Directing Induced Pluripotent Stem Cell Derived Neural Stem Cell

Research Article Cite This: ACS Appl. Mater. Interfaces XXXX, XXX, XXX−XXX

www.acsami.org

Directing Induced Pluripotent Stem Cell Derived Neural Stem Cell Fate with a Three-Dimensional Biomimetic Hydrogel for Spinal Cord Injury Repair Lei Fan,†,‡,# Can Liu,†,# Xiuxing Chen,§,# Yan Zou,○ Zhengnan Zhou,∥ Chenkai Lin,⊥ Guoxin Tan,∥ Lei Zhou,*,‡ Chenyun Ning,*,‡ and Qiyou Wang*,† †

Department of Spine Surgery, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou 510630, Guangdong Province, China ‡ College of Materials Science and Technology, South China University of Technology, Guangzhou 510641, Guangdong Province, China § State Key Laboratory of Oncology in South China, Sun Yat-sen University Cancer Center, Guangzhou 510630, Guangdong Province, China ∥ Institute of Chemical Engineering and Light Industry, Guangdong University of Technology, Guangzhou 510006, Guangdong Province, China ⊥ Department of Orthopedics, The Seventh Affiliated Hospital of Sun Yat-sen University, Shenzhen 510275, Guangdong Province, China ○ Department of Radiology, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou 510630, Guangdong Province, China S Supporting Information *

ABSTRACT: Current treatment approaches for spinal cord injuries (SCIs) are mainly based on cellular transplantation. Induced pluripotent stem cells (iPSCs) without supply constraints and ethical concerns have emerged as a viable treatment option for repairing neurological disorders. However, the primarily limitations in the neuroregeneration field are uncontrolled cell differentiation, and low cell viability caused by the ischemic environment. The mechanical property of three-dimensional (3D) hydrogel can be easily controlled and shared similar characteristics with nerve tissue, thus promoting cell survival and controlled cell differentiation. We propose the combination of a 3D gelatin methacrylate (GelMA) hydrogel with iPSC-derived NSCs (iNSCs) to promote regeneration after SCI. In vitro, the iNSCs photoencapsulated in the 3D GelMA hydrogel survived and differentiated well, especially in lower-moduli hydrogels. More robust neurite outgrowth and more neuronal differentiation were detected in the soft hydrogel group. To further evaluate the in vivo neuronal regeneration effect of the GelMA hydrogels, a mouse spinal cord transection model was generated. We found that GelMA/iNSC implants significantly promoted functional recovery. Further histological analysis showed that the cavity areas were significantly reduced, and less collagen was deposited in the GelMA/iNSC group. Furthermore, the GelMA and iNSC combined transplantation decreased inflammation by reducing activated macrophages/microglia (CD68-positive cells). Additionally, GelMA/iNSC implantation showed striking therapeutic effects of inhibiting GFAP-positive cells and glial scar formation while simultaneously promoting axonal regeneration. Undoubtedly, use of this 3D hydrogel stem cell-loaded system is a promising therapeutic strategy for SCI repair. KEYWORDS: gelatin methacrylate hydrogel scaffold, 3D culture, induced pluripotent stem cells, spinal cord injury, neuroregeneration

1. INTRODUCTION Traumatic injury or disease may result in spinal cord injury (SCI). Generally, SCIs have devastating conditions that can leads to permanent sensory and motor dysfunction below the injury site, mainly due to the appearance of a harsh microenvironment around the damage site, which impairs neuroregeneration and functional recovery after a SCI. Because © XXXX American Chemical Society

of the severity of SCIs, no effective treatment has yet to be developed.1−3 Recent advances in stem cell transplantation provide a potentially effective method to repair damaged spinal Received: April 2, 2018 Accepted: May 7, 2018 Published: May 7, 2018 A

DOI: 10.1021/acsami.8b05293 ACS Appl. Mater. Interfaces XXXX, XXX, XXX−XXX

Research Article

ACS Applied Materials & Interfaces

Figure 1. Schematic representation of the hydrogel synthesis and animal experiment. A mixed solution of GelMA and iNSCs cross-linked by a photoinitiator under UV irradiation was developed. After generating the complete transection mouse SCI model, the scaffold was transplanted into the injury site. MEFs = mouse embryonic fibroblasts, iPSCs = induced pluripotent stem cells, iNSCs = iPSC-derived neural stem cells, NSCs = neural stem cells, RN = regenerative nerve, SCI = spinal cord injury.

properties of the material, which cannot be simulated by these 3D scaffolds. In our study, hydrogels composed of the collagen degradation product gelatin combined with methacrylate (GelMA) were used to photoencapsulate iPSC-derived neural stem cells (iNSCs) and provided an excellent scaffold material for SCI repair. The GelMA 3D hydrogel system shared similar characteristics with nerve tissue, including high permeability for oxygen and nutrients, a high water-content matrix, and moderate mechanical properties, which together provide an excellent environment for cell growth.10 Promoting and controlling the differentiation of iNSCs into neurons is a major aim in transplantation studies. Biophysical aspects of the biomaterials, especially elasticity, play an important role in cellular behaviors containing stem cell expansion, migration, and differentiation.15 The mechanical properties of the hydrogel have been reported to have profound influence on NSC differentiation.16 The fates of NSCs can be modulated by the mechanical properties of the hydrogel. NSCs can not survive well in materials which possess very low (100 kPa), and neuronal differentiation is more likely in soft scaffolds (≈0.1−1 kPa); otherwise, NSCs are prone to astrocyte differentiation in slightly stiffer materials (≈7−10 kPa).17,18 Thus, the proliferation and fate of NSCs could be manipulated by just regulating the mechanical properties of hydrogels. Importantly, the phenotype and migration of neural cells play important roles in neuronal maturation. Furthermore, whether the mechanical properties of GelMA hydrogels also have profound influences on the survival, migration, and differentiation of iNSCs has not been addressed in previous research.19 In addition, the GelMA hydrogel is rich in the cell-adhesive Arg-Gly-Asp (RGD) peptide, which increases the adhesion and differentiation of encapsulated stem cells.10,20 Several groups have reported the application of

cords. Induced pluripotent stem cells (iPSCs) without supply constraints and ethical concerns have been implanted into models of SCI and have achieved promising results, and iPSCbased treatments have emerged as a powerful approach for neurological regeneration.4−6 With the advent of iPSC technology, iPSCs have become a promising cell type for use in therapeutic approaches to treat patients with SCI. However, various limitations still need to be overcome to use direct cell injections as a therapeutic strategy in SCI. (1) Direct injections inevitably cause cell loss in the injury site.7 (2) Dead or dying cells caused by ischemia and the adverse environment at the injured site can worsen outcomes.8 (3) The differentiation of transplanted stem cells to their mature phenotypes including neurons, astrocytes, and oligodendrocytes was uncontrolled.9,10 The cells in traditional two-dimensional (2D) systems are very different from those cultured in 3D environments regarding their adhesion, spreading, polarity, and migration.11,12 A promising three-dimensional (3D) biomimetic platform that mimics the unique physiological microenvironment of the native central nervous system (CNS) is needed to deliver stem cells and promote cell survival and neural differentiation. The aim of 3D cell culture systems is to simulate the in situ functions of living tissue by rebuilding organizational structure and providing a favorable microenvironment for cell survival and proliferation.13 In particular, to study the CNS, given the poor representation of soft tissue provided by 2D cultures, 3D cultures of neural lineage cells (neurons and glial cells) are exploited to more accurately rebuild the complex function and structure of the human brain.13,14 Solid porous scaffolds or other fibrous 3D scaffolds with cells seeded on the surface of the scaffold do not imitate the natural structure of the CNS well. For example, the direction of neural stem cell (NSC) differentiation can be well-controlled by the mechanical B


Research Article

ACS Applied Materials & Interfaces Table 1. Primer Sequences target

forward

reverse

GAPDH Tuj-1 GFAP SOX2 4-Oct NANOG Nestin PAX

AGGTCGGTGTGAACGGATTTG TCACGCAGCAGATGTTCGAT CCTGAGAGAGATTCGCACTCAA TAGAGCTAGACTCCGGGCGAT TCTTTCCACCAGGCCCCCGGCTC CACAGTTTGCCTAGTTCTGAGG CCCCTTGCCTAATACCCTTGA GTTGTGTGAGTAAAATTCTGGGC

GGGGTCGTTGATGGCAACA GTGGCGCGGGTCACA CTCCTCTGTCTCTTGCATGTTACTG TTGCCTTAAACAAGACCACGAAA TGCGGGCGGACATGGGGAGATCC GCAAGAATAGTTCTCGGGATGAA GCCTCAGACATAGGTGGGATG GAGTCGCCACTCTTGGCTTA

10% FBS (GIBCO)) for 48 h. Then, these cells were collected and cultured with an MEF feeder in iPSC induction medium (DMEM supplemented with 15% KSR (GIBCO), 1 mM L- glutamine (GIBCO), 1 mM sodium pyruvate (GIBCO), 0.1 mM nonessential amino acids (NEAA, GIBCO), 1× penicillin/streptomycin, 0.1 mM βmercaptoethanol (GIBCO), and 1000 units of recombinant leukemia inhibitory factor (LIF, Millipore)); the medium was changed every 2 days. (Figure 1). 2.2.2. Differentiation of IPSCs into INSCs. After dissociating with 0.125% trypsin-EDTA, iPSCs were transferred to agarose G-10-coated (BIOWEST) tissue culture dishes (low-attachment dishes) and cultured in iPSC medium without LIF to promote embryoid body (EB) formation. For differentiation toward a neuronal lineage, the EBs were treated with 1 μM all-trans retinoic acid (RA; Sigma) for 4 days and then transferred to 0.01% poly-L-lysine (PLL, Sigma) coated tissue culture dishes and maintained with NSC proliferation medium. The medium was changed every 2 days. Seven days later, NSC-like cells were trypsinized, transferred to low-attachment dishes, and cultured with NSC medium. 2.2.3. iNSC Photoencapsulation and 3D Culture. Cell photoencapsulation was conducted following previously published protocols.27 Briefly, iNSC were pelleted and resuspended in pure GelMA solution containing 0.5% (w/v) photoinitiator, Irgacure 2959 at a concentration of 1 × 107 cells/mL. Microgel units with entrapped cells were fabricated in a 6 mm in diameter and 2 mm in height PDMS mold following exposure to 6.9 mW/cm2 UV light (360−480 nm) for 15, 25, and 40 s, respectively. Then the cross-linking hydrogels were immediately transferred into NSC differentiation medium (1:1mix of Neurobasal Medium (NB, GIBCO) and DMEM/F12 supplemented with N2, B27, as well as 1 × Glutamax and Penicillin/Streptomycin) and cultured at 37 °C with 5% CO2. Half of the media was changed every other day. 2.2.4. Live−Dead Assays and Cell Proliferation within GelMA Hydrogels. Encapsulation iNSCs were washed by phosphate buffered saline (PBS) and then incubated with Calcein-AM/ethidium (CalceinAM/PI Invitrogen) homodimer fluorescence for 20 min at 37 °C, 5% CO2. After washing with PBS two times, the samples were visualized using an inverted fluorescence microscope (Olympus IX71, Olympus Co. Tokyo, Japan). A Cell Counting Kit-8 (CCK-8, Dojindo, Japan) test was used to measure cell proliferation. In brief, the proliferation of encapsulated cells were measured at 1, 3, and 7 days, respectively. After 3 h of being incubated in the medium containing CCK8 (1:10), 100 μL supernatant was transferred into 96-well culture plates. The absorbance of the solution was measured on microplate reader (EON, Gene Company Limited) at 450 nm. 2.2.5. Gene Expression. GelMA hydrogels were degraded in collagenase type II solution at 100 U/mL concentration (Sigma) at 37 °C for 1 h to release entrapped cells. Next, The process of reverse transcription quantitative polymerase chain reaction (RT-qPCR) were performed as described previously.29 The primer information is provided in Table 1. All experiments were performed in triplicate. Gene expression was calculated using the 2-ΔΔCt method. 2.2.6. Immunofluorescence. After the hydrogels were blocked with 4% paraformaldehyde at 4 °C for 20 min, they were permeabilized with a mixture of 6% fetal bovine serum (BSA Sigma) and 0.2% Triton X-100 (Sigma) for 1 h at room temperature. They were then incubated with primary antibodies (Table 2) overnight. After collecting the

this extracellular matrix (ECM) like GelMA scaffold for skin tissue engineering, bone repair, treatment of cardiovascular diseases, and so on.21−25 However, its potential for applications in neural tissue engineering has not been widely investigated. We hypothesized that photoencapsulated iNSCs in a tunable mechanical GelMA hydrogel 3D culture system that mimics both the structure and mechanical properties of nervous tissue would promote iNSC neuronal differentiation in vitro and in vivo. In the vivo study, hydrogels were used to fill the lesion site of the spinal cord in adult male mice to evaluate their neuroregenerative ability at time points up to 6 weeks. A GelMA hydrogel based a biomaterial was used to efficiently deliver iNSCs. Hydrogels are particularly appealing for use as the vehicle for cell transplantation because they not only can promote cell survival but also inhibit inflammation and promote neuroregeneration. To our knowledge, this is the first report to evaluate the effects of GelMA scaffold mechanical properties on the differentiation of iNSCs and to combine the good biocompatibility of GelMA scaffolds with iNSCs to treat SCI model mice.

2. MATERIALS AND METHODS 2.1. Fabrication and Characterization of GelMA Hydrogels. The synthesis process of GelMA has been reported in previous work.26,27 1H NMR spectra of GelMA were obtained according to the literature.28 At room temperature, a Bruker Avance 300 MHz instrument was used to determinate the methacrylation degree of GelMA at 1H resonance frequency of 400 MHz, 16 scans after dissolution in D2O (30 mg/mL). Hydrogels were prepared from GelMA solution (3% w/v) with 0.5% photoinitiator, 2-hydroxy-1-(4(hydroxyethoxy) phenyl)-2-methyl-1-propanone (Irgacure 2959; Sigma) under UV irradiation (6.9 mW/cm2, 360−480 nm). Varying UV exposure time (15, 25, and 40 s) yielded three hydrogels of variable stiffness. The internal microstructures of GelMA hydrogels with different stiffness were observed under a scanning electron microscope (SEM) as previously described.27 Then the software (ImageJ) was used to calculate the pore sizes. The compressive modulus of GelMA hydrogels were characterized on a Bose ELF 3200 universal testing system (Bose Corp., Eden Prairie, MN, USA). Briefly, after a 6 cm in diameter and 800 μm in thickness disc was removed from Dulbecco’s phosphate buffered saline (DPBS) and the residual liquid was removed by blotting with kimwipes, then the hydrogel disc was tested at a rate of 20% strain/min. From the linear region of the stress−strain, the compressive modulus can be calculated. 2.2. In Vitro Study. 2.2.1. Isolation of Murine Embryonic Fibroblasts (MEFs) and IPS Generation. The episomal vectors pEP4103EO2S-ET2K (7 μg) (Addgene plasmid 20927), which encoded three transcription factors, Oct4, Sox2, and Klf4, and pCEP4-miR302367 clusters (5 μg) were electroporated into 2 × 106 MEFs, which were obtained from mouse embryos at approximately 2 weeks according to previously published protocols.29 Plasmids carrying the reprogramming factors were transfected using a Nucleofector 2b Device (Lonza, Basel, Switzerland) according to the instructions. After transfection, 1 × 105 cells were cultured in MEF medium (DMEM + C


Research Article

ACS Applied Materials & Interfaces Table 2. Primary and Secondary Antibodies antibodies

species

type

dilution (cell/tissue)

source

Anti-beta III Tubulin (Tuj-1) Anti-Glial fibrillary acidic protein (GFAP) Anti-CD68 Anti-Synapsin I (Syn) Anti-Neurofilament (NF) Anti-Nestin Anti-Pax 6 Anti-NANOG Anti-SOX2 Anti-SSEA1 conjuncted Anti-Mouse secondary antibody conjuncted anti-Rabbit secondary antibody

mouse rabbit mouse rabbit rabbit mouse rabbit rabbit rabbit rabbit goat donkey

monoclonal IgG polyclonal IgG monoclonal IgG polyclonal IgG polyclonal IgG polyclonal IgG polyclonal IgG polyclonal IgG polyclonal IgG polyclonal IgG polyclonal IgG polyclonal IgG

1:1000/1:200 1:1000/1:200 1:200 1:1000 1:200 1:500 1:500 1:1000 1:1000 1:1000 1:1000/1:200 1:1000/1:200

Abcam, London, England Abcam, London, England Abcam, London, England Abcam, London, England Abcam, London, England Santa Cruz Biotechnology, INC, Texas, America Santa Cruz Biotechnology, INC, Texas, America Proteintech, Chicago, America Proteintech, Chicago, America Proteintech, Chicago, America Abcam, London, England Thermo Fisher, Massachusetts, America

Figure 2. Characteristics of the GelMA hydrogels. (A1−A3) Representative SEM images of the surfaces of the three hydrogel systems. The pore size of the hydrogels considerably increased as the modulus of hydrogels decreased. (B) Quantification of the average pore sizes of the GelMA hydrogels with three different mechanical stiffnesses (* and ** indicate p < 0.05 and p < 0.01, respectively). (C) Representative stress−strain curves of three hydrogel samples. (D) Quantification result of the compressive Young’s modulus showing that the modulus significantly decreased with hydrogel softness (* and ** indicate p < 0.05 and p < 0.01, respectively). (E) Appearance of the GelMA hydrogel. (F) Mouse spinal cord tissue can stick to the GelMA hydrogels in vitro. were anesthetized by injection of a mixture of 70 mg/kg ketamine and 5 mg/kg xylazine via intraperitoneal. After corneal reflexes stopped, fur was surgically shaved from the surgical site and the skin was disinfected with iodine tincture and ethanol 70%. Then layers of the skin and paravertebral muscles in the back of the mice were cut. The spinal cord was transected, and a 2 mm spinal cord segment was completely removed after laminectomy at the T9−10 level. After the respective treatment, the paravertebral muscles and skin were closed in layers, and then disinfected with ethanol 70% again. The mice were allowed to recover in a warmed cage with free access to food and water. 2.3.3. Motor Behavior and Footprint Analysis. The motor behavior of the hindlimbs was assessed by using Basso mouse scale (BMS) scores weekly.32 Hind limb movements of all three groups of mice were observed in a grid (80 cm side length) at 1−6 weeks postoperatively. The locomotion of hindlimbs was assessed with BMS scores ranging from 0 (no ankle movement) to 9 (complete functional recovery) points. In addition, mice were excluded from future

primary antibody, the secondary antibody was added, and cells were further incubated for 1 h. Finally, cells were stained with Hoechst 33342 (Sigma) in PBS for 5 min. Between each step, PBS was used to wash three times. 2.3. In Vivo Testing. 2.3.1. Ethics Statement. All experimental protocols and animal handling procedures were conducted according to National Institutes of Health Guide for the Care and Use of Laboratory Animal, which was approved by the Institutional Animal Care and Use Committee of Sun Yat-sen University. 2.3.2. Experimental Groups and Spinal Cord Injury Surgery. Twenty-four 6- to 8-week-old C57BL/6N male mice were randomly divided into three equal groups as follows: spinal cord transection with saline injection (SCI group), spinal cord transection with simple cell treatment (iNSCs group), and iNSC-laden GelMA hydrogel treatment (GelMA/iNSCs group). The spinal cord was transected at the level of T9−10 in adult male C57BL/6N mice as the method described previously.30,31 Briefly, mice D


Research Article


Figure 3. Generation and characterization of iPSCs and iNSCs. (A1−A2) Morphology of the iPSCs. Only the iPSC colonies expressed pluripotent green fluorescence. (A3) Alkaline phosphatase staining of iPSCs. (B1−B9) iPSCs expressed representative pluripotency markers including OCT4, SOX2, NANOG, and SSEA1. (C1−C3) H&E stained sections showed that teratomas formed from iPSCs after injection into immunodeficient mice differentiated into all three germ layers: ectoderm, endoderm, and mesoderm (black arrow). (D) Results of RT-qPCR revealed that iPSCs shared ESC-associated pluripotency markers OCT4, SOX2, NANOG, and SSEA1 while murine embryonic fibroblasts seldom express (* and ** indicate p < 0.05 and p < 0.01, respectively). (E1−E3) Morphologies of embryoid bodies (EBs), iNSCs, and differentiated neural cells. (F1−F3) Immunostaining of neural progenitor-specific markers Nestin and Pax-6. (G1−G9) Immunostaining results showed that iNSCs can efficiently differentiate into neurons, astrocytes, and oligodendrocytes in vitro. (H) RT-qPCR analysis showing the expression of neural stem markers by iNSCs. Wild-type NSCs were used as a negative control, and iPSCs were used as a positive control. evaluation if their BMS scores were higher than 3 points 1 day after injury. Body weight support and limb coordination ability were assessed by footprint analysis. Briefly, the fore and hind limbs of the mouse were pressed down onto blue and red ink, respectively. After that, animals were allowed to walk on white paper (1 m in length and 7 cm in width) without constraints. The distance between the left and right hindpaws was determined as the base of support. Stride length which assessed limb coordination ability was characterized as the distance between the center pads of the forelimb and hind limb perpendicular. The angle of rotation (AR) was defined as the angle formed by two lines connecting the third toe and the stride line at the center of the hindpaw. The outcomes was determined by the average of five sequential steps.33,34 2.3.4. Histological Analysis. Mice were euthanized by deep anesthetization using 10 g/0.1 mL 0.6% sodium pentobarbital (Merck) at 6 weeks post-SCI. Then they were perfused with 20 mL 0.9% NaCl through the left ventricle and followed by 50 mL 4%

paraformaldehyde. A dissection of spinal cord containing the lesion site was performed, and the tissues were fixed in 4% paraformaldehyde 24 h prior to embedding in paraffin. Ten thickness longitudinal slices were performed using a Leica RM2245 electric slicer. Hematoxylin and eosin (H&E) staining was performed to generally review the cellular and extracellular matrix features. Adjacent tissue sections were stained with Masson’s trichrome, which was used to measure the collagenous tissue deposition within the injury site. 2.3.5. Immunohistochemistry (IHC). For IHC, paraffin-embedded spinal cord tissues were dewaxed and rehydrated, and then, antigens were retrieved by incubating slides in 2% ethylene diamine tetraacetic acid (EDTA) for 5 min at 95 °C and for 1 h at room temperature. After incubation with 6% hydrogen peroxide for 10 min, slides were blocked for 1 h at room temperature in goat serum. Then, the slides were incubated with primary antibody overnight at 4 °C. Secondary horseradish peroxidase (HRP) labeled goat antirabbit IgG polymer (ZSGB-BIO, China) was then added for 60 min at 37 °C. The slides were developed with 3,3′-diaminobenzidine (DAB) for 3 min at room E


Research Article


Figure 4. Viability and proliferation of iNSCs in the GelMA hydrogels. (A1−A3) Live−dead cell analysis of iNSCs using Calcein-AM/PI staining was performed with a fluorescence inversion microscope system 24 h after encapsulation. Hydrogels were stained with calcein-AM to indicate live cells and PI to indicate dead cells. (C1−C6) For the live−dead analysis, the hydrogels were scanned by a confocal microscope to generate z-stacks, which showed the level of retention of iNSCs in the hydrogels. The arrow heads in the insets indicate that the iNSCs still retained their original shape in the medium and stiff hydrogels but exhibited processes extending outward in the soft hydrogel. (D) CCK8 assays were performed to identify the role of the modulus in iNSC proliferation (* and ** indicate p < 0.05 and p < 0.01, respectively, compared with the SCI group, † and †† indicate p < 0.05 and p < 0.01, respectively, compared with the iNSCs group). 2.4. Statistical Analyses. The statistical software SPSS13.0 is used to perform all statistical analyses. All data are presented as means ± standard deviations (SDs). Multiple group comparisons were tested via one-way analysis of variance (ANOVA) with an LSD-t (equal variance assumed), or Bonferroni was performed. A statistically significant difference was admitted at p < 0.05.

temperature and counterstained with Hematoxylin for 1 min. Finally, the samples were dehydrated by ethanol and mounted with coverslips. 2.3.6. Western Blot (WB) Analysis. Forty-five days after surgery, the injured spinal cord of each mouse was extracted using liquid nitrogen. The spinal cord tissues were homogenized in RIPA lysis buffer (CWBIO, China) and extraction buffer including 20 mM Tris-HCl (pH 7.4) and lysed on ice for 1 h. After the sample centrifuged at 12 000g for 30 min, the tissue lysates were obtained from the supernatant. Then a BCA protein assay kit (Thermo Fisher Scientific Inc., Waltham, MA) was used to quantitatively measure. SDS-PAGE protein loading buffer (5X) was added to the samples, and the samples were heated at 100 °C for 10 min. Equal amounts (20 μg) of protein suspension were loaded on 6% (for NF protein) or 8% (for Tuj-1, GFAP, and CD68 protein) polyacrylamide gels. The gel electrophoresis was used to separate proteins and the samples were then transferred onto polyvinylidenefuloride (PVDF) membranes; 5% skimmed milk was added to the PVDF membranes to block for 1 h. Next, the membranes were incubated with the primary antibodies listed in Table 2 at 4 °C overnight. Another day, horseradish peroxidase-conjugated secondary antibody (ZSGB Bio, Beijing, China) was performed to incubate for 2 h. Immunoblots were visualized by using an enhanced chemiluminescence (ECL) kit, and chemiluminescence was detected by a Mini Chemiluminescence Imager. The density of each protein band was calculated using ImageJ software.

3. RESULTS 3.1. Characterization of Hydrogels. As the proton NMR of gelatin showed, the peak appearing at 7.4 ppm confirmed the existence of the aromatic amino acid, and the peaks at 5.5 and 5.7 ppm verified the double bonds of the methacrylate groups (Figure S1). The soft, medium, and stiff hydrogels all possessed a transparent porous structure that provided adequate space for cell adherence and proliferation (Figure 2A1−A3). The average pore sizes of the soft, medium, and stiff hydrogels were 183.5, 141.2, and 86.7 μm, respectively (Figure 2B). The pore size of the hydrogels significantly decreased as the modulus of the hydrogels increased. All three GelMA hydrogels displayed a typical linear elastic behavior region and a nonlinear region at low and higher stress, F


Research Article


Figure 5. Soft GelMA hydrogel promoted neuronal differentiation. (A1−C4) Immunocytochemistry of iNSC neurospheres 7 days after encapsulation in stiff, medium, and soft hydrogels. The arrow heads in the insets indicate the obvious neurite outgrowth in the soft hydrogels. (D and E) Quantification of the percentages of total cells that differentiated into neurons and astrocytes. iNSCs photoencapsulated in the soft hydrogel tended to differentiate into neurons (* and ** indicate p < 0.05 and p < 0.01, respectively).

negative for all the above makers. Teratomas derived from the human iPSCs included neural tissue (ectoderm), cartilage tissue (mesoderm), and glandular tissue (endoderm), showing the ability of the cells to differentiate into the three germ layers (Figure 3C1−C3). According to the fluorescence images and RT-qPCR results, iNSCs derived from iPSCs expressed typical neural progenitor markers, including PAX6 and Nestin, which were absent in iPSCs (Figure 3F1−F3 and H). iNSCs were also able to efficiently differentiate into neurons, astrocytes, and oligodendrocytes in vitro (Figure 3G1−G9), confirming their NSC identity. 3.2.2. Live−Dead Assay and Cell Proliferation Inside the Hydrogels. The fluorescence images indicated that most of the cells were alive in all three hydrogels. The same phenomenon was observed on day 7, at which time nearly no dead cells were detected in all three hydrogels. All samples were nontoxic to the cells and showed very good biocompatibility. In the case of

respectively. As shown in Figure 2C, as the time of UV radiation increased, the stiffness of stress−strain curves increased. Young’s modulus was lowest for the soft hydrogel at 0.68 ± 0.02 kPa and incrementally increased to 1.23 ± 0.11 kPa and 2.03 ± 0.09 kPa for medium and stiff hydrogels, respectively (Figure 2D). The modulus of soft hydrogel was significantly lower than the moduli of medium and stiff hydrogels (p < 0.01). In addition, the GelMA hydrogels were found to stick to nervous tissue, which may provide potential possibility for future in vivo utilization (Figure 2F). 3.2. In Vitro Studies. 3.2.1. Pluripotency of MEF-Derived iPSCs and iNSC Differentiation. The mouse embryonic stem cell (ESC)-like iPSCs were positive for alkaline phosphatase (AP) staining (Figure 3A1−A3). Immunocytochemical analysis of the cells showed that they expressed the representative pluripotency markers SOX2, OCT4, SSEA1, and NANOG (Figure 3B1−B9). The same markers were also detected by RT-qPCR (Figure 3D). Other cell sources, such as MEFs, were G


Research Article


Figure 6. GelMA hydrogel combined with iNSCs promoted functional recovery. (A) Hindlimb locomotion was measured by using the 9-point BMS. Mice treated with GelMA/iNSCs presented significantly higher BMS scores than mice in the SCI and iNSCs groups from two and 3 weeks postinjury onward, respectively (* and ** indicate p < 0.05 and p < 0.01, respectively, compared with the SCI group; † and †† indicate p < 0.05 and p < 0.01, respectively, compared with the iNSCs group). (B) Photos of mouse footprints. The forelimb footprints are shown in blue, and the hindlimb footprints, in red. The black arrow shows the footprints of the fore- and hindpaws almost overlapping, indicating that the mice in the GelMA/iNSCs group exhibited partly restored coordination between the hind- and forepaws. (C−F) Four parameters were used to quantify the recovery of locomotion at 6 weeks after injury (* and ** indicate p < 0.05 and p < 0.01, respectively): (C) base of support; (D) rotation angle; (E) stride length; (F) toe dragging.

the soft GelMA hydrogel, the iNSCs proliferated and formed intercell connections in the hydrogel with a filopodia-rich morphology. However, the iNSCs in the stiff hydrogel showed a rounded shape morphology (Figure 4A1−A3). Figure 4C4− C6 show that the neurospheres were well retained and evenly distributed in all three hydrogels after 7 days of culture. The proliferation of iNSCs in the hydrogels was found significantly increased as the modulus of the hydrogels decreased (Figure 4D). After 3 days of culture, CCK8 assays showed that the cell viability was much higher in the lowest modulus hydrogel than in the other two hydrogels (p < 0.01), although a similar difference was not detected between the medium and stiff hydrogels. Seven days after encapsulation in the hydrogels, the proliferation of encapsulated iNSCs in the soft hydrogel was significantly higher than the proliferation in the stiff and medium hydrogels (p < 0.01). 3.2.3. Effect of Hydrogel Modulus on Cell Differentiation and Axonal Outgrowth. Immunocytochemistry was used to evaluate the differentiation of iNSCs after 3 and 7 days of encapsulation. The levels of Tuj-1, a marker for neuronal differentiation, were considerably lower in the cells cultured in the stiff hydrogel than in the cells grown in the soft and medium hydrogels after 7 days of culture (Figure 5A1−C4). Furthermore, extensive neurite outgrowth could be observed in the soft hydrogel group, and the length of axons even exceeded 200 μm (Figure S2). We also investigated synaptophysin (Syn),

a presynaptic vesicle protein (Figure S3). Compared with the cells encapsulated in the soft hydrogel, iNSCs seeded in the medium or stiff hydrogels showed a significant decrease in synaptophysin immunodensity. The expression of GFAP, a marker for astrocytes, was significantly greater in cells cultured in the stiff and medium hydrogels, especially in the stiff group. In contrast, cells cultured on the soft hydrogel over the same period of culture seldom expresses astrocyte proteins. The imaging results were complemented by an analysis of Tuj-1 and GFAP expression using RT-qPCR at 3 and 7 days of culture in the differentiation medium. Consistent with the immunofluorescence results, the relative expression of Tuj-1 was 7.6-fold and 3.3-fold higher in cells cultured in the soft hydrogel than in those cultured in the stiff and medium hydrogels after 3 days of culture (Figure 5D). Seven days after encapsulation, the percentage of neuronal differentiation in the soft hydrogel group increased by a factor of 15.1 (p < 0.01), while that in the other two groups only increased by factors of 5.1 and 2.8, respectively (Figure 5D). The percentage of neuronal differentiation decreased as the hydrogel modulus increased. In contrast, the percentage of glial differentiation increased as the hydrogel modulus increased. At 7 days, little GFAP was expressed by iNSCs in the soft hydrogel compared with iNSCs cultured in the medium and stiff hydrogels (Figure 5E, p < 0.01). These results clearly demonstrated that culturing iNSCs in soft hydrogels with a modulus below 1 kPa, which H


Research Article


Figure 7. GelMA/iNSCs implants reduced lesion volume and promoted axonal regeneration. (A1−A4) Microsurgical procedures were performed under a microscope. Arrow heads in the insets show that cells directly injected into the transection area spread around the gap, while cells encapsulated in the hydrogel were well retained at the injury site. (B1−B4) H&E staining was used to view the cavities of the injury site in each group at 6 weeks after surgery. (C1−C4). Masson’s trichrome staining of horizontal sections of spinal cords illustrates collagen deposits. Minimal collagen deposits were observed in the GelMA/iNSCs group, and well-aligned nerve fibers could be detected at the injury site. (D1−E4) Immunohistochemical staining showed that neurofilament (NF)-specific nerve fibers migrated to the injury site in the GelMA/iNSCs group and almost connected the rostral and caudal areas, while few NF-positive fibers were detected in the other two groups.

base of support of the mice in the GelMA/iNSCs group was obviously reduced compared with that in the SCI-only group and the iNSCs group (Figure 6C, p < 0.01). The GelMA/ iNSCs group showed a smaller angle of rotation than the iNSCs and SCI groups (Figure 6D, p < 0.01). Mean stride length was also significantly shorter in the GelMA/iNSCs group (Figure 6E), and some hindpaw footprints tended to overlap the forepaw footprints during walking, which indicated that the injured animals partly regained the coordination between the hind- and forepaws. In addition, toe dragging was more severe in the SCI and iNSCs groups than in the GelMA/ iNSCs group (Figure 6F, p < 0.01). The mice treated with the GelMA hydrogel combined with iNSC showed coordinated crawling even with the ability to raise their tails, whereas mice in the SCI group still dragged their hindlimbs. 3.3.2. Combined Treatment Reduced the Lesion Volume and Collagen Deposits. Functional recovery may result in the change of organizational structure and pathophysiology. General views of the mouse spinal cords 6 weeks after operation in the four groups are shown in Figure S4. After 6 weeks postsurgery, H&E staining revealed large lesion volumes and disordered structures in the SCI group. In contrast, in the GelMA/iNSCs group, no obvious cavity was detected, and the regenerated organization showed a linear ordered structure (Figure 7B1−B4). Therefore, transplantation of the GelMA scaffolds combined with iNSCs clearly promoted spinal tissue regeneration and reduced the volume of the cavity.

matches the modulus of brain tissue, can enhance neuronal differentiation, and inhibit astrocyte proliferation. 3.3. In Vivo Testing. 3.3.1. Functional Recovery and Footprint Analysis in SCI Model Mice. All animals exhibited normal locomotor behavior prior to injury (Basso mouse scale [BMS] score of 9), with a significant drop after spinal cord transection, as the animals exhibited complete paralysis of the hindlimbs. Little locomotor recovery was observed in all three groups during the first week. The mice treated with GelMA/ iNSCs presented higher BMS scores than mice in the SCI-only group from 2 weeks postinjury onward (p < 0.01), whereas the mice in the iNSCs group presented higher BMS scores from 3 weeks onward (p < 0.01) up to 6 weeks postoperation, i.e., the last time point evaluated (Figure 6A). Indeed, at 6 weeks postoperation, most SCI-only mice still exhibited complete flaccid paralysis of the hindlimbs (BMS score = 0) or were only able to extensively move the ankle joint (BMS score = 2). Moreover, at the same time postoperation, mice treated with iNSCs still did not exhibit permanent weight support (BMS score = 4). In contrast, most GelMA/iNSCs-transplanted mice exhibited permanent recovery of weight support, and some were even able to tilt their tails (BMS score = 7) (Video S1). The footprint analysis of the hindlimbs is summarized in Figure 6B. At 6 weeks after SCI, the base of support, stride length, angle of rotation, and toe dragging of mice in the sham group were all minimal and showed the same interlimb coordination as normal mice. (Figure 6C−F). At 6 weeks, the I


Research Article


in the GelMA/iNSCs group compared with the iNSCs and SCI groups. In addition, at the rostral and caudal regions, the GelMA/iNSCs transplantation group exhibited fewer CD68positive macrophages/microglia than the SCI and iNSCs groups, and this result was verified by WB analysis (Figure 8D). Furthermore, the expression of CD68 was higher in the iNSCs group than in the SCI group, although the WB results did not reveal a significant difference (Figure 8E). Thus, the implantation of GelMA combined with iNSCs may have beneficial effects on the inflammatory reaction following SCI. 3.3.4. Combined Treatment Promoted Nerve Fiber Regeneration and Inhibited Reactive Astrogliosis in Vivo. Nerve fiber growth and reactive astrocyte differentiation was confirmed by immunofluorescence staining and WB. Although Tuj-1-positive neurons were observed in the lesion site in all three groups, and the density of neuron signal in the transection area of mice in the GelMA/iNSCs treatment group was highest among all groups (Figure 9A2, B2, C2). Meanwhile, newborn NF-positive neurofilaments were distributed through the graft site of the spinal cords of mice in the GelMA/iNSCs groups at 42 days after hydrogel transplantation. In addition, after operation, significantly fewer NF-positive neurons were observed in the mice of the SCI and iNSCs groups, and NF-positive cells were nearly indistinguishable in the SCI-only group (p < 0.01 Figure 10). The staining density of GFAP, which is a marker of reactive astrogliosis, was assessed 6 weeks after SCI. SCI alone or SCI treated with iNSCs only corresponded to a nonsignificant trend in reducing the GFAP astroglial scar, in which more hypertrophic GFAP-positive astrocytes were observed, while the combined transplantation of GelMA hydrogel and iNSCs resulted in a significant reduction in reactive astrogliosis (Figure 9A3, B3, C3). In the SCI and iNSCs groups, the largest number of GFAP-positive cells was captured in the perilesional area of the lesion site, especially in the SCI-only group (Figure 9A5, B5). The immunofluorescence staining results were further confirmed by the results of the WB analysis (Figures 9D and 10D). The expression levels of differentiation marker proteins, including Tuj-1, NF, and GFAP, significantly differed among groups (p < 0.01). Tuj-1 expression in the GelMA/iNSCs group was significantly higher than that in the SCI and iNSCs groups (p < 0.01), while the expression of Tuj-1 in the SCI group was lowest (p < 0.01). NF expression was also significantly up-regulated in the GelMA/iNSCs group (p < 0.01). In contrast, GFAP expression was slightly downregulated in the GelMA/iNSCs group (p < 0.01) but was not statistically significant different between the iNSCs group and the SCI group (p = 0.202). Thus, the low-modulus GelMA hydrogel was capable of both promoting neuronal differentiation and preventing astrocytic hyperplasia of iNSCs in vitro and in vivo.

Figure 8. GelMA/iNSCs transplantation was more effective in reducing inflammation. (A1−C3) CD68 staining for reactive microglia/macrophages 6 weeks after SCI. Many more CD68-positive cells were detected in the rostral, injury/graft, and caudal sites of the spinal cord in the SCI and iNSCs groups than in the GelMA/iNSCs group. (D) Western blot analysis showing the protein expression levels of CD68 in each group. GAPDH protein was used as a loading control. (E) Quantification of CD68 protein expression in the three groups (* and ** indicate p < 0.05 and p < 0.01, respectively).

According to Masson staining, minimal collagen deposits stained in blue were discovered in the GelMA/iNSCs group; in contrast, a much greater density of collagen deposits were observed in the SCI and iNSCs groups (Figure 7C1−C4). This finding indicated that GelMA/iNSCs markedly reduced the collagen deposits and provided a suitable microenvironment for axonal regeneration. The IHC results were consistent with Masson staining, which showed that ordered neurofilament (NF) specific nerve fibers migrated to the injury site in the GelMA/iNSCs group and almost connected the rostral and caudal areas, while few NFpositive fibers were detected in the other two groups (Figure 7D1−E4). 3.3.3. GelMA Implantation was Effective in Modulating Inflammation. Inflammatory reactions commonly result in secondary injury cascades after SCI. To assess inflammation 6 weeks after spinal cord transection, CD68-positive macrophages/microglia were assessed (Figure 8). The results of immunofluorescence staining showed that the total number of CD68-reactive cells was significantly reduced at the lesion site

4. DISCUSSION In our study, an iNSC-encapsulated 3D hydrogel system was fabricated based on a photo-cross-linkable GelMA hydrogel scaffold, which has been shown to play a important role in cytokine secretion, cell proliferation, and matrix deposition.35 3D cell culture systems which can improve initial cell populations are important for cell−cell signaling transduction, which may affect stem cell differentiation and proliferation.11,36 Cells cultured on a plate surface (a 2D culture system) may exhibit cell morphology, gene and protein expression, and J


Research Article


Figure 9. GelMA/iNSCs treatment promoting neuronal differentiation and inhibited astrocytic formation in vivo. (A1−C5) Immunofluorescent staining of Tuj-1 (green) and GFAP (red) at the lesion site. The largest number of GFAP-positive astrocytes was observed in the perilesional area of the injury site in the SCI and iNSCs groups, while Tuj-1-positive cells were more hypertrophic in the GelMA/iNSCs group. (A5, B5, C5) Increased magnification of the boxed areas shows a similar phenomenon. (D) Protein expression levels of Tuj-1 and GFAP in each group measured by Western blot analysis. GAPDH protein was used as a loading control. (E) Quantification of Tuj-1 protein expression in the SCI, iNSCs, and GelMA/iNSCs groups (* and ** indicate p < 0.05 and p < 0.01, respectively). (F) Quantification of GFAP protein expression in the three groups (* and ** indicate p < 0.05 and p < 0.01, respectively).

remains unclear. In our study, nearly no dead cells were found during the first 24 h or 7 days after encapsulation in any of the three hydrogel systems. 3D images acquired by confocal microscopy revealed that the GelMA hydrogels allowed free spreading of iNSCs and provided a permanent 3D microenvironment for cell−cell communication. By quantitatively measuring cell proliferation during culture in the GelMA hydrogels with three different moduli, we found that the value of the CCK8 assay was significantly higher in the soft hydrogel than in the medium and stiff hydrogels. For cell differentiation, the relative gene expression, including the expression of Tuj-1 and GFAP, was determined after 3 and 7 days of culture. The percentage of Tuj-1 in the soft group increased by factors of 3.3 (p < 0.01) and 7.6 (p < 0.01) compared with the medium and stiff groups, respectively, at 3 days after encapsulation. By day 7, the differences had become even more obvious. Although GFAP expression showed no significant difference among these three groups at 3 days, by 7 days, GFAP expression had decreased by factors of 2.5 (p < 0.05) and 2.6 (p < 0.05) in the stiff and medium hydrogels, respectively, compared with the soft hydrogel. GFAP-positive astrocytes are a type of reactive astrocyte present after injury.16 Therefore, inhibition of

nutrient and oxygen exchange that highly differ from the 3D microenvironment of living tissues.37,38 Gelatin is a degradation product of collagen, which is the major component of ECM. Due to its biocompatibility and degradability properties and its relatively low antigenicity, gelatin is much less expensive than collagen and has been identified as one of the most suitable materials for hydrogel scaffolds for 3D cell culture. In this study, GelMA hydrogels were cross-linked by visible light.22 Within tens of seconds of UV exposure, methacrylated gelatin can be cross-linked to form scaffolds, which guarantees good biocompatibility and a regulatable mechanical modulus. Meanwhile, desirable mechanical properties can be obtained by simply modifying the concentration of gelatin or making subtle changes to the UV exposure time.24 The mechanical properties of the hydrogels are the main factors affecting cell survival, neuronal differentiation, and axon formation.17,39 Several recent studies have attempted to alternate the viscoelasticity of materials to affect the neuronal differentiation of NSCs and MSCs.17,35 However, whether the mechanical properties of GelMA hydrogels also have a profound influence on the survival and differentiation of iPSC-derived NSCs and on in vivo neuroregeneration therapy has been rarely studied and K


Research Article


Although the same cellular densities were used in both cases for implantation with or without the vehicle, the cells were more effective when transplanted in the 3D soft hydrogel. Therefore, 3D cell capsulation is an attractive strategy to expand a therapeutically relevant number of stem cells. Inflammation is a critical mediator in secondary damage after SCI. Large numbers of activated macrophages/microglia, which can be stained with the pan-macrophage/monocyte marker CD68, migrated into the lesion site and induced several inflammatory factors that accelerate cell apoptosis and hinder axonal regeneration.41 Compared with the SCI and iNSCs groups, the GelMA hydrogel significantly suppressed CD68+ microglia, suggesting the potential therapeutic mechanisms of GelMA transplantation. This result is mainly due to the fact that the natural gelatin material, which is a degradation product of collagen, produced relatively low antigenicity. Simultaneously, iNSCs encapsulated and limited by the 3D GelMA hydrogels offered advantages of scaffold-based therapy over direct cell transfer. The 3D hydrogel system reduced the number of dead or dying cells caused by ischemia and the adverse environment at the injured site, which is important because this environment can lead to a “waterfall effect” of uncontrollable inflammation. iNSCs embedded in the GelMA hydrogel were effective in promoting neural regeneration and subsequently promoting functional recovery post-SCI. Exogenous cellular transplantation contributes to enhanced axonal regeneration and improved functional recovery, mainly because the scaffold provides a new regenerative site for nerve fibers.3 In addition, the GelMA hydrogel can adhere to the mouse spinal cord and connect the rostral and caudal areas to support rebuilding the spinal cord structure. In our study, although extensive axonal outgrowth stained by Tuj-1 and NF could be seen in the injury site in all three groups, more newborn nerve fibers were found to extend into the lesion site in the GelMA/iNSCs group. In addition, we found that the GelMA/iNSCs treatment resulted in a significant decrease in the astroglial scar at the injury site both in the rostral and caudal directions; however, scar formation was obvious in the SCI and iNSCs groups. This mixed tissue engineering scaffold can minimize the deleterious effects of inflammation at the early stage and promote more nerve fiber regeneration in the injury/graft site. These mechanisms may explain why the mice in the GelMA/iNSCs group could walk with normal strength, while mice the iNSCs and SCI groups still exhibited an ataxic gait.

Figure 10. GelMA hydrogel scaffolds promoted mature neuron formation. (A1−C3) Representative confocal images of immunostaining for NF protein in longitudinal spinal cord sections. (D) Western blot analysis showing NF protein bands in the three groups. GAPDH protein was used as a loading control. (E) Quantification of NF protein expression in the three groups (* and ** indicate p < 0.05 and p < 0.01, respectively).

astrocytic differentiation is believed to play a major role in prevention of the glial scar formation, a main barrier to inhibit axonal regeneration following SCI.40 The RT-qPCR results were complemented by an immunofluorescence analysis, which revealed consistent results. In addition, the length of synapses in the soft hydrogel even reached 250 μm (Figure S2.). Mechanotransduction was defined as one of the most possible mechanisms for the ability of the material modulus to determine stem cell fate. Hydrogel scaffolds are quite different from traditional solid porous scaffolds, which have Young’s moduli that highly matched with CNS tissue (0.1−16 kPa) can better imitate real tissue for use in disease models. Our results indicate that culture in GelMA 3D hydrogels, especially soft hydrogels with mechanical properties comparable to those of native CNS tissue, provided a more suitable environment for survival and neuronal differentiation. All these excellent features make GelMA a promising scaffold for use in nerve tissue regeneration. In our study, a low-modulus 3D GelMA hydrogel was used as a vehicle for iNSC delivery via neural tissue engineering. A most severe complete mouse spinal cord transection model was utilized in this research to evaluate the GelM/iNSCs treatment effect on functional recovery. Six hours after iNSC neurospheres were photoencapsulated in the GelMA hydrogel, the soft hydrogel was transplanted into the SCI site in mice. Cells that were encapsulated in the hydrogel were well retained at the injury site, while a large number of cells that were directly injected into the transection area spread around the gap.

5. CONCLUSION Hydrogel scaffolds can recreate a favorable 3D microenvironment that mimics the human CNS for culturing iNSCs. The hydrogel scaffolds developed here showed potential for use as model systems to mechanistically investigate iNSC proliferation and differentiation. The findings ultimately showed that lowmodulus hydrogels with similar moduli to those of native CNS tissue can promote cell proliferation and neural differentiation in vitro. The in vivo results demonstrated that the combination therapy exhibited the greatest advantage for decreasing inflammation and cavity formation, facilitating axonal and neuronal regeneration, inhibiting glial scar hyperplasia, and enhancing locomotor recovery. Therefore, the implantation of iNSC-loaded 3D GelMA hydrogels into the injury site could undoubtedly play an important role in SCI repair. L


Research Article


■

(9) Broguiere, N.; Isenmann, L.; Zenobi-Wong, M. Novel enzymatically cross-linked hyaluronan hydrogels support the formation of 3D neuronal networks. Biomaterials 2016, 99, 47−55. (10) Wang, L. S.; Chung, J. E.; Chan, P. P.; Kurisawa, M. Injectable biodegradable hydrogels with tunable mechanical properties for the stimulation of neurogenesic differentiation of human mesenchymal stem cells in 3D culture. Biomaterials 2010, 31, 1148−1157. (11) Patel, M.; Lee, H. J.; Park, S.; Kim, Y.; Jeong, B. Injectable thermogel for 3D culture of stem cells. Biomaterials 2018, 159, 91− 107. (12) Ravi, M.; Paramesh, V.; Kaviya, S. R.; Anuradha, E.; Solomon, F. D. P. 3D Cell Culture Systems: Advantages and Applications. J. Cell. Physiol. 2015, 230, 16−26. (13) Murphy, A. R.; Laslett, A.; O’Brien, C. M.; Cameron, N. R. Scaffolds for 3D in vitro culture of neural lineage cells. Acta Biomater. 2017, 54, 1−20. (14) Diaz, L. A.; Curras, D.; Mousa, J.; Hengsbach, S.; Lantada, A. D. Tissue Engineering Scaffolds for 3D Cell Culture. Microsystems for Enhanced Control of Cell Behavior: Fundamentals, Design and Manufacturing Strategies, Applications and Challenges 2016, 18, 249− 268. (15) Huebsch, N.; Lippens, E.; Lee, K.; Mehta, M.; Koshy, S. T.; Darnell, M. C.; Desai, R. M.; Madl, C. M.; Xu, M.; Zhao, X.; Chaudhuri, O.; Verbeke, C.; Kim, W. S.; Alim, K.; Mammoto, A.; Ingber, D. E.; Duda, G. N.; Mooney, D. J. Matrix elasticity of voidforming hydrogels controls transplanted-stem-cell-mediated bone formation. Nat. Mater. 2015, 14, 1269−1277. (16) Seidlits, S. K.; Khaing, Z. Z.; Petersen, R. R.; Nickels, J. D.; Vanscoy, J. E.; Shear, J. B.; Schmidt, C. E. The effects of hyaluronic acid hydrogels with tunable mechanical properties on neural progenitor cell differentiation. Biomaterials 2010, 31, 3930−3940. (17) Tseng, T. C.; Tao, L.; Hsieh, F. Y.; Wei, Y.; Chiu, I. M.; Hsu, S. H. An Injectable, Self-Healing Hydrogel to Repair the Central Nervous System. Adv. Mater. (Weinheim, Ger.) 2015, 27, 3518−3524. (18) Banerjee, A.; Arha, M.; Choudhary, S.; Ashton, R. S.; Bhatia, S. R.; Schaffer, D. V.; Kane, R. S. The influence of hydrogel modulus on the proliferation and differentiation of encapsulated neural stem cells. Biomaterials 2009, 30, 4695−4699. (19) Zhang, Z. N.; Freitas, B. C.; Qian, H.; Lux, J.; Acab, A.; Trujillo, C. A.; Herai, R. H.; Nguyen, H. V.; Wen, J. H.; Joshi-Barr, S.; Karpiak, J. V.; Engler, A. J.; Fu, X. D.; Muotri, A. R.; Almutairi, A. Layered hydrogels accelerate iPSC-derived neuronal maturation and reveal migration defects caused by MeCP2 dysfunction. Proc. Natl. Acad. Sci. U. S. A. 2016, 113, 3185−3190. (20) Tam, R. Y.; Cooke, M. J.; Shoichet, M. S. A covalently modified hydrogel blend of hyaluronan-methyl cellulose with peptides and growth factors influences neural stem/progenitor cell fate. J. Mater. Chem. 2012, 22, 19402−19411. (21) Zhao, X.; Sun, X.; Yildirimer, L.; Lang, Q.; Lin, Z. Y.; Zheng, R.; Zhang, Y.; Cui, W.; Annabi, N.; Khademhosseini, A. Cell infiltrative hydrogel fibrous scaffolds for accelerated wound healing. Acta Biomater. 2017, 49, 66−77. (22) Noshadi, I.; Hong, S.; Sullivan, K. E.; Sani, E. S.; Portillo-Lara, R.; Tamayol, A.; Shin, S. R.; Gao, A. E.; Stoppel, W. L.; Black, L. D.; Khademhosseini, A.; Annabi, N. In vitro and in vivo analysis of visible light crosslinkable gelatin methacryloyl (GelMA) hydrogels. Biomater. Sci. 2017, 5, 2093−2105. (23) Xin, T.; Gu, Y.; Cheng, R.; Tang, J.; Sun, Z.; Cui, W.; Chen, L. Inorganic Strengthened Hydrogel Membrane as Regenerative Periosteum. ACS Appl. Mater. Interfaces 2017, 9, 41168−41180. (24) Liu, C.; Zhou, Y.; Sun, M.; Li, Q.; Dong, L.; Ma, L.; Cheng, K.; Weng, W.; Yu, M.; Wang, H. Light-induced cell alignment and harvest for anisotropic cell sheet technology. ACS Appl. Mater. Interfaces 2017, 9, 36513−36524. (25) Zhang, X.; Li, J.; Ye, P.; Gao, G.; Hubbell, K.; Cui, X. Coculture of mesenchymal stem cells and endothelial cells enhances host tissue integration and epidermis maturation through AKT activation in gelatin methacryloyl hydrogel-based skin model. Acta Biomater. 2017, 59, 317−326.

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsami.8b05293. NMR characterization of methacrylated gelatin; Neurite outgrowth and immunofluorescent staining of neural protein of iNSC neurospheres encapsulated in there hydrogels of variable stiffness; General views of the mouse spinal cords in the four groups 6 weeks after operation (PDF) Video S1 showing hindlimb motor functions of mice in three groups in the BMS test at 6 weeks (AVI)

■

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected] (L.Z.). *E-mail: [email protected] (C.N.). *E-mail: [email protected] (Q.W.). ORCID

Qiyou Wang: 0000-0001-8817-5291 Author Contributions #

L.F., C.L., and X.C. contributed equally to this work and should be considered as cofirst authors. Notes

The authors declare no competing financial interest.

■ ■

ACKNOWLEDGMENTS This research was supported by National Natural Science Foundation of China (Grant Nos. 51772106, 31771080). REFERENCES

(1) Assuncao-Silva, R. C.; Gomes, E. D.; Sousa, N.; Silva, N. A.; Salgado, A. J. Hydrogels and Cell Based Therapies in Spinal Cord Injury Regeneration. Stem Cells Int. 2015, 2015, 948040−948063. (2) Austin, J. W.; Kang, C. E.; Baumann, M. D.; DiDiodato, L.; Satkunendrarajah, K.; Wilson, J. R.; Stanisz, G. J.; Shoichet, M. S.; Fehlings, M. G. The effects of intrathecal injection of a hyaluronanbased hydrogel on inflammation, scarring and neurobehavioural outcomes in a rat model of severe spinal cord injury associated with arachnoiditis. Biomaterials 2012, 33, 4555−4564. (3) Li, G.; Che, M.; Zhang, K.; Qin, L.; Zhang, Y.; Chen, R.; Rong, L.; Liu, S.; Ding, Y.; Shen, H.; Long, S.; Wu, J.; Ling, E.; Zeng, Y. Graft of the NT-3 persistent delivery gelatin sponge scaffold promotes axon regeneration, attenuates inflammation, and induces cell migration in rat and canine with spinal cord injury. Biomaterials 2016, 83, 233−248. (4) Goulao, M.; Lepore, A. C. iPS Cell Transplantation for Traumatic Spinal Cord Injury. Curr. Stem Cell Res. Ther. 2016, 11, 321−328. (5) Takahashi, K.; Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 2006, 126, 663−676. (6) Nagoshi, N.; Okano, H. iPSC-derived neural precursor cells: potential for cell transplantation therapy in spinal cord injury. Cell. Mol. Life Sci. 2018, 75, 989−1000. (7) Lim, T. C.; Toh, W. S.; Wang, L. S.; Kurisawa, M.; Spector, M. The effect of injectable gelatin-hydroxyphenylpropionic acid hydrogel matrices on the proliferation, migration, differentiation and oxidative stress resistance of adult neural stem cells. Biomaterials 2012, 33, 3446−3455. (8) Fuhrmann, T.; Tam, R. Y.; Ballarin, B.; Coles, B.; Elliott, D. I.; van der Kooy, D.; Nagy, A.; Tator, C. H.; Morshead, C. M.; Shoichet, M. S. Injectable hydrogel promotes early survival of induced pluripotent stem cell-derived oligodendrocytes and attenuates longterm teratoma formation in a spinal cord injury model. Biomaterials 2016, 83, 23−36. M


Research Article

ACS Applied Materials & Interfaces (26) Nichol, J. W.; Koshy, S. T.; Bae, H.; Hwang, C. M.; Yamanlar, S.; Khademhosseini, A. Cell-laden microengineered gelatin methacrylate hydrogels. Biomaterials 2010, 31, 5536−5544. (27) Wang, H.; Zhou, L.; Liao, J.; Tan, Y.; Ouyang, K.; Ning, C.; Ni, G.; Tan, G. Cell-laden photocrosslinked GelMA-DexMA copolymer hydrogels with tunable mechanical properties for tissue engineering. J. Mater. Sci.: Mater. Med. 2014, 25, 2173−2183. (28) Wang, L. F.; Shen, S. S.; Lu, S. C. Synthesis and characterization of chondroitin sulfate-methacrylate hydrogels. Carbohydr. Polym. 2003, 52, 389−396. (29) Murai, K.; Sun, G.; Ye, P.; Tian, E.; Yang, S.; Cui, Q.; Sun, G.; Trinh, D.; Sun, O.; Hong, T.; Wen, Z.; Kalkum, M.; Riggs, A. D.; Song, H.; Ming, G.; Shi, Y. The TLX-miR-219 cascade regulates neural stem cell proliferation in neurodevelopment and schizophrenia iPSC model. Nat. Commun. 2016, 7, 10965−10980. (30) Wada, N.; Shimizu, T.; Takai, S.; Shimizu, N.; Kanai, A. J.; Tyagi, P.; Kakizaki, H.; Yoshimura, N. Post-injury bladder management strategy influences lower urinary tract dysfunction in the mouse model of spinal cord injury. Neurourol. Urodyn. 2017, 36, 1301−1305. (31) Maggio, D. M.; Singh, A.; Iorgulescu, J. B.; Bleicher, D. H.; Ghosh, M.; Lopez, M. M.; Tuesta, L. M.; Flora, G.; Dietrich, W. D.; Pearse, D. D. Identifying the Long-Term Role of Inducible Nitric Oxide Synthase after Contusive Spinal Cord Injury Using a Transgenic Mouse Model. Int. J. Mol. Sci. 2017, 18, 245−260. (32) Basso, D. M.; Fisher, L. C.; Anderson, A. J.; Jakeman, L. B.; McTigue, D. M.; Popovich, P. G. Basso mouse scale for locomotion detects differences in recovery after spinal cord in ury in five common mouse strains. Journal of Neurotrauma 2006, 23, 635−659. (33) Tian, T.; Yu, Z.; Zhang, N.; Chang, Y.; Zhang, Y.; Zhang, L.; Zhou, S.; Zhang, C.; Feng, G.; Huang, F. Modified acellular nervedelivering PMSCs improve functional recovery in rats after complete spinal cord transection. Biomater. Sci. 2017, 5, 2480−2492. (34) Hong, L. T. A.; Kim, Y. M.; Park, H. H.; Hwang, D. H.; Cui, Y.; Lee, E. M.; Yahn, S.; Lee, J. K.; Song, S. C.; Kim, B. G. An injectable hydrogel enhances tissue repair after spinal cord injury by promoting extracellular matrix remodeling. Nat. Commun. 2017, 8, 533−547. (35) Leipzig, N. D.; Shoichet, M. S. The effect of substrate stiffness on adult neural stem cell behavior. Biomaterials 2009, 30, 6867−6878. (36) Chua, I. L. S.; Kim, H. W.; Lee, J. H. Signaling of extracellular matrices for tissue regeneration and therapeutics. Tissue Eng. Regener. Med. 2016, 13, 1−12. (37) Crowder, S. W.; Leonardo, V.; Whittaker, T.; Papathanasiou, P.; Stevens, M. M. Material Cues as Potent Regulators of Epigenetics and Stem Cell Function. Cell Stem Cell. 2016, 18, 39−52. (38) Liow, S. S.; Dou, Q.; Kai, D.; Karim, A. A.; Zhang, K.; Xu, F.; Loh, X. J. Thermogels: In Situ Gelling Biomaterial. ACS Biomater. Sci. Eng. 2016, 2, 295−316. (39) Pek, Y. S.; Wan, A. C. A.; Ying, J. Y. The effect of matrix stiffness on mesenchymal stem cell differentiation in a 3D thixotropic gel. Biomaterials 2010, 31, 385−391. (40) Silva, G. A.; Czeisler, C.; Niece, K. L.; Beniash, E.; Harrington, D. A.; Kessler, J. A.; Stupp, S. I. Selective differentiation of neural progenitor cells by high-epitope density nanofibers. Science 2004, 303, 1352−1355. (41) Wang, Z.; Nong, J.; Shultz, R. B.; Zhang, Z.; Kim, T.; Tom, V. J.; Ponnappan, R. K.; Zhong, Y. Local delivery of minocycline from metal ion-assisted self-assembled complexes promotes neuroprotection and functional recovery after spinal cord injury. Biomaterials 2017, 112, 62−71.

N


Directing Induced Pluripotent Stem Cell Derived Neural Stem Cell

Recommend Documents