in vivo glucotoxicity. J. Clin. Endocrinol. Metab. 2012, 97, 4682−4691. (3) Brownlee, M. A radical explanation for glucose-induced beta cell dysfunction. J. Clin. Invest. 2003, 112, 1788−1790. (4) Marchetti, P.; Del Prato, S.; Lupi, R.; Del Guerra, S. The pancreatic beta-cell in human Type 2 diabetes. Nutr. Metab. Cardiovasc. Dis. 2006, 16 (Suppl. 1), S3−6. (5) Robertson, R.; Zhou, H.; Zhang, T.; Harmon, J. S. Chronic oxidative stress as a mechanism for glucose toxicity of the beta cell in type 2 diabetes. Cell Biochem. Biophys. 2007, 48, 139−146. (6) Bonora, E. Protection of pancreatic beta-cells: is it feasible? Nutr. Metab. Cardiovasc. Dis. 2008, 18, 74−83. (7) Chang-Chen, K. J.; Mullur, R.; Bernal-Mizrachi, E. Beta-cell failure as a complication of diabetes. Rev. Endocr. Metab. Disord. 2008, 9, 329−343. (8) Lee, S. H.; Park, M. H.; Park, S. J.; Kim, J.; Kim, Y. T.; Oh, M. C.; Jeong, Y.; Kim, M.; Han, J. S.; Jeon, Y. J. Bioactive compounds extracted from Ecklonia cava by using enzymatic hydrolysis protects high glucose-induced damage in INS-1 pancreatic β-cells. Appl. Biochem. Biotechnol. 2012, 167, 1973−1985. (9) Chakraborty, D.; Samadder, A.; Dutta, S.; Khuda-Bukhsh, A. R. Antihyperglycemic potentials of a threatened plant, Helonias dioica: antioxidative stress responses and the signaling cascade. Exp. Biol. Med. (Maywood) 2012, 237, 64−76. (10) Palsamy, P.; Subramanian, S. Ameliorative potential of resveratrol on proinflammatory cytokines, hyperglycemia mediated oxidative stress, and pancreatic beta-cell dysfunction in streptozotocinnicotinamide-induced diabetic rats. J. Cell. Physiol. 2010, 224, 423− 432. (11) Ekelund, M.; Qader, S. S.; Jimenez-Feltstrom, J.; Salehi, A. Selective induction of inducible nitric oxide synthase in pancreatic islet of rat after an intravenous glucose or intralipid challenge. Nutrition 2006, 22, 652−660. (12) Yuan, H. D.; Chung, S. H. Fermented ginseng protects streptozotocin-induced damage in rat pancreas by inhibiting nuclear factor-kappaB. Phytother. Res. 2010, 24 (Suppl. 2), S190−195. (13) Dung, N. T.; Kim, J. M.; Kang, S. C. Chemical composition, antimicrobial and antioxidant activities of the essential oil and the ethanol extract of Cleistocalyx operculatus (Roxb.) Merr and Perry buds. Food Chem. Toxicol. 2008, 46, 3632−3639. (14) Mai, T. T.; Yamaguchi, K.; Yamanaka, M.; Lam, N. T.; Otsuka, Y.; Chuyen, N. V. Protective and anticataract effects of the aqueous extract of Cleistocalyx operculatus flower buds on beta-cells of streptozotocin-diabetic rats. J. Agric. Food Chem. 2010, 58, 4162−4168. (15) Ye, C. L.; Lu, Y. H.; Wei, D. Z. Flavonoids from Cleistocalyx operculatus. Phytochemistry 2004, 65, 445−447. (16) Min, B. S.; Thu, C. V.; Dat, N. T.; Dang, N. H.; Jang, H. S.; Hung, T. M. Antioxidative flavonoids from Cleistocalyx operculatus buds. Chem. Pharm. Bull. 2008, 56, 1725−1728.

AUTHOR INFORMATION

Corresponding Author

*Tel: + 86-21-64251185. Fax: + 86-21-64251185. E-mail: [email protected]. Funding

This work was supported by “the Fundamental Research Funds for the Central Universities”, and partially supported by Shanghai Leading Academic Discipline Project (B505), the National Special Fund for State Key Laboratory of Bioreactor Engineering (2060204). Notes

The authors declare no competing financial interest. 1607

dx.doi.org/10.1021/jf405365d | J. Agric. Food Chem. 2014, 62, 1602−1608

Journal of Agricultural and Food Chemistry

Article

(17) Min, B. S.; Cuong, T. D.; Lee, J. S.; Shin, B. S.; Woo, M. H.; Hung, T. M. Cholinesterase inhibitors from Cleistocalyx operculatus buds. Arch. Pharm. Res. 2010, 33, 1665−1670. (18) Woo, A. Y. H.; Waye, M. M. Y.; Kwan, H. S.; Chan, M. C. Y.; Chau, C. F.; Cheng, C. H. K. Inhibition of ATPases by Cleistocalyx operculatus. A possible mechanism for the cardiotonic actions of the herb. Vasc. Pharmacol. 2002, 38, 163−168. (19) Mai, T. T.; Thu, N. N.; Tien, P. G.; Van Chuyen, N. Alphaglucosidase inhibitory and antioxidant activities of Vietnamese edible plants and their relationships with polyphenol contents. J. Nutr. Sci.Vitaminol. 2007, 53, 267−276. (20) Mai, T. T.; Chuyen, N. Van Anti-Hyperglycemic Activity of an Aqueous Extract from Flower Buds of Cleistocalyx operculatus (Roxb.) Merr and Perry. Biosci., Biotechnol., Biochem. 2007, 71, 69−76. (21) Ko, H.; Kim, Y. J.; Amor, E. C.; Lee, J. W.; Kim, H. C.; Kim, H. J.; Yang, H. O. Induction of autophagy by dimethyl cardamonin is associated with proliferative arrest in human colorectal carcinoma HCT116 and LOVO cells. J. Cell Biochem. 2011, 112, 2471−2479. (22) Li, D. D.; Wu, X. Q.; Tang, J.; Wei, X. Y.; Zhu, X. F. ON-III inhibits erbB-2 tyrosine kinase receptor signal pathway and triggers apoptosis through induction of Bim in breast cancer cells. Cancer Biol. Ther. 2009, 8, 739−743. (23) Ye, C. L.; Liu, Y.; Wei, D. Z. Antioxidant and anticancer activity of 3′-formyl-4′, 6′-dihydroxy-2′-methoxy-5′-methylchalcone and (2S)8-formyl-5-hydroxy-7-methoxy-6-methylflavanone. J. Pharm. Pharmacol. 2007, 59, 553−559. (24) Ye, C. L.; Qian, F.; Wei, D. Z.; Lu, Y. H.; Liu, J. W. Induction of apoptosis in K562 human leukemia cells by 2′,4′-dihydroxy-6′methoxy-3′,5′-dimethylchalcone. Leuk. Res. 2005, 29, 887−892. (25) Zhu, X.; Xie, B.; Zhou, J.; Feng, G.; Liu, Z.; Wei, X.; Zhang, F.; Liu, M.; Zeng, Y. Blockade of vascular endothelial growth factor receptor signal pathway and antitumor activity of ON-III (2′,4′dihydroxy-6′-methoxy-3′,5′-dimethylchalcone), a Component from Chinese herbal medicine. Mol. Pharmacol. 2005, 67, 1444−1450. (26) Ye, C. L.; Liu, J. W.; Wei, D. Z.; Lu, Y. H.; Qian, F. In vivo antitumor activity by 2′,4′-dihydroxy-6′-methoxy-3′,5′-dimethylchalcone in a solid human carcinoma xenograft model. Cancer Chemother. Pharmacol. 2005, 55, 447−452. (27) Ye, C. L.; Liu, J. W.; Wei, D. Z.; Lu, Y. H.; Qian, F. In vitro antitumor activity of 2′,4′-dihydroxy-6′-methoxy-3′,5′-dimethylchalcone against six established human cancer cell lines. Pharmacol. Res. 2004, 50, 505−510. (28) Huang, H.; Niu, J.; Lu, Y. Multidrug resistance reversal effect of DMC derived from buds of Cleistocalyx operculatus in human hepatocellular tumor xenograft model. J. Sci. Food Agric. 2012, 92, 135−140. (29) Huang, H.; Niu, J.; Zhao, L.; Lu, Y. Reversal effect of 2′,4′dihydroxy-6′-methoxy-3′,5′-dimethylchalcone on multi-drug resistance in resistant human hepatocellular carcinoma cell line BEL-7402/5-FU. Phytomedicine 2011, 18, 1086−1092. (30) Qian, F.; Ye, C. L.; Wei, D. Z.; Lu, Y. H.; Yang, S. L. In vitro and in vivo reversal of cancer cell multidrug resistance by 2′,4′-dihydroxy6′-methoxy-3′,5′-dimethylchalcone. J. Chemother. 2005, 17, 309−314. (31) Kim, Y. J.; Ko, H.; Park, J. S.; Han, I. H.; Amor, E. C.; Lee, J. W.; Yang, H. O. Dimethyl cardamonin inhibits lipopolysaccharide-induced inflammatory factors through blocking NF-kappaB p65 activation. Int. Immunopharmacol. 2010, 10, 1127−1134. (32) Dung, N. T.; Bajpai, V. K.; Yoon, J. I.; Kang, S. C. Antiinflammatory effects of essential oil isolated from the buds of Cleistocalyx operculatus (Roxb.) Merr and Perry. Food Chem. Toxicol. 2009, 47, 449−453. (33) Martínez, A.; Conde, E.; Moure, A. Natural Product Research: Formerly Natural Product Letters Protective effect against oxygen reactive species and skin fibroblast stimulation of Couroupita guianensis leaf extracts. Nat. Prod. Res. 2012, 37−41. (34) Su, M. Y.; Huang, H. Y.; Li, L.; Lu, Y. H. Protective effects of 2′,4′-dihydroxy-6′-methoxy-3′,5′-dimethylchalcone to PC12 cells against cytotoxicity induced by hydrogen peroxide. J. Agric. Food Chem. 2011, 59, 521−527.

(35) Maisuthisakul, P.; Suttajit, M.; Pongsawatmanit, R. Assessment of phenolic content and free radical-scavenging capacity of some Thai indigenous plants. Food Chem. 2007, 100, 1409−1418. (36) Yu, W. G.; Qian, J.; Lu, Y. H. Hepatoprotective effects of 2′,4′dihydroxy-6′-methoxy-3′,5′-dimethylchalcone on CCl4-induced acute liver injury in mice. J. Agric. Food Chem. 2011, 59, 12821−12829. (37) Amor, E. C.; Villaseñor, I. M.; Ghayur, M. N.; Gilani, A. H.; Choudhary, M. I. Spasmolytic flavonoids from Syzygium samarangense (Blume) Merr. & L.M. Perry. Z. Naturforsch., C 2005, 60, 67−71. (38) Ghayur, M. N.; Gilani, A. H.; Khan, A; Amor, E. C.; Villaseñor, I. M.; Choudhary, M. I. Presence of calcium antagonist activity explains the use of Syzygium samarangense in diarrhoea. Phytother. Res. 2006, 20, 49−52. (39) Salem, M. M.; Werbovetz, K. A. Antiprotozoal compounds from Psorothamnus polydenius. J. Nat. Prod. 2005, 68, 108−111. (40) Gafner, S.; Wolfender, J. L.; Mavi, S.; Hostettmann, K. Antifungal and antibacterial chalcones from Myrica serrata. Planta Med. 1996, 62, 67−69. (41) Dao, T. T.; Tung, B. T.; Nguyen, P. H.; Thuong, P. T.; Yoo, S. S.; Kim, E. H.; Kim, S. K.; Oh, W. K. C-Methylated Flavonoids from Cleistocalyx operculatus and Their Inhibitory Effects on Novel Influenza A (H1N1) Neuraminidase. J. Nat. Prod. 2010, 3423, 1636−1642. (42) Amor, E. C.; Villaseñor, I. M.; Yasin, A.; Choudhary, M. I. Prolyl endopeptidase inhibitors from Syzygium samarangense (Blume) Merr. & L. M. Perry. Z. Naturforsch., C 2004, 59, 86−92. (43) Resurreccion-Magno, M. H.; Villaseñor, I. M.; Harada, N.; Monde, K. Antihyperglycaemic flavonoids from Syzygium samarangense (Blume) Merr. and Perry. Phytother. Res. 2005, 19, 246−251. (44) Jin, X. H.; Wei, X. Y.; Huang, Z. W.; Wu, D. H. Identify and Characterize the PPAR-γ Ligand-binding Activity of Extracts of Cleistocalyx operculatus. J. Anhui Agric. Sci. 2008, 36, 9106−9109. (45) Lu, Y.; Du, C.; Wu, Z.; Ye, C.; Liu, J.; Wei, D. Protective effects of Cleistocalyx operculatus on lipid peroxidation and trauma of neuronal cells. Zhongguo Zhongyao Zazhi 2003, 28, 964−966. (46) Su, M. Y.; Huang, H. Y.; Li, L.; Lu, Y. H. Protective effects of 2′,4′-dihydroxy-6′-methoxy-3′,5′-dimethylchalcone to PC12 cells against cytotoxicity induced by hydrogen peroxide. J. Agric. Food Chem. 2011, 59, 521−527. (47) Hu, Y. C.; Luo, Y. D.; Li, L.; Joshi, M. K.; Lu, Y. H. In vitro investigation of 2′,4′-dihydroxy-6′-methoxy-3′,5′-dimethylchalcone for glycemic control. J. Agric. Food Chem. 2012, 60, 10683−10688. (48) Luo, Y. D.; Lu, Y. H. 2′,4′-Dihydroxy-6′-methoxy-3′,5′dimethylchalcone inhibits apoptosis of MIN6 cells via improving mitochondrial function. Pharmazie 2012, 67, 798−803. (49) Kaneto, H.; Miyatsuka, T.; Kawamori, D.; Matsuoka, T. A. Pleiotropic Roles of PDX-1 in the Pancreas. Rev. Diabetic Stud. 2007, 4, 209−225. (50) Cai, E. P.; Lin, J. K. Epigallocatechin gallate (EGCG) and rutin suppress the glucotoxicity through activating IRS2 and AMPK signaling in rat pancreatic beta cells. J. Agric. Food Chem. 2009, 57, 9817−9827. (51) Dalle, S.; Burcelin, R.; Gourdy, P. Specific actions of GLP-1 receptor agonists and DPP4 inhibitors for the treatment of pancreatic β-cell impairments in type 2 diabetes. Cell. Signalling 2013, 25, 570− 579. (52) Jonas, J. C.; Bensellam, M.; Duprez, J.; Elouil, H.; Guiot, Y.; Pascal, S. M. A. Glucose regulation of islet stress responses and betacell failure in type 2 diabetes. Diabetes, Obes. Metab. 2009, 11 (Suppl. 4), 65−81. (53) Ding, S. Y.; Nkobena, A.; Kraft, C. A.; Markwardt, M. L.; Rizzo, M. A. Glucagon-like peptide 1 stimulates post-translational activation of glucokinase in pancreatic beta cells. J. Biol. Chem. 2011, 286, 16768−16774.

1608

dx.doi.org/10.1021/jf405365d | J. Agric. Food Chem. 2014, 62, 1602−1608