Discovery and Structural Characterization of G ... - ACS Publications

Subscriber access provided by TULANE UNIVERSITY

Article

Discovery and Structural Characterization of G-quadruplex DNA in Human Acetyl-CoA Carboxylase Gene Promoters: Its Role in Transcriptional Regulation and as a Therapeutic Target for Human Disease Mangesh Kaulage, Basudeb Maji, Jyotsna Bhat, Yasumasa Iwasaki, Subhrangsu Chatterjee, Santanu Bhattacharya, and K Muniyappa J. Med. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.jmedchem.6b00453 • Publication Date (Web): 08 Apr 2016 Downloaded from http://pubs.acs.org on April 12, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Journal of Medicinal Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Medicinal Chemistry

Discovery and Structural Characterization of G-quadruplex DNA in Human Acetyl-CoA Carboxylase Gene Promoters: Its Role in Transcriptional Regulation and as a Therapeutic Target for Human Disease Mangesh Kaulage,1,2 Basudeb Maji,2 Jyotsna Bhat,3 Yasumasa Iwasaki,4 Subhrangsu Chatterjee,3 Santanu Bhattacharya2 and Kalappa Muniyappa1*

1

2

Department of Biochemistry, Indian Institute of Science, Bangalore 560012, India

Department of Organic Chemistry, Indian Institute of Science, Bangalore 560012, India 3

4

Department of Biophysics, Bose Institute, Kolkata-700054, India

Department of Endocrinology, Metabolism, and Nephrology, Kochi Medical School, Kochi University, Nankoku, Japan

1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 59

ABSTRACT Accumulating evidences suggest that G-quadruplexes play vital roles in gene expression, DNA replication and recombination. Three distinct promoters (PI, PII and PIII) regulate human Acetyl-CoA Carboxylase 1 (ACC1) gene expression. In this study, we asked whether the G-rich sequences within the human ACC1 (PI and PII) promoters can form G-quadruplex structures and regulate normal DNA transactions. Using multiple complementary methods, we show that G-rich sequences of PI and PII promoters form intramolecular G-quadruplex structures, and then establish unambiguously the topologies of these structures. Importantly, G-quadruplex formation in ACC1 gene promoter region blocks DNA replication, suppresses transcription, and this effect was further augmented by G-quadruplex stabilizing ligands. Altogether, these results are consistent with the notion that G-quadruplex structures exist within the human ACC1 gene promoter region, whose activity can be suppressed by G-quadruplex stabilizing ligands, thereby reveal a novel regulatory mechanism of ACC1 gene expression and as a possible therapeutic target.

KEY WORDS: Acetyl-CoA carboxylase, gene promoter, G-quadruplex structures, Gquadruplex stabilizing ligands, gene expression.


Page 3 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION In most organisms, Acetyl-CoA Carboxylase (ACC) is the rate-limiting enzyme in long chain fatty acid biosynthesis, which catalyzes the ATP-dependent carboxylation of acetyl-CoA to generate malonyl-CoA.1-3 Animals, including humans, possess two structurally distinct isoforms of ACC: ACC1 (265 kDa) and ACC2 (280 kDa) (also referred to as ACCα and ACCβ, respectively) are encoded by separate genes, play key roles in fatty acid biosynthesis and fatty acid oxidation,3-5 and display distinct tissue distribution and regulation.3-9 Although both ACC1 and ACC2 catalyze the biosynthesis of malonyl-CoA, they play distinct roles in various cellular compartments.3 Unlike ACC2, ACC1 lacks the mitochondria targeting sequence and, consequently, is localized within the cytoplasm.10 These enzymes are highly enriched in lipogenic tissues such as liver, lactating mammary gland, adipose, and their catalytic activities are controlled by a multitude of cellular and nutritional signals: covalent modification by phosphorylation/dephosphorylation, allosteric activation by citrate and palmitoyl- CoA, and feedback inhibition by long-chain fatty acids.11-19 In addition, dietary and hormonal states of the animal affect the level and activities of the ACC1 enzymes.14,17,18 ACC2, located predominantly in mitochondria, is highly expressed in tissues such as skeletal muscle and heart.10 The vital roles that these enzymes play and their impaired function in obesity, Type 2 diabetes and other clinical manifestations has generated significant pharmaceutical interest in them.1-3 Indeed, several lines of evidence strongly support the view that ACCs can serve as targets for drug discovery and development for human diseases, including microbial infections, diabetes, obesity and cancers.1-3,20-24 Further, ACC1 is thought to be important for glucose homeostasis, and is regulated systemically at the cellular level by energy charges.11-13 Accumulating evidences also suggest that activation of fatty acid synthesis is required for



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 59

carcinogenesis as deregulation of lipid metabolism starts in the early stages of oncogenesis.25,26 The expression and activity of ACC1 has shown to be up-regulated in multiple human cancers such as breast, prostate and liver,27,28 rendering ACC1 as a potential target for cancer intervention and diseases that result from the rapid growth of malignant cells. Several lines of evidence suggest the existence of GC-rich sequences, which are preferentially localized to promoter regions, can fold into G-quadruplex structures in both mitochondrial and nuclear genomes of many organisms including humans. The human ACC1 gene expression is regulated by three promoters (PI, PII and PIII).28,29 Promoter PI is constitutively and highly expressed unlike that of other mammalian species. The sequence of human PII promoter has similarities with those of its counterparts in rat, bovine, and ovine, and also functions as a major regulator of ACC1 transcription.3,29 Interestingly, ACC1 PI and PII promoters lack the typical TATA and CAAT boxes, and possess multiple copies of G-box elements (GGGCGGG/GGGGCGGGG) (Fig. 1).28,29 Previous investigations in a number of biological systems have shown that G-rich sequences fold into G-quadruplex motifs.30-34 Studies have also shown that G-quadruplex structures affect genome stability, regulate promoter activity, RNA splicing, RNA translation, DNA replication and mRNA localization.35-42 Furthermore, Gquadruplex motifs embedded in the core promoter regions regulate the expression of oncogenes such as human c-MYC 43, c-KIT 44 and k-RAS 45, as well as cellular genes such as VEGF, PDGF, HIF1α, BCL-2, RB, RET, HRAS 31,46,47, C9orf7248 and hTERT.49,50 In several studies, specific Gquadruplex binding proteins have been identified and the mechanism underlying their role is emerging, indicating that G4 DNA-mediated transcriptional regulation is likely to be a general feature among genes bearing GC-rich upstream promoter elements.30-34 To date, however, it is unknown whether the G-rich sequences in ACC1 promoters can form stable G-quadruplex


Page 5 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


structures and contribute to the regulation of ACC1 gene expression. Since ACC1 is the rate limiting enzyme and its main active promoters, PI and PII are regulated we believe that it is important to understand the role of G-rich sequences in the regulation of its expression. To address these questions, we asked whether the G-rich sequences from the ACC1 promoters fold into G-quadruplex structures. Using multiple complementary methods, we show that these sequences fold into four-stranded intramolecular G-quadruplex DNA structures under physiologically relevant conditions. Using biochemical, biophysical methods and molecular dynamics simulation, we provide detailed and unambiguous data for the structure and topology of the ACC1 G-quadruplex DNA. Notably, we demonstrate that G-quadruplex structure interacts with G4 DNA specific protein and functions as a transcriptional repressor element in vivo. In summary, our findings reveal that ACC1 transcription in human cells is regulated by G4 DNA and that G-quadruplex stabilizing ligands suppress its transcription, thus reveal a novel regulatory mechanism of ACC1 gene expression. The mechanism derived is supported by sitedirected mutagenesis and it is discussed in the context of ACC1 as a therapeutic target for human disease. RESULTS AND DISCUSSION G-rich sequences from ACC1 PI and PII promoters fold into intramolecular G-quadruplex structures Traditionally, CD spectroscopy has been used to identify the existence of G-quadruplex motifs in guanine-rich DNA/RNA sequences and characterize the modes of guanine stacking in different G4 topologies. In general, the parallel and antiparallel G-quadruplexes display dramatically different CD spectroscopic signatures due to differences in their glycosidic bond (syn or anti) torsion angles: parallel G-quadruplex structures exhibit positive and negative peaks



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 59

at 260 nm and 240 nm respectively, whereas anti-parallel G-quadruplexes display positive and negative peaks at 295 nm and 260 nm. We first evaluated the potential of G-rich sequences from ACC1 PI and PII promoters to fold into G-quadruplex structure(s) in a buffer containing nearphysiological concentrations of K+ ions. Both these 25-mer oligonucleotides (ODN) contain 3-5 G-tracts: G-tracts in the PI sequence contain five arrays of three guanines, whereas G-tracts in the PII sequence contain two arrays of four guanines and one each of three and five guanines; the linkers between G-tracts differ in both length and sequence. For comparison, we analyzed the CD spectra of mutant forms of the corresponding wild-type sequences (Fig. 2A). The CD measurements were carried out in a buffer solution containing 5 µM ODN, 10 mM Tris-HCl (pH 7.4), 0.1 mM EDTA and 120 mM KCl. Each of these sequences displayed a strong positive maxima at 262 nm accompanied by a small trough at 240 nm (Fig. 2B), consistent with the CD spectrum reported for the c-MYC G4-forming sequence that can transition from duplex to quadruplex DNA in vivo. These CD characteristics correspond predominantly to parallel Gquadruplex conformation. Under identical conditions, mutant ODNs corresponding to PI and PII showed very different CD profiles corresponding to the random coil structure of single-stranded DNA (Fig. 2B). Additionally, we calculated the thermal difference spectrum (TDS) factors for both PI and PII G-quadruplex DNA structures to determine the nature of folding in the quadruplex architecture. TDS factors which were found to be >2 further confirms a parallel nature of G-quadruplex DNA folding for both the PI and PII promoter.51 Next, we recorded CD melting curves for both promoters PI and PII with varying oligonucleotide strand concentration (5, 7.5 and 10 µM) in the presence and absence of 120 mM KCl. CD melting curves recorded in the presence of KCl revealed a Tm of 90.5 °C for PI and 82 °C for PII, respectively. In addition, for both the sequences Tm did not depend upon oligonucleotide strand concentration. Melting


Page 7 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


curves recorded in absence of KCl have very low melting (data not shown), suggesting KCl provided significant stability (Fig. 2C). The independence of Tm form oligonucleotide strand concentration provides primary evidence for formation of intramolecular G-quadruplex structures. Therefore, the experiments hereafter were all performed in the presence of 120 mM KCl in 10 mM Tris-HCl buffer solution. As an independent evaluation of the ability of G-rich sequences from ACC1 PI and PII promoters to fold into intramolecular G-quadruplexes, we performed mobility shift assay to monitor their formation. For direct comparison, we also analyzed the structures formed by the corresponding mutant sequences. With wild-type sequences, we observed the formation of a major DNA species migrating faster than single-stranded DNA with two minor species having retarded electrophoretic mobilities on a native polyacrylamide gel. Furthermore, the amount of faster migrating species progressively increased in yield with increasing concentrations of ssDNA. In the case of ACC1 PII sequence, we observed two different types of bands: a major fast migrating band and two slower migrating bands. Consistent with previous reports, the slow migrating species, relative to the migration of single-stranded DNA, corresponds to two- and four-stranded intermolecular G-quadruplexes, whereas the fast migrating species to that of intramolecular quadruplex DNA (Fig. 2D). On the other hand, WT PI sequence formed two distinct bands corresponding to fast migrating intra G4 DNA species and a slow migrating inter G4 DNA. In contrast, neither the formation of intra- or intermolecular G-quadruplex structures was evident with the corresponding mutant ODNs (Fig. 2D). To ascertain the formation of Gquadruplex structures, we analyzed electrophoretic mobility of the wild type and mutant sequences under denaturing conditions (Fig. S1). We observed that the mutant sequences showed similar electrophoretic mobility with that of wild-type sequences, indicating that the size of



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 59

mutant ODN was identical to that of wild-type ODN. Altogether, these results suggest that PI and PII G-rich sequences fold predominantly into intramolecular G-quadruplex in the presence of KCl. FRET and MALDI-TOF experiments reveal the existence of intramolecular G-quadruplex structures in ACC1 PI and PII promoters To gain further insights, we used FRET assay to investigate the specificity of G-quadruplex formation by ACC1 PI and PII G-rich sequences. This assay is homogeneous, continuous and specific, because the appearance of the FRET signal is directly correlated with the formation of intramolecular G-quadruplex structures. Both wild-type PI and PII ODNs (25-mer) contained fluorescein (FAM) donor molecule at the 5' end and 5-carboxytetramethylrhodamine (TAMRA) acceptor molecule at the 3' end (Fig. 3A). Since FAM and TAMRA form a FRET pair with a Förster distance R0 of 49–54 Å,52 a decrease in the fluorescence emission of FAM at 520 nm with simultaneous increase in the fluorescence emission of TAMRA at 580 nm manifest the proximity of the two DNA end indicating the formation of an intramolecular G-quadruplex DNA structure. As shown in Fig. 3B, in the presence of KCl, FRET from FAM to TAMRA occurred as manifested by a decrease in FAM fluorescence and concomitant increase in the intensity of TAMRA fluorescence emission. In contrast, FRET signal was almost undetectable in the absence of KCl. Altogether, FRET results indicate that G-rich sequences from ACC PI and PII promoters fold into stable, intramolecular G-quadruplex structures. Furthermore, the nature of G-quadruplex DNA folding was also investigated by MALDITOF spectrometry. MALDI-TOF spectrometric analysis showed the presence of 7925.04 and 7899.76 molecular ion peaks for PI and PII respectively (Fig. S3), which were in good agreement with their theoretical mass of 7918.2 and 7895.2 respectively. Thus, MALDI-TOF spectrometric


Page 9 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


results further confirmed the formation of an intramolecular (monomeric) G-quadruplex structure by both the sequences, PI and PII. DMS footprinting confirms the formation of G-quadruplex in ACC1 PI and PII promoters To ascertain the formation of G-quadruplex structures in ACC1 PI and PII promoters, and to determine the exact G residues involved in G quadruplex formation, we performed DMS footprinting assay. DMS is most reactive with N7 and N3 of guanine and adenine in single- and double-stranded DNA, respectively, but inaccessible when N7 of guanine is involved in base pairing with a neighbouring guanine through Hoogsteen H-bonding in a G-quadruplex DNA.53 Toward this end, 32P-labeled 25-mer ODNs containing the ACC1 PI and PII promoters were incubated in a buffer containing 10 mM Tris-HCl and 120 mM KCl. The reaction products were analyzed by DMS footprinting to identify G-quartets and G4 DNA.53 Fig. 3C shows the pattern of guanines protected from methylation and residues hypersensitive to methylation. We observed a clear salt-dependent protection from DMS reactivity, thereby providing evidence for the formation G-quadruplex DNA (Fig. 3C, compare lane 2 with 3-6). Guanine residues that are fully and partially protected are highlighted in red and green colour respectively, while residues that show enhanced reactivity are shown in black. Interestingly, in the case of PI promoter, all the three G residues in the interior 3 arrays were protected from reaction with DMS, whereas guanine residues in the flanking arrays at both 5' and 3'-ends reacted partially with DMS. The DMS protection pattern of the ACC1 PI promoter suggests the formation of two distinct G-quadruplex structures with 1:1:1 loop arrangements using the four runs of guanines either from (G1-G3, G4-G6, G7-G9, G10-G12) or (G4-G6, G7G9, G10-G12, G13-G15). In addition, the footprinting results suggest that the formation of both isomers is more or less equally feasible with three G-tetrads. However, this DMS protection



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 59

pattern was different from that ACC1 PII promoter: three G residues in all the 4 arrays were involved in G-quadruplex DNA formation. This indicates that the ACC1 PII promoter has three planar G-tetrads formed from four tracts of guanines, specifically G2-G4, G5-G7, G11-G13, and G14-G16 while G8-G10, which are likely located in the loop region, and G1 positioned at the exterior of the G-quadruplex structure. Accordingly, these results suggest a 1:4:1 loop. RMSD analysis reveals important insights into G-quadruplex conformations Root mean square deviation (RMSD) implies the overall deviation of a structure from the reference frame of coordinates; in this case the final frame after the equilibrium state of simulation is considered as reference frame. RMSD is calculated in ptraj module of AMBER11 with the formula:

૚ ࡾࡹࡿࡰ = ඩ ෍((ࢄ૙ − ࢄ࢏ ሻ૛ + (ࢅ૙ − ࢅ࢏ ሻ૛ +(ࢆ૙ − ࢆ࢏ ሻ૛ ሻ ࢔ ࢏=࢔ ࢏=૙

Higher RMSD values imply more flexibility in the structure, however, during the simulation run if it converges to the stable conformation; it arrives to a steady RMSD value. Considering the RMSD profiles (Fig. 4) and the last 100 ps ensemble structures in the 50 ns MD simulation study (Fig. 5) of the three promoter models, it can be concluded that all the three systems were converged to a steady conformation during the simulation. Model-1 showed less stability for the first 10 ns with gradual increase in RMSD to around 4 Å, however with further progress, it attained stability with an average RMSD of 3.948 Å. Model-2 and Model-3 showed more flexible nature, but they eventually converged to a steady state during last 15 ns simulation run with an average RMSD of 5.359 Å and 5.847 Å respectively. The RMSD of the guanine tetrads showed overall stability in all the three models with a RMSD value of around 0.901 Å. Moreover, the low RMSD (< 2 Å) value of the loop regions indicates the high stability of each of 10 ACS Paragon Plus Environment

Page 11 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the three G-quadruplex conformations. RMSD values of loop regions are enlisted in Supplemental Information, Table SII. Loop 1 is stable in all the three models till 28 ns with RMSD below 0.5 Å, but further progress increased the RMSD values to 1.166 Å and 1.092 Å for Model-1 and Model-2 respectively. In case of Model-3, RMSD of Loop1 changed from 0.5 Å to 1.179 Å and again reduced to 0.644 Å. Loop2 is stable in both Model-1 and Model-2 but the bulging second loop of Model-3 showed more flexibility. Loop3 is stable in Model-1 and Model3 but slightly more flexible in Model-2. (ii) Interaction pattern responsible for the secondary structure The total number of hydrogen bonds was found to be similar in all the three models with an average value of ~60 (SI, Fig. S4). Percentile of hydrogen bond occupancy is calculated for each model enlisted in Table 1 and Table 2. In all the three models, we found that the guanine residues which are involved in the tetrad formation show higher % of hydrogen bond occupancy (Table 1) compared to other bases in the loops and fraying regions (Table 2). In Model-1, % of hydrogen bond occupancies in the Hoogsteen G-G base pairing between the strands, II-III and III-IV is significantly higher compared to that of the strands IV-I and I-II (I, II, III and IV are designated as stems of GGG repeats forming G quadruplex structure). Additional hydrogen bonding interactions among the bases from 5' and 3'-ends such as [5′G1: 3′C19/3′G20]’, [5′C2: 3′G21], [5′T3: G22 /3′G24] were also observed in Model-1. Thus, this pseudo double-strand formation among

3′

the end bases further adds a significant value to the overall stability for the quadruplex structure. In Model-2, (I-II) and (IV-I) strands form much better Hoogsteen G-G base pairing compared to those between (II-III) and (III-IV). In addition, the 5'-end overhang forms a capping, which stacks over the quadruplex with several hydrogen bonding between, [5′G1: 3′loopC19], [5′C2: 3′loop

C19]; [5′T3: 3′loopC19], [5′G4: 3′backboneC19/ G20]; [5′G5: 3′sugerG20]. This additional hydrogen

bonding interaction contributes towards higher extent of stabilization of the Guanine-tetrad, 11 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 59

which interacts with the capping bases. In Model-3, the hydrogen bonding for all the strands is nearly similar. The interactions among 5'-3' bases are described in detail in Table 2. (iii) Water dynamics in Model-1 is much lesser compared to that in the other two model As explained in Experimental section, denser water association represents the less flexible conformation. As seen in Fig. 6, water density is highest for Model-1 whereas Model-2 and Model-3 have comparatively lower than the previous one, depicting highest stability of Model-1 among all. In Model-1, duplex, quadruplex grooves are densely covered by water molecules. In Model-2, both the tetrad ends (3' and 5’-ends) and the backbones are weakly hydrated. In Model3, even though the backbones and grooves are covered, the 5' and 3'-end are poorly hydrated. These results demonstrate that the water dynamics in Model-1 is much lesser compared to that in the other two models. The cationic porphyrin TMPyP4 binds to ACC1 PI and PII G-quadruplex structures A growing body of evidence suggests the possibility of therapeutic interventions for important human diseases though targeting of G-quadruplex structures.34,35,54 Accordingly, a large number of G-quadruplex stabilizing ligands have been synthesized and tested for antitelomerase activity. To determine whether G-quadruplex-specific ligands can bind G-rich sequences from ACC1 PI and PII promoters, we used a known G4 DNA-stabilizing ligand, TMPyP4, which binds to G-quadruplex structures.34,55-57 First we investigated the interaction between TMPyP4 and ACC1 wild-type PII promoter G-quadruplex using UV-visible absorption spectroscopy. The preformed G4 DNA from PII promoter was titrated into a buffer solution containing 5 µM TMPyP4 and the Soret band was monitored as a function of DNA concentration (Fig. 7A). Hypochromicity observed upon the addition of increasing concentration of ACC1 PII quadruplex DNA was concomitant with a bathochromic red shift of 18-20 nm and an apparent 12 ACS Paragon Plus Environment

Page 13 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


isobestic point at 432 nm, indicating TMPyP4 binding to ACC1 PII G-quadruplex. The same analysis was performed on ACC1 PI preformed G4 DNA with a similar effect (data not shown). The equilibrium dissociation constants in the lower nM range (70-83 nM) suggest high affinity of TMPyP4 toward both PI and PII promoter G-quadruplex DNA. To further investigate the specificity of interaction between TMPyP4 and G-quadruplex structures from PI and PII promoters, we used fluorescence emission spectroscopy. Fig. 7B shows the emission spectra of TMPyP4 after the addition of increasing amounts of ACC1 PI preformed G4 DNA. We observed a significant decrease in the fluorescence emission intensity of TMPyP4 upon addition of increasing concentrations of PI G-quadruplex DNA (Fig. 7B). TMPyP4 fluorescence emission spectrum exhibits a broad peak around 680 nm which splits into two peaks centered at 665 nm and 727 nm upon interaction with G-quadruplex DNA and also the ratio of intensity of these split peaks increases with G-quadruplex DNA concentration. Broad featureless fluorescence emission spectrum of TMPyP4 is attributed to coupling of first excited state with a nearby charge transfer state. The coupling that arises due to electron transfer from the TMPyP4 core to an electron acceptor pyridinium moiety is enabled by high polarity solvents and a high degree of rotational freedom of these groups. However, upon interaction with Gquadruplex DNA, quenching of fluorescence intensity and splitting of the broad signature originates from the placement of TMPyP4 within binding sites with low polarity environment and hindrances from free rotation of the pyridinium groups. We obtained similar results when the analysis was performed with preformed PII G4 DNA (data not shown). Thus, we demonstrate by two independent methods that PI and PII G-quadruplex forming sequences were able to interact with TMPyP4 in a concentration-dependent manner. The data from titration with increasing concentrations of TMPyP4 suggests that the mode of its interaction is unlikely to be limited to



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 59

external stacking at G-quadruplex ends and may involve intercalation between the G-quartets and TMPyP4. Other studies have suggested a stacking of TMPyP4 on G-quadruplex DNA. The presence of G-quadruplex structures in ACCI promoters blocks DNA synthesis The human genome is littered with G-rich sequences capable of forming G-quadruplexes that can interfere with DNA metabolic processes. Having established that the G-rich sequences from ACC1 PI and PII promoters fold into parallel DNA quadruplexes, we next asked whether the existence of such structures interfere with DNA synthesis. To this end, we used 60-mer wildtype or mutant DNA templates of ACC1 PI and PII promoter sequences (Fig. 8A). These templates were then annealed to 32P-labeled primers in the assay buffer containing increasing concentrations of KCl. The primer was present in 1.5-fold molar excess over the template and targeted to a complementary region at the 3' end of the template. We initiated DNA synthesis by the addition of Taq DNA polymerase. After 45 min incubation at 37 °C, reactions were stopped and the products were analyzed on a denaturing gel. Fig. 8B shows that primer extension performed at low salt concentrations generated a full length product. Under these conditions, we observed a weak band at 40-mer position corresponding to the pause site in the reactions performed at low salt concentrations. However, the amounts of full length product progressively decreased in the presence of increasing salt concentrations and totally abolished in the presence of 100 mM KCl, indicating that polymerase was physically blocked at the last guanine of 4 G array. In contrast, under similar conditions, primer extension of mutant sequence was independent of salt concentrations tested (Fig. 8B, lanes 7-11). TMPyP4 binds ACCI G-quadruplex and blocks DNA synthesis To obtain further evidence for the formation of G-quadruplex and its impact on DNA synthesis, we performed polymerase stop assay at 45 °C in the presence of increasing


Page 15 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


concentrations of TMPyP4. The latter was included to stabilize the G-quadruplex DNA. In this assay, template containing wild type or mutant PI and PII promoter G-rich sequences (Fig. 8A) were annealed to 32P-labeled primers as described above, but in the presence of 10 mM KCl. Subsequently, incubation of primer annealed templates with Taq polymerase in the presence of increasing amounts of TMPyP4 lead to progressive decrease in the formation of full length product, whereas it had no effect on the mutant promoter I sequence (Fig. 8C(i)). We note that with the wild-type sequence the pausing occurred at two sites perhaps due to the presence of two G-quadruplex isomers. On the other hand, wild-type PII sequence behaved similar to that of PI, but its mutant form exhibited significant stalling of primer extension (Fig. 8C(ii), lanes 7-11). However, the amount of product generated was nearly consistent across a wide range of salt concentrations tested. Nonetheless, these data indicate that G4 quadruplex structures in the ACCI promoter could stall DNA polymerase, thereby act as roadblocks for DNA synthesis. Molecular dynamics simulation studies suggest preferential affinity of TMPyP4 to Model-1 structure The interaction between TMPyP4 and G-quadruplex DNA was further investigated using docking and molecular dynamics simulation studies (see SI Materials and Methods). TMPyP4 ligand has both planar central core and four twisted non-planar pyridinium moieties. The peripheral cationic charge on the pyridinium nitrogen favors ionic interaction with DNA. Even though all the three G-quadruplex DNA structures are intramolecular and parallel in nature, they have very discrete G-tetrad, groove and loops. Our interest was to explore the possible modes of interaction between the G-quadruplexes and TMPyP4. After 10 ns of final production run, each of the three DNA-ligand complexes reached a considerably low and steady RMSD values (< 3 Å) (SI, Fig. S10). Porphyrin prefers to interact with Model-1 through partial stacking with the 5′-



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 59

tetrad. Efficient stacking interaction was observed with the G8 and G12 tetrad bases along with ionic interaction with C2, T3, and G12 base phosphate residues (Fig. 8C (i)). In the case of Model-2, porphyrin was found to interact with the large groove created by G21-G22-T23: G6C7-G8-G9 residues. The close proximity with G22, T23, and G24 phosphate moieties indicates favorable ionic interaction with pyridinium ends (Fig. 8C (ii)). The binding mode with Model-3 was almost similar to that of Model-1. Porphyrin replaced G15 residue from the top of the 5′tetrad with significant stacking interaction with A3, G20, and G16 bases along with ionic interaction with G16, G17, and G20 phosphate residues (Fig. 8D (iii)). Nucleolin binds to the G-quadruplex structures formed from PI and PII promoters Having established the existence of G-quadruplex DNA in the ACC1 PI and PII promoters, we asked whether known nuclear G4 DNA binding proteins interact with Gquadruplex formed from these promoter sequences. Nucleolin, a conserved major nuclear protein, functions as an important regulator of cellular proliferation and plays a key role in the regulation of expression of oncogenes such as c-myc.58,59 Toward this end, we performed electrophoretic mobility shift assay with nucleolin which binds both intra- and intermolecular Gquadruplex DNA, but displays higher affinity toward the intramolecular parallel G-quadruplex structure. To determine the binding of human nucleolin to PI and PII G-quadruplexes, each of the 5'-32P-labeled DNA was incubated with increasing concentrations of nucleolin in the presence of K+ ions as described under Experimental section. Our results show that nucleolin can bind to the ACC1 G-quadruplex DNA with high specificity and in a dose dependent manner, indicating that it serves as a binding target for nucleolin (Fig. 9A-B). However, our results also showed that the binding affinity of nucleolin was significantly higher for the PII G-quadruplex structure than for the PI G-quadruplex DNA. The increased nucleolin binding to the PII G-


Page 17 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


quadruplex DNA is perhaps due to its loop arrangement or may be related to the specific sequence of DNA. In control experiments, we found that nucleolin failed to bind to the corresponding mutant sequences under similar reaction conditions (Figure 9C-D). The existence of G-quadruplex DNA in ACC1 promoters suppresses transcription Having demonstrated the presence of G-quadruplex structures in the ACC1 PI and PII promoters, we next investigated the effect of G-quadruplex formation on transcription using wild-type or mutant forms of ACC1 PI and PII promoters.19 The human genomic DNA fragments containing –2019/+53 region (1.9 kb) of PI promoter and –1965/+30 region (2.1 kb) of PII promoter with respect to the transcription start site (see Fig. 1) were subcloned into a pGL2-Basic vector that contains the luciferase gene without a eukaryotic promoter or enhancer elements. The recombinant constructs bearing ACC1 PI and PII sequences were designated as pACC1WTPI and pACC1WTPII, respectively. We performed site-directed mutagenesis in the G-rich region to generate mutants, pACC1MtPI and pACC1MtPII, respectively (Fig. 10A). These constructs were transiently transfected into HeLa cells, and the luciferase activity was measured 48 h after transfection. As shown in Fig. 10B, both wild-type and mutant forms of PI and PII sequences were found to activate luciferase gene expression. Comparison between the wild-type and mutant PI and PII in pACC1MtPI and pACC1MtPII constructs revealed significant differences in the extent of luciferase activity, 9.7 and 2.6-fold, respectively. Human ACC1 promoter region contains several putative Sp1-binding sites with the consensus sequence 5'-(G/T)GGGCGG(G/A)(G/A)(C/T)-3' in double-stranded DNA. It is possible that mutation of GGGCGG core sequence in ACC1 promoters may affect the binding between the target sequence and transcription factor Sp1 in double-stranded DNA, which subsequently can affect ACC1 gene expression. However, Sp1 pull-down experiments using HeLa cell nuclear extracts,



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 59

together with biophysical binding assays revealed that Sp1 has a comparable binding affinity for G-quadruplex structure formed from the SP1 target sequence and the canonical SP1 duplex sequence.60 Further, the authors have shown that mutation of GGGCGG core sequence (G →T), which disrupts the G-quadruplex formation, does not alter the binding of Sp1 to the duplex, thereby implicating that mutations (G →T) in pACC1MtPI and pACC1MtPII constructs, may not affect the binding between the substrate and Sp1. Taken together, these results suggest the existence of G-quadruplex structures in the ACC1 promoters, which, in turn, can down-regulate ACC1 gene expression. TMPyP4 suppresses ACC1 gene expression in HeLa cells To identify G-quadruplex-directed small molecule inhibitors of ACC1 gene expression, we first performed luciferase reporter assay. For this purpose, cultures of HeLa cells transfected with pACC1WTPI and pACC1WTPII constructs were grown in the absence or presence of increasing concentrations of TMPyP4 (0.1- 25 µM). Fig. 10C-D show that the levels of luciferase activity decreased in cells treated with TMPyP4 in a dose-dependent manner. Although luciferase gene expression was suppressed in both the cases, the decrease was relatively higher in the case of PII (84%) compared to PI (67%) sequence containing construct. The significantly different levels of suppression might be related to the presence of G-rich sequences in either template or nontemplate strand. Furthermore, these results support the view that luciferase gene expression driven by ACC1 promoters can be used as transcriptional reporter system to measure the effect of G-quadruplex binding molecules in drug screening efforts directed at the regulation of ACC1 gene expression. We have shown previously that benzimidazole-carbazole conjugates display specific binding and stabilization of human G-quadruplex structures.61 To confirm that the G-quadruplex


Page 19 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


specific ligands target G-quadruplex structure in the ACC1 promoters and influence ACC1 gene transcription, we carried out qRT-PCR with one such compound, mono-(bis-benzimidazole) derivative (CBM). 61 Towards this end, HeLa cells were treated with varying concentration of CBM ligand for 24 h and then the relative changes in ACC1 gene expression were measured in comparison to the reference gene GAPDH. Fig. 10E shows that the levels of ACC1 transcripts decreased significantly in a dose-dependent manner in cells treated with CBM with no measurable differences in the levels of GAPDH transcripts. Altogether, these results suggest that G-quadruplex-specific ligands suppress ACC1 transcription, and that the inhibitory effect of these ligands manifest in human cells. Together, the results are consistent with earlier observations with G-quadruplex-specific ligands against several other targets.31,34 CONCLUSION Based on a plethora of compelling data in support of the in vitro existence of G4 DNA structures, G-quadruplexes have been demonstrated in diverse cellular contexts of different organisms, including humans, bacteria, fungi, plants and insects.30-34 G-quadruplex structures are thought to be functionally important because of their vital roles in processes such as transcription, DNA replication, and consequently, the maintenance of genome stability. However, the nature and distribution of G-quadruplexes across the genome remains elusive.30-34 Computational studies of genomes of a number of organisms have revealed that G4 motifs are widely distributed and in some instances overrepresented in the promoter regions.30,62 Further, in many organisms, including humans the G4 motifs embedded in the promoter regions are often found in the template strand.30-34 In this context, G4 structures are thought to form spontaneously or as a result of supercoiling-induced stress during transcription; however, their function and significance is poorly understood. 19 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 59

Figure 11 summarizes the results of this study. Using multiple complementary methods, we show that G-rich sequences present in the ACC1 promoter region fold into intramolecular Gquadruplex DNA structures under physiological conditions. These results support the view that intramolecular G4 structures form at specific G-rich regions with a sequence motif having at least four runs of guanines, in which each G-tract most often contains three guanine residues. Thermodynamic studies indicate that although G4 structures are extremely stable, their stability depends on many factors including the length and sequence composition of the G4 motif, loop size, strand stoichiometry, topology and alignment.30-34 Owing to the biochemical properties of conventional DNA/RNA polymerases, G4 structures can obstruct DNA replication and transcription resulting in their slow down or arrest. 30-34 Consistent with our prediction, primer extension assays confirmed the formation of intramolecular G-quadruplex DNA in the ACC1 PI and PII promoters. Our studies also revealed that the formation of the G-quadruplex DNA structures suppress ACC1 gene expression in vivo, suggesting a potential role for G4 DNA specific helicases in ACC1 gene transcription. We also demonstrate that small molecules that bind to G-quadruplexes in vitro stabilize ACC1 G-quadruplexes in the cellular context and augment suppression of ACC1 gene expression. In summary, our substantive evidence for Gquadruplex formation in the human ACC1 promoters and ligand-mediated stabilization of Gquadruplexes as a means to control ACC1 transcription, adds to the portrait gallery of yet another fascinating regulatory mechanism of this important enzyme and as a target of G4 DNA-specific drug screening efforts. EXPERIMENTAL SECTIONS DNA, proteins and reagents. Highly purified nucleoside triphosphates (NTPs) were purchased from Amersham Pharmacia Biotech. Oligonucleotide (ODN) substrates and PCR primers for


Page 21 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


site-directed mutagenesis were purchased from Sigma-Genosys. Primer sequences are listed in Table SI. All oligonucleotide stock solutions were resuspended in 10 mM Tris-HCl (pH 7.5) buffer, 0.1 mM EDTA and indicated concentrations of KCl. To induce G4 DNA formation, the annealing reaction was carried out in the presence of 120 mM KCl. After the annealing step, samples were stored at 4 °C. Human nucleolin was purified from recombinant pET21, a plasmid carrying a truncated nucleolin gene encoding residues from 284–707 and six histidines as previously described.63 Recombinant nucleolin carries residues 284–709, including all four RNA binding domains and the C-terminal domain. pET-∆Nuc-His construct was transformed into expression strain Escherichia coli C41(DE3). Cells were grown in Luria-Bertani broth until A600 = 0.4 at 37 °C, and then induced with the addition of 0.5 mM isopropyl-1-thio-β-d-galactopyranoside at 30 °C. After 8 h, cells were harvested by centrifugation at 5000 rpm for 10 min. The cell pellet was resuspended in lysis buffer (20 mM sodium phosphate buffer of pH 7.4, 150 mM NaCl, 10 mM imidazole, 1 mM PMSF, 5 mM 2-mercaptoethanol and 10% (v/v) glycerol) and lysed by sonication. The whole-cell lysate was centrifuged in a Beckman Ti-45 rotor at 30,000 rpm for 1 h at 4 °C. The supernatant was loaded onto pre-equilibrated nickel affinity column. The column was washed with 10 bed volumes of buffer (20 mM sodium phosphate buffer of pH 7.4, 150 mM NaCl, 25 mM imidazole, 1 mM PMSF, 5 mM 2-mercaptoethanol and 10% (v/v) glycerol) and the bound protein was eluted with a linear gradient of 50→500 mM imidazole. Fractions containing nucleolin were pooled and dialyzed against buffer B (10 mM Tris-HCl, pH 7.4, 10% glycerol, 600 mM NaCl and 5 mM 2-mercaptoethanol). The dialysate was applied onto a preequilibrated Superdex 75 gel filtration column (120-mL bed volume). The peak factions containing nucleolin were pooled and dialyzed against buffer C (20 mM Tris-HCl (pH 7.4, 1 mM



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 59

DTT, 120 mM NaCl and 20% glycerol). The purity of nucleolin was assessed by SDS-PAGE and found to be 98%. Circular dichroism spectroscopy. CD spectra were recorded using a Jasco spectrophotometer equipped with temperature controller using a quartz cell of 1 mm optical path length with a scanning speed of 100 nm/min over the range of 200-350 nm. Samples contained 5 µM DNA in 10 mM Tris-HCl buffer (pH 7.4), 0.1 mM EDTA with varying KCl concentrations. Samples were heated at 95 °C for 5 min and annealed by slow cooling to room temperature prior to recording spectra. To examine the stability and stoichiometry of ACC quadruplexes, CD spectra of samples containing 2.5-10 µM quadruplex DNA were recorded over a wavelength range of 200-400 nm and between 20 - 96 °C with increment of 2 °C/min. Similarly, to determine ligand mediated quadruplex stabilization, CD spectra of samples containing DNA quadruplexes in the presence of ligand in the ratio of 1:2.5. Further, ellipticity versus temperature profiles (melting curves) were plotted (for normalized values) at 262 nm and Tm was determined. All values were corrected for dilution effects. Each trace shown in the figure is the result of the average of at least three scans taken with a temperature gradient of 1 °C/min and a band width of 1 nm. A blank sample containing only buffer was treated in the same manner and subtracted from the collected data. MALDI-TOF spectrometry. The stoichiometric ratio of strands in the G-quadruplex structures was analyzed by MALDI-TOF spectrometry with a Bruker Daltonics – autoflex speed MALDITOF(/TOF) instrument. The samples were prepared in 100 mM ammonium citrate dibasic and were heated at 95˚C for 5 min. Samples were subsequently slowly air-cooled to room temperature and kept at 4˚C for 24 h. The final DNA concentration of the sample was 20 µM. The matrix was prepared by making a saturated solution 3-hydroxypicolinic acid in H2O:ACN 22 ACS Paragon Plus Environment

Page 23 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


50:50 (v:v), containing 10 mg/ml ammonium citrate dibasic. Ground steel plate (MTP 384) was used for sample spotting. The spectra were recorded in negative ion mode with the accelerating voltage set at 20 KV and 100 laser shots were given for each spectrum. Absorption spectroscopy. Absorption spectra were recorded using a Shimadzu UV-2100 spectrometer equipped with a temperature-controller in a quartz cuvette of 1 cm path length at 25 °C. Samples in a buffer containing 10 mM Tris-HCl (pH 7.4), 0.1 mM EDTA, 100 mM KCl and 5 µM TMPyP4 were titrated against increasing concentration of ACC1 PI or PII G-quadruplex DNA. Ttitrations were terminated when the wavelength and intensity of the absorption band for TMPyP4 did not change upon further addition of DNA. The data were plotted using origin 8.0 software and the respective binding affinities were determined from the Scatchard plot. The concentration of free porphyrin was determined using a molar extinction coefficient of 226,000 M-1 cm-1. UV TDS experiments were also performed using a Shimadzu UV-2100 spectrometer equipped with a temperature-controller in a quartz cuvette of 1 cm path length. The variable temperature absorption spectra were recorded using a 1 µM G-quadruplex DNA solution in the temperature range of 20-90 °C. The TDS factor was calculated by ∆A240nm/∆A295nm where ∆Aλ = Aλ(90°C)-Aλ(20°C). All values were corrected for dilution effects. Fluorescence spectroscopy. Fluorescence emission spectra were recorded on a Jobin YvonSpex Fluoromax 3 fluorimeter (Instruments S. A., Inc.), equipped with excitation and emission monochromators and red-sensitive photomultiplier tubes, using quartz cells with a path length of 0.5 mm at 25 °C. The fluorescein fluorescence was excited at 492 nm and emission was measured from 500 to 650 nm. In experiments involving titration with TMPyP4, the indicated concentrations of ACC1 PI or PII promoter ODNs were added to a solution containing 10 mM Tris-HCl (pH 7.4) buffer containing 0.1 mM EDTA, 100 mM KCl and 0.8 µM TMPyP4. After 23 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 59

incubation for 10 min, the emission spectra were recorded with an excitation at 430 nm and slit width of 10/10 (nm). We terminated titrations when the wavelength and intensity of the emission band did not change upon further addition of DNA. The data were processed in Origin 8.0 software. All values were corrected for dilution effects. Radiolabeling of oligonucleotides. ODNs were labelled at the 5'-end using [γ-32P]ATP and T4 polynucleotide kinase (New England Biolabs) as previously described.64 The 32P-labeled ODNs were then purified using Micro Spin G-25 column (GE Healthcare), and purified on denaturing polyacrylamide gel electrophoresis. The bands corresponding to 32P-labeled ODNs were cut and eluted from the gel by soaking in sterile water, and followed by ethanol precipitation. The pellet was washed with 70% ethanol, dried and resuspended in water. DMS footprinting. The assay was performed as previously described.53 The 5'-end 32P-labeled ODNs were resuspended in 10 mM Tris-HCl (pH 7.4) buffer (either no or 120 mM KCl) were denatured by heating at 95 °C for 5 min and then cooled down to room temperature to facilitate annealing. Following addition of 1 µg/µl calf thymus DNA, increasing concentrations of freshly diluted DMS was added to the annealed DNA, and was allowed to proceed for 5 min at room temperature. The reaction was quenched by the addition of of stop solution (1.5 M sodium acetate (pH 5), 1 mM β-mercaptoethanol and 250 µg/mL calf thymus DNA). Following ethanol precipitation and washing the pellets, DNA was resuspended in 90 µl of 10% piperidine. The reaction mixture was incubated at 90 °C for 30 min. Samples were centrifuged under vacuum to dryness and then resuspended in 100 µl water, and dried again and the process was repeated thrice. Samples were resuspended in 5 µl of loading dye [95% formamide (v/v)/20 mM EDTA/0.01% (w/v) bromophenol blue], heated at 95 °C for 5 min, and DNA products were


Page 25 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


resolved on 18% denaturing PAGE. Gels were dried, exposed to the phosphorimaging screen and images were acquired using Fuji FLA-5000 phosphor Imager. Taq polymerase stop assay. Polymerase stop assay was performed as previously described.65 Briefly, single-stranded DNA templates (10 nM) bearing G-quadruplex forming or mutant sequences were mixed with 32P-labeled primers (15 nM) in annealing buffer (Tris-HCl, pH 8, with varying KCl concentration) and denatured by heating at 95 °C for 5 min and then cooled down to room temperature over a period of 24 h. Primer extension reactions were performed by mixing annealed substrates with reaction buffer (10 mM MgCl2, 0.5 mM DTT, 1.5 mg/ml BSA and 0.1 mM dNTPs) and then incubated with Taq DNA polymerase for 45 min at 37 °C. For reactions performed in the presence of TMPyP4, the primer-annealed templates were incubated with increasing concentrations of TMPyP4 for 1 h at 37 °C before the start of the primer extension reaction. The primer extension assay was performed in the presence of TMPyP4 for 30 min at 42 °C. The reactions were stopped by the addition of loading dye (95% formamide, 10 mM EDTA, 10 mM NaOH, 0.1% xylene cyanol, 0.1% bromophenol blue). Samples were separated on 15% denaturing PAGE. Gel was fixed for 30 min in a solution containing 10% acetic acid and 10% methanol. The dried gel was exposed to the phosphorimaging screen prior to acquiring images using Fuji FLA-5000 phosphorImager. Electrophoretic mobility shift assay. The 5′-end labeled wild type and mutant ODNs in TrisHCl (pH 7.4) buffer, 0.1 mM EDTA in the absence or presence of varying concentration of KCl were annealed by heating at 95 °C for 5 min followed by slow cooling to room temperature. Samples were resolved 15% native or denaturing PAGE. Gels were dried, exposed to the phosphor-imaging screen and images were acquired using Fuji FLA-5000 phosphorimager.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 59

Nucleolin binding to wild-type and mutant ACC1 PI and PII G-rich sequences was performed by mobility shift assays as previously described.66 Binding reactions (20 µl) contained 10 mM Tris-HCl (pH 7.4), 0.1 mM EDTA, 0.1 mM DTT, 100 mM KCl, 2 nM 32P-labelled wildtype or mutant DNA and increasing concentrations of nucleolin as specified in the figure legends. After incubation at 37 °C for 45 min, reactions were stopped by the addition of 2 µl loading dye, then resolved on 8% native PAGE. Gels were dried, exposed to the phosphorimager screen and images acquired using Fuji FLA-5000 phosphorimager. Construction of ACC1 reporter plasmids. The wild-type PI (2.1 kb) and PII (1.9 kb) promoter regions of ACC1 gene 19 were subcloned into a pGL3-basic vector, which contains a promoterless luciferase gene. In parallel, mutant plasmids were generated by substitution mutation, where the indicated G residues were changed to T residues in the both ACC1 PI and PII promoters by site- directed mutagenesis as previously described.67 The recombinant plasmids were verified by automated dideoxy sequencing using chain terminator dyes. Cell cultures and luciferase assays. HeLa cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum at 37 °C in humidified air containing 5% CO2, and maintained in logarithmic phase of growth. HeLa cells (50000) per well were seeded in a 12 well plate. On the following day, cells were transfected with the wild type or mutant plasmids (2 µg) using Lipofectamine 2000 based-system (Invitrogen) in the absence (Fig. 10B) or presence (Fig. 10C) of indicated concentrations of TMPyP4. After 48 h, luciferase activity was assayed by using the Dual Luciferase Reporter Assay System (Promega) in a 24-well plate format as previously described.68 The data are mean values of three independent experiments ± S.E.M.


Page 27 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Semi-quantitative RT-PCR. For gene expression studies, 200000 Hela cells per well were seeded in 6 well plate and treated with different concentration of G-quadruplex selective ligand CBM 67 for 24 h. After 24 h treatment, cells were collected and total RNA was extracted using TRIZOL (Sigma) reagent following manufacturer’s instructions. RNA was quantified using a NanoDrop 2000/2000c Spectrophotometers (Thermo Scientific). The cDNA synthesis was carried out from 2 µg of total RNA using cDNA synthesis kit (Thermo Scientific) according to the manufacturer’s protocol. The real-time PCR reactions were carried out using specific primers for acetyl CoA carboxylase and GAPDH.69 The following PCR program was used: initial denaturation at 94 °C for 3 min followed by 30 cycles of denaturation at 94 °C for 15 sec each time, 61.5 °C primer annealing for 30 sec and 72 °C extension for 30 sec, the final extension was carried at 72 oC for 2 min. Samples were analyzed by agarose gel electrophoresis. Structure building and molecular dynamics simulation. The CD spectral data and DNA footprinting results were comprised together to generate the possible G-quadruplex structures for the promoter sequences under investigation. The experimental observations suggest that these promoter sequences acquire secondary conformation reminiscent of parallel G-quadruplex structures; however, the structural details at the atomic levels are lacking. NMR solution structures for the intra-molecular parallel stranded G-quadruplexes are available for various Grich sequences, in general it has been observed that guanines involved in G-stacking attain an anti conformation in glycosidic angles.70-74 Here, we have considered the available solution structure of c-MYC promoter region [PDB:1XAV, Sequence: (5'TGAGGGTGGGTAGGGTGGGTAA-3')] as an template structure as it is also an intramolecular parallel stranded G-quadruplex structure with all the guanines in an anti conformation.75 Coordinates of the three tetrads with K+ ions were extracted from the PDB 27 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 59

structure while the connecting loops and 5'/3'-ends were modeled as per the foot-printing results. Interestingly, PI sequence 5'-GCTGGGCGGGCGGGCGGGCGGGTGG-3' having five consecutive GGG segment indicates the possibility of two kinds of quadruplex folding resulting in two distinctly different structures (Model-1 and Model-2; Fig. 3D). Model-1 consists of first four GGG repeats adjacent to the 5'-end while the fifth GGG repeat i.e. 3'-end remains as pendent. On the other hand, Model-2 was generated with the four GGG repeats adjacent to the 3'-end and the 5'-end remains as an overhang. On the contrary, the presence of only four GGG stretch in the PII sequence, 5'-ACAGGGGCGGGGCGGGGGCGGGTCA-3'’ suggests the formation of a solitary G-quadruplex structure (Model-3; Fig. 3D). The coordinates of bases in loop regions and bases in 5'/3'-ends were built in Maestro.76 All the models were further refined by gas phase energy minimization where steric clashes and bond orders were corrected. ff99SB force field parameters of AMBER11 were calculated for the nucleotide Models.77, 78 The charges were neutralized with counter ions. Further, the whole system was solvated in 8Å TIP3PBOX water model. Simulation was conducted in AMBER 11 with the normal protocol i.e. minimization conducted in two steps followed by 50 ps heating and further equilibration for 1ns. Production run of 50ns was conducted for all the equilibrated systems. Simulation parameters used were as follows: NPT ensemble, temperature of 300K, and pressure at 1 atm. To maintain the temperature and pressure Langevin thermostat and barostat were used and movement of hydrogen was applied with the SHAKE algorithm. 79, 80 Step size of 2 fs was followed. Long range electrostatic interactions were calculated with 0.1 nm grid spacing of fast Fourier transform grid using Particle Mesh Ewald method, cut of range was kept at 12 Å.81 Simulated trajectories are composed of atomic coordinates recorded at each 10 ps time step. Analysis of simulated trajectories were performed using Ptraj module of AMBER, and visualized


Page 29 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


using PyMol and VMD.82, 83After 50 ns MD simulation studies, final structures were employed for the docking and simulation studies of porphyrin-quadruplex complex. Porphyrin structure was energy optimized initially using B3LYP level of theory with 6-31G* as the basis set in Gaussian 03. The energy optimized structure was then undertaken for docking studies with each of the final G-quadruplex DNA models on the basis of experimental findings. Statistically and energetically favored DNA-ligand complexes obtained from the docking studies were then subjected to molecular dynamics simulations using a similar protocol. Water-density map. It has been shown that water plays crucial role in determining the secondary structure of biomolecules as well as its stability. In case of the nucleic acids, the charged backbone atoms are exposed to solvent and hydrophobic bases are involved in base pairing as well as stacking. Water molecules are engaged in hydrogen bonding interactions being associated with the charged phosphate backbone atoms. The water structure adhered to the DNA backbone determines the strength of the overall secondary structure. It has been found in simulation study that if the structure is more dynamic in nature, the water association is reduced. Thus, highest water density implies that the nucleic acid is stable with less flexibility.84 PTRAJ module of AMBER11 was used to calculate the water density map for three quadruplex models, occupancy of water molecules around the quadruplex structure was analyzed. The percentage of time over the entire simulation run for which the oxygen atom of particular water molecule occupies a certain grid point determines the occupancy value. Occupancy was calculated based on the reference frame i.e. average structure of the simulation frames (without water molecules). 100Å grid with a grid spacing of 0.5 Å was built over the averaged frame. Higher occupancy is visualized as a denser water map and vice versa. Visualization of XPLOR density maps was carried out in Chimera 1-9.85 If a particular grid point 29 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 59

is populated with water molecules for longer period of time over the entire time scale, that region is covered with dense water contour, and conversely if water stays for a shorter period the particular region is covered with a lighter water contour that can be examined visually in a XPLOR density map generated in Chimera. ASSOCIATED CONTENT Supporting Information. Details of DNA substrates, structure building, RMSD and MD simulations, EMSA and MALDI characterization of G-quadruplex DNA (Tables SI and SII; Figures S1-S9). This material is available free of charge via the Internet at http://pubs.acs.org. Author Contributions M.K., B. M., S. C., S.B. and K. M. contributed to the planning and design of the work. M. K. carried out the bulk of the experiments with assistance from B. M. J. B. carried out the RMSD and MD simulation measurements in the laboratory of S.C. Y.I. provided the plasmid constructs containing wild-type PI (2.1 kb) and PII (1.9 kb) promoter regions of ACC1 gene. K. M. wrote the manuscript with inputs from all other authors. ACKNOWLEDGMENTS We thank Eleanor K. Spicer of the Medical University of South Carolina for her generous gift of pET-∆Nuc-His recombinant plasmid. We gratefully acknowledge P. Sandhya Rani and Jaganath Jana for their assistance with qPCR and MALDI measurements, respectively. FUNDING J. C. Bose National Fellowship from the Department of Science and Technology, New Delhi, to K.M. and S. B.; Senior Research Fellowship from the Council of Scientific and Industrial Research, New Delhi, to M. K., and Department of Biotechnology, New Delhi, to S.C. J.B. received DBT fellowship from the project (BT/PR6627/GBD/27/440/2012). 30 ACS Paragon Plus Environment

Page 31 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ABBREVIATIONS USED ACC1, Acetyl-CoA Carboxylase 1; CD, circular dichorism; DMS, dimethyl sulfate; DMSO, dimethyl sulfoxide; DTT, dithiothreitol; FI, fluorescence intensity; EDTA, ethylenediaminetetraacetic acid; FAM,5-carboxyfluorescein; FRET, Fluorescence Resonance Energy Transfer; G4 DNA, G-quadruplex DNA; MALDI-TOF, Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry; ODNs, oligodeoxynucleotides; PAGE, polyacrylamide gel electrophoresis; PMSF, phenylmethanesulfonyl fluoride; qRT-PCR, quantitative real-time polymerase chain reaction; RMSD, Root Mean Square Deviation; SDSPAGE, Sodium dodecylsulfate polyacrylamide gel electrophoresis; TDS, thermal difference spectrum; Tm, melting temperature;TMPyP4, tetra-(N-methyl-4-pyridyl)porphyrin; TAMRA, tetramethylrhodamine; WT, wild-type. Conflict of interest statement. None declared. AUTHOR INFORMATION *

Corresponding author:

Email: [email protected]; Phone +91 80 23600278

REFERENCES 1. Zu, X.; Zhong, J.; Luo, D.; Tan, J.; Zhang, Q.; Wu, Y.; Liu, J.; Cao, R.; Wen, G.; Cao, D., Chemical genetics of acetyl-CoA carboxylases. Molecules 2013, 18, 1704-1719. 2. Tong, L.; Harwood, H. J., Jr. Acetyl-coenzyme A carboxylases: versatile targets for drug discovery. J. Cell. Biochem. 2006, 99, 1476-1488.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 59

3. Barber, M. C.; Price, N. T.; Travers, M. T., Structure and regulation of acetyl-CoA carboxylase genes of metazoa. Biochim. Biophys. Acta 2005, 1733, 1-28 4. Thampy, K. G., Formation of malonyl coenzyme A in rat heart. Identification and purification of an isozyme of A carboxylase from rat heart. J. Biol. Chem.. 1989, 264, 1763117634. 5. Bianchi, A.; Evans, J. L.; Iverson, A. J.; Nordlund, A. C.; Watts, T. D.; Witters, L. A., Identification of an isozymic form of acetyl-CoA carboxylase. J. Biol. Chem.. 1990, 265, 1502-1509. 6. Abu-Elheiga, L.; Jayakumar, A.; Baldini, A.; Chirala, S. S.; Wakil, S. J., Human acetyl-CoA carboxylase: characterization, molecular cloning, and evidence for two isoforms. Proc. Natl. Acad. Sci. U. S. A. 1995, 92, 4011-4015. 7. Abu-Elheiga, L.; Almarza-Ortega, D. B.; Baldini, A.; Wakil, S. J., Human acetyl-CoA carboxylase 2. Molecular cloning, characterization, chromosomal mapping, and evidence for two isoforms. J. Biol. Chem. 1997, 272, 10669-10677. 8. Lopaschuk, G. D.; Witters, L. A.; Itoi, T.; Barr, R.; Barr, A., Acetyl-CoA carboxylase involvement in the rapid maturation of fatty acid oxidation in the newborn rabbit heart. J. Biol. Chem. 1994, 269, 25871-25878. 9. Ha, J.; Lee, J. K.; Kim, K. S.; Witters, L. A.; Kim, K. H., Cloning of human acetyl-CoA carboxylase-beta and its unique features. Proc. Natl. Acad. Sci. U. S. A. 1996, 93, 1146611470. 10. Abu-Elheiga, L.; Brinkley, W. R.; Zhong, L.; Chirala, S. S.; Woldegiorgis, G.; Wakil, S. J. The subcellular localization of acetyl-CoA carboxylase 2. Proc Natl Acad Sci U S A 2000, 97, 1444-1449.


Page 33 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


11. Hardie, D. G., Regulation of fatty acid and cholesterol metabolism by the AMP-activated protein kinase. Biochim. Biophys. Acta 1992, 1123, 231-238. 12. Kim, K. H., Regulation of mammalian acetyl-coenzyme A carboxylase. Annu. Rev. Nutr. 1997, 17, 77-99. 13. Fediuc, S.; Gaidhu, M. P.; Ceddia, R. B., Regulation of AMP-activated protein kinase and acetyl-CoA carboxylase phosphorylation by palmitate in skeletal muscle cells. J. Lipid Res. 2006, 47, 412-420. 14. Mabrouk, G. M.; Helmy, I. M.; Thampy, K. G.; Wakil, S. J.,

Acute hormonal control of

acetyl-CoA carboxylase. The roles of insulin, glucagon, and epinephrine. J. Biol. Chem. 1990, 265, 6330-6338. 15. Lee, J. J.; Moon, Y. A.; Ha, J. H.; Yoon, D. J.; Ahn, Y. H.; Kim, K. S., Cloning of human acetyl-CoA carboxylase beta promoter and its regulation by muscle regulatory factors. J. Biol. Chem. 2001, 276, 2576-2585. 16. Atkinson, L. L.; Fischer, M. A.; Lopaschuk, G. D., Leptin activates cardiac fatty acid oxidation independent of changes in the AMP-activated protein kinase-acetyl-CoA carboxylase-malonyl-CoA axis. J. Biol. Chem. 2002, 277, 29424-29430. 17. Foufelle, F.; Ferre, P., New perspectives in the regulation of hepatic glycolytic and lipogenic genes by insulin and glucose: a role for the transcription factor sterol regulatory element binding protein-1c. Biochem. J. 2002, 366, 377-391. 18. Oh, S. Y.; Park, S. K.; Kim, J. W.; Ahn, Y. H.; Park, S. W.; Kim, K. S., Acetyl-CoA carboxylase beta gene is regulated by sterol regulatory element-binding protein-1 in liver. J. Biol. Chem. 2003, 278, 28410-28417.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 59

19. Zhao, L. F.; Iwasaki, Y.; Zhe, W.; Nishiyama, M.; Taguchi, T.; Tsugita, M.; Kambayashi, M.; Hashimoto, K.; Terada, Y., Hormonal regulation of acetyl-CoA carboxylase isoenzyme gene transcription. Endocr. J. 2010, 57, 317-324. 20. Knobloch, M.; Braun, S. M.; Zurkirchen, L.; von Schoultz, C.; Zamboni, N.; Arauzo-Bravo, M. J.; Kovacs, W. J.; Karalay, O.; Suter, U.; Machado, R. A.; Roccio, M.; Lutolf, M. P.; Semenkovich, C. F.; Jessberger, S., Metabolic control of adult neural stem cell activity by Fasn-dependent lipogenesis. Nature 2013, 493, 226-230. 21. Folmes, C. D.; Park, S.; Terzic, A., Lipid metabolism greases the stem cell engine. Cell Metabolism 2013, 17, 153-155. 22. Pandey, P. R.; Xing, F.; Sharma, S.; Watabe, M.; Pai, S. K.; Iiizumi-Gairani, M.; Fukuda, K.; Hirota, S.; Mo, Y. Y.; Watabe, K., Elevated lipogenesis in epithelial stem-like cell confers survival advantage in ductal carcinoma in situ of breast cancer. Oncogene 2013, 32, 51115122. 23. Chajes, V.; Cambot, M.; Moreau, K.; Lenoir, G. M.; Joulin, V., Acetyl-CoA carboxylase alpha is essential to breast cancer cell survival. Cancer Research 2006, 66, 5287-5294. 24. Baenke, F.; Peck, B.; Miess, H.; Schulze, A., Hooked on fat: the role of lipid synthesis in cancer metabolism and tumour development. Disease Models & Mechanisms 2013, 6, 13531363. 25. Menendez, J. A.; Lupu, R., Fatty acid synthase and the lipogenic phenotype in cancer pathogenesis. Nature Reviews Cancer 2007, 7, 763-777. 26. Milgraum, L. Z.; Witters, L. A.; Pasternack, G. R.; Kuhajda, F. P., Enzymes of the fatty acid synthesis pathway are highly expressed in in situ breast carcinoma. Clin. Cancer Res. 1997, 3, 2115-2120.


Page 35 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


27. Yahagi, N.; Shimano, H.; Hasegawa, K.; Ohashi, K.; Matsuzaka, T.; Najima, Y.; Sekiya, M.; Tomita, S.; Okazaki, H.; Tamura, Y.; Iizuka, Y.; Ohashi, K.; Nagai, R.; Ishibashi, S.; Kadowaki, T.; Makuuchi, M.; Ohnishi, S.; Osuga, J.; Yamada, N., Co-ordinate activation of lipogenic enzymes in hepatocellular carcinoma. Eur. J. Cancer 2005, 41, 1316-1322. 28. Lopez-Casillas, F.; Kim, K. H., Heterogeneity at the 5' End of Rat Acetyl-Coenzyme-a Carboxylase Messenger-RNA - Lipogenic Conditions Enhance Synthesis of a Unique Messenger-Rna in Liver. J. Biol. Chem. 1989, 264, 7176-7184. 29. Mao, J.; Chirala, S. S.; Wakil, S. J., Human acetyl-CoA carboxylase 1 gene: Presence of three promoters and heterogeneity at the 5 '-untranslated mRNA region. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 7515-7520. 30. Bochman, M. L.; Paeschke, K.; Zakian, V. A., DNA secondary structures: stability and function of G-quadruplex structures. Nat. Rev. Genet. 2012, 13, 770-780. 31. Murat, P.; Balasubramanian, S., Existence and consequences of G-quadruplex structures in DNA. Curr. Opin. Genet. Dev. 2014, 25, 22-29. 32. Maizels, N.; Gray, L. T., The G4 genome. PLoS Genet. 2013, 9, e1003468. 33. Ghosal, G.; Muniyappa, K., Hoogsteen base-pairing revisited: resolving a role in normal biological processes and human diseases. Biochem. Biophys. Res. Commun. 2006, 343, 1-7. 34. Balasubramanian, S.; Hurley, L. H.; Neidle, S., Targeting G-quadruplexes in gene promoters: a novel anticancer strategy? Nature Rev. Drug Discov. 2011, 10, 261–275. 35. Bugaut, A.; Balasubramanian, S., 5'-UTR RNA G-quadruplexes: translation regulation and targeting. Nucleic Acids Res. 2012, 40, 4727-4741. 36. Biffi, G.; Tannahill, D.; McCafferty, J.; Balasubramanian, S., Quantitative visualization of DNA G-quadruplex structures in human cells. Nature Chem. 2013, 5, 182-186.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 36 of 59

37. Lopes, J.; Piazza, A.; Bermejo, R.; Kriegsman, B.; Colosio, A.; Teulade-Fichou, M. P.; Foiani, M.; Nicolas, A., G-quadruplex-induced instability during leading-strand replication. EMBO J. 2011, 30, 4033-4046. 38. Wu, Y.; Brosh, R. M., Jr., G-quadruplex nucleic acids and human disease. FEBS J. 2010, 277, 3470-3488. 39. Lipps, H. J.; Rhodes, D., G-quadruplex structures: in vivo evidence and function. Trends Cell Biol.2009, 19, 414-422. 40. Melko, M.; Bardoni, B., The role of G-quadruplex in RNA metabolism: involvement of FMRP and FMR2P. Biochimie 2010, 92, 919-926. 41. Baral, A.; Kumar, P.; Halder, R.; Mani, P.; Yadav, V. K.; Singh, A.; Das, S. K.; Chowdhury, S., Quadruplex-single nucleotide polymorphisms (Quad-SNP) influence gene expression difference among individuals. Nucl. Acids Res. 2012, 40, 3800-3811. 42. Reddy, K.; Schmidt, M. H.; Geist, J. M.; Thakkar, N. P.; Panigrahi, G. B.; Wang, Y. H.; Pearson, C. E., Processing of double-R-loops in (CAG).(CTG) and C9orf72 (GGGGCC).(GGCCCC) repeats causes instability. Nucl. Acids Res.2014, 42, 10473-10487. 43. Siddiqui-Jain, A.; Grand, C. L.; Bearss, D. J.; Hurley, L. H., Direct evidence for a Gquadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription. Proc. Natl. Acad. Sci. U.S.A. 2002, 99, 11593-11598. 44. Rankin, S.; Reszka, A. P.; Huppert, J.; Zloh, M.; Parkinson, G. N.; Todd, A. K.; Ladame, S.; Balasubramanian, S.; Neidle, S., Putative DNA quadruplex formation within the human c-kit oncogene. J. Am. Chem. Soc. 2005, 127, 10584-10589. 45. Cogoi, S.; Xodo, L. E., G-quadruplex formation within the promoter of the KRAS protooncogene and its effect on transcription. Nucl. Acids Res. 2006, 34, 2536-2549.


Page 37 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


46. Patel, D. J.; Phan, A. T.; Kuryavyi, V., Human telomere, oncogenic promoter and 5'-UTR Gquadruplexes: diverse higher order DNA and RNA targets for cancer therapeutics. Nucl. Acids Res.2007, 35, 7429-7455. 47. Membrino, A.; Cogoi, S.; Pedersen, E. B.; Xodo, L. E., G4-DNA formation in the HRAS promoter and rational design of decoy oligonucleotides for cancer therapy. PLoS One 2011, 6, e24421. 48. Reddy, K.; Zamiri, B.; Stanley, S. Y.; Macgregor, R. B., Jr.; Pearson, C. E., The diseaseassociated r(GGGGCC)n repeat from the C9orf72 gene forms tract length-dependent uniand multimolecular RNA G-quadruplex structures. J. Biol. Chem. 2013, 288, 9860-9866. 49. Palumbo, S. L.; Ebbinghaus, S. W.; Hurley, L. H., Formation of a unique end-to-end stacked pair of G-quadruplexes in the hTERT core promoter with implications for inhibition of telomerase by G-quadruplex-interactive ligands. J. Am. Chem. Soc. 2009, 131, 10878-10891. 50. Lim, K. W.; Lacroix, L.; Yue, D. J.; Lim, J. K.; Lim, J. M.; Phan, A. T., Coexistence of two distinct G-quadruplex conformations in the hTERT promoter. J. Am. Chem. Soc. 2010, 132, 12331-12342. 51. Karsisiotis, A. I.; Hessari, N. M.; Novellino, E.; Spada, G. P.; Randazzo, A.; Webba da Silva, M., Topological characterization of nucleic acid G-quadruplexes by UV absorption and circular dichroism. Angew Chem. Int. Ed. Engl. 2011, 50, 10645-10648. 52. Wu, P.; Brand, L., Resonance energy transfer: methods and applications. Anal Biochem. 1994, 218,1-13. 53. Sen, D.; Gilbert, W., Formation of parallel four-stranded complexes by guanine-rich motifs in DNA and its implications for meiosis. Nature 1988, 334, 364-366.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 38 of 59

54. Neidle, S., The structures of quadruplex nucleic acids and their drug complexes. Curr. Opin. Struct. Biol. 2009, 19, 239-250. 55. Siddiqui-Jain, A.; Grand, C. L.; Bearss, D. J.; Hurley, L. H., Direct evidence for a Gquadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription. Proc. Natl. Acad. Sci. U. S. A. 2002, 99, 11593-11598. 56. Zamiri, B.; Reddy, K.; Macgregor, R. B., Jr.; Pearson, C. E., TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins. J. Biol. Chem. 2014, 289, 4653-4659. 57. Biffi, G.; Di Antonio, M.; Tannahill, D.; Balasubramanian, S., Visualization and selective chemical targeting of RNA G-quadruplex structures in the cytoplasm of human cells. Nature Chem. 2014, 6, 75-80. 58. Gonzalez, V.; Guo, K.; Hurley, L.; Sun, D., Identification and characterization of nucleolin as a c-myc G-quadruplex-binding protein. J. Biol. Chem. 2009, 284, 23622-23635. 59. Gonzalez, V.; Hurley, L. H., The c-MYC NHE III(1): function and regulation. Annu Rev Pharmacol. Toxicol. 2010, 50, 111-129. 60. Raiber, E. A.; Kranaster, R.; Lam, E,; Nikan, M.; Balasubramanian, S., A non-canonical DNA structure is a binding motif for the transcription factor SP1 in vitro. Nucl. Acids Res. 2012, 40, 1499-1508. 61. Maji, B.; Kumar, K.; Kaulage, M.; Muniyappa, K.; Bhattacharya, S., Design and synthesis of new benzimidazole-carbazole conjugates for the stabilization of human telomeric DNA, telomerase inhibition, and their selective action on cancer cells. J. Med. Chem. 2014, 57, 6973-6988.


Page 39 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


62. Yadav, V. K.; Abraham, J. K.; Mani, P.; Kulshrestha, R.; Chowdhury, S., QuadBase: genome-wide database of G4 DNA--occurrence and conservation in human, chimpanzee, mouse and rat promoters and 146 microbes. Nucl. Acids Res. 2008, 36, D381-385. 63. Sengupta, T. K.; Bandyopadhyay, S.; Fernandes, D. J.; Spicer, E. K., Identification of nucleolin as an AU-rich element binding protein involved in bcl-2 mRNA stabilization. J. Biol. Chem. 2004, 279, 10855-10863. 64. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 65. Han, H.; Hurley, L. H.; Salazar, M., A DNA polymerase stop assay for G-quadruplexinteractive compounds. Nucl. Acids Res. 1999, 27, 537-542. 66. Muniyappa, K.; Anuradha, S.; Byers, B., Yeast meiosis-specific protein Hop1 binds to G4 DNA and promotes its formation. Mol. Cell. Biol. 2000, 20, 1361-1369. 67. Papworth, C.; Bauer, J. C.; Braman, J.; Wright, D. A., Site-directed mutagenesis in one day with >80% efficiency. Strategies 1996, 9, 3-4. 68. Halder, K.; Benzler, M.; Hartig, J. S., Reporter assays for studying quadruplex nucleic acids. Methods 2012, 57, 115-121. 69. Yoon, S.; Lee, M. Y.; Park, S. W.; Moon, J. S.; Koh, Y. K.; Ahn, Y. H.; Park, B. W.; Kim, K. S., Up-regulation of acetyl-CoA carboxylase alpha and fatty acid synthase by human epidermal growth factor receptor 2 at the translational level in breast cancer cells. J. Biol. Chem. 2007, 282, 26122-26131. 70. Parkinson, G. N.; Lee, M. P. H.; Neidle, S. Crystal structure of parallel quadruplexes from human telomeric DNA. Nature 2002, 417, 876-880.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 40 of 59

71. Sengar, A.; Heddi, B.; Phan, A. T. n. Formation of G-quadruplexes in poly-G sequences: Structure of a propeller-type parallel-stranded G-quadruplex formed by a G15 stretch. Biochemistry 53, 7718-7723. 72. Agrawal, P.; Hatzakis, E.; Guo, K.; Carver, M.; Yang, D. Solution structure of the major Gquadruplex formed in the human VEGF promoter in K+: insights into loop interactions of the parallel G-quadruplexes. Nucl. Acids Res. 2013, 41, 10584-10592. 73. Lim, K. W.; Lacroix, L.; Yue, D. J. E.; Lim, J. K. C.; Lim, J. M. W.; Phan, A. T. Coexistence of two distinct G-quadruplex conformations in the hTERT promoter. J. Am. Chem. Soc. 2010, 132, 12331-12342. 74. Burge, S.; Parkinson, G. N.; Hazel, P.; Todd, A. K.; Neidle, S. Quadruplex DNA: sequence, topology and structure. Nucl. Acids Res. 2006, 34, 5402-5415. 75. Ambrus, A.; Chen, D.; Dai, J.; Jones, R. A.; Yang, D., Solution structure of the biologically relevant G-quadruplex element in the human c-MYC promoter. Implications for Gquadruplex stabilization. Biochemistry 2005, 44, 2048-2058. 76. Release, S., 3: Maestro, version 9.6; Schrödinger, LLC: New York, 2013. 77. Wang, J.; Wang, W.; Kollman, P. A.; Case, D. A., Automatic atom type and bond type perception in molecular mechanical calculations. J. Mol. Graph. Model. 2006, 25, 247-260. 78. Wang, J.; Wolf, R. M.; Caldwell, J. W.; Kollman, P. A.; Case, D. A., Development and testing of a general amber force field. J. Comput. Chem. 2004, 25, 1157-1174. 79. Krautler, V.; Van Gunsteren, W. F.; Hunenberger, P. H., A fast SHAKE: Algorithm to solve distance constraint equations for small molecules in molecular dynamics simulations. J. Comp. Chem. 2001, 22, 501-508.


Page 41 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


80. Schneider.T; Stoll, E., Molecular-Dynamics Investigation of Structural Phase-Transitions. Physical Review Lett. 1973, 31, 1254-1258. 81. Darden, T.; York, D.; Pedersen, L., Particle Mesh Ewald - an N.Log(N) Method for Ewald Sums in Large Systems. J. Chem. Phys. 1993, 98, 10089-10092. 82. Roe, D. R.; Cheatham, T. E., PTRAJ and CPPTRAJ: Software for Processing and Analysis of Molecular Dynamics Trajectory Data. J. Chem. Theory Comp. 2013, 9, 3084-3095. 83. Humphrey, W.; Dalke, A.; Schulten, K., VMD: Visual molecular dynamics. J. Mol.Graph. Modelling 1996, 14, 33-38 84. Cheatham, T. E.; Kollman, P. A., Molecular dynamics simulations highlight the structural differences among DNA:DNA, RNA:RNA, and DNA:RNA hybrid duplexes. J. Am. Chem. Soc. 1997, 119, 4805-4825. 85.

Pettersen, E. F.; Goddard, T. D.; Huang, C. C.; Couch, G. S.; Greenblatt, D. M.; Meng, E. C.; Ferrin, T. E., UCSF chimera - A visualization system for exploratory research and analysis. J. Comp. Chem.2004, 25, 1605-1612.

LEGENDS TO FIGURES Figure 1. Schematic diagram of ACC1 promoters showing G-rich sequences (pPY/pPu tract) with their position relative to the transcription start site (TSS). Figure 2. ACC1 PI and PII promoters fold into G-quadruplex DNA. A, The sequence of wild-type and mutant ACC1 promoters used in this study. ACC1 promoter I (25-mer) is characterized by five arrays of tandem guanines, whereas promoter II (25-mer) 41 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 42 of 59

contains 1 array of 3 G, 2 arrays of 4 G and one array of 5 G residues. The mutant forms of promoter I and II were generated by changing the indicated G residues to T residues, which are highlighted in red. The ODNs (shown in Fig. 1A) contain 3 residues flanked at each end of Grich tracts. B, CD spectra of wild-type and mutant forms of promoter I and promoter II in the presence of 120 mM KCl; red and black traces represent the CD spectra of wild-type and mutant forms, respectively. C, Thermal denaturation profiles of ACC1 promoter I and II sequences as measured by CD in presence of 100 mM KCl containing buffer. Here black, red, blue and green curves represents thermal denaturation profile with varying ODN conc. i.e. 2.5 µM, 5 µM, 7.5 µM and 10µM respectively. D, The relative mobility shifts of various forms of DNA formed by wild-type and mutant forms of ACC1 promoters. The position of substrates, intra- and intermolecular G-quadruplexes is indicated between the two panels. Higher and slower mobility bands correspond to the intra- and intermolecular G-quadruplex DNA, respectively. The closed triangle on the top of the gel denotes increasing concentrations of wild-type or mutant ODNs (promoter I: 50, 100, 150, 200, 250 and 300 nM, lanes 1-6 and 7-12, respectively; Promoter II: 50, 100, 150, 200 and 250, lanes 1-5 and 6-10, respectively). Figure 3. ACC1 PI and PII promoters fold into intramolecular G-quadruplex DNA. A, The sequence of ACC1 PI and PII promoter bearing 5' FAM donor and 3' TAMRA quencher used in this study. B, Intramolecular FRET exhibited by ACC1 promoter PI (i) and PII (ii) in the absence and presence of KCl. Samples contained the indicated ODN (200 nM) in 10 mM Tris-HCl (pH 7.4) 42 ACS Paragon Plus Environment

Page 43 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


in the absence (black line) or presence of 100 mM KCl (red line). Prior to FRET recordings, samples were heated at 95 °C for 5 min followed by slow cooling to 24 °C over a 24 h period. C, DMS methylation protection pattern of guanines of promoter PI (i) and promoter PII (ii) in the presence of 120 mM KCl. The protected guanine residues are highlighted in red. In case of promoter PI, we observed redundancy in the involvement of G residues in the formation of Gquadruplex DNA (highlighted in green). Lanes 1 and 2, C+T and A+G ladder, respectively; lane 3, DMS reaction performed in the absence of KCl; lanes 4-6, reaction performed in the presence of 120 mM KCl with increasing concentrations of DMS. (D) Proposed G-quadruplex DNA structures for ACC1 promoter PI and promoter PII based on DMS protection and CD spectroscopy assays. The positions of guanines involved in Gquadruplex DNA formation are marked. Arrows indicate the orientation of strands. Figure 4. (A) RMSD plots for the entire 50 ns final production run of the three G-quadruplex DNA models, Model-1, Model-2, and Model-3. (B) RMSD plots of guanine residues of the first, second, and third tetrad of each model. (C) RMSD plots of the first, second, and third loop of each model. Figure 5. Ensemble of last 100 ps structures of each of the models, (A) Model-1, (B) Model-2, and (C) Model-3 in the 50 ns final production run. Figure 6. Water Density Maps of (A) Model-1, (B) Model-2, and (C) Model-3 after 50 ns of final production run. Figure 7. (A) UV/vis absorption spectra of 5 µM TMPyP4 in a buffer containing 10 mM TrisHCl (pH 7.4), 120 mM KCl and 0.1 mM EDTA in the presence of increasing concentration of



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 44 of 59

promoter I G-quadruplex DNA. The individual spectral trace was obtained after the addition of each aliquot containing an equimolar amount of DNA (0.12 µM). The final trace was at 4.37 µM. The inset represents the corresponding saturation plot. (B) Fluorescence emission spectra of 0.8 µM of TMPyP4 in a buffer containing 10 mM Tris-HCl (pH 7.4), 120 mM KCl and 0.1 mM EDTA with increasing concentration of promoter I Gquadruplex DNA. The individual spectral trace was obtained after the addition of each aliquot containing an equimolar amount of DNA (0.17 µM). The final trace was at 1.17 µM. Figure 8. The formation of intramolecualr G-quadruplex DNA in ACC1 promoter II arrests primer extension catalyzed by Taq polymerase. Assay was performed as described under Materials and Methods. (A), Sequences of wild-type (WT) and mutant ACC1 promoters used in this study. The ODNs (62-mer) contained ACC1 promoter I and II G-rich sequence at the 5' end (highlighted in green) and additional residues at the 3' end. The mutant forms of promoters I and II were generated by changing the indicated G residues to T residues, which are highlighted in red. (B), Inhibition of primer extension catalyzed by Taq polymerase with promoter II as a function of KCl concentration. The position of primer, full-length product and the product terminated consequent to the formation of G-quarduplex DNA is indicated on the right-hand side. The mobility of marker ODNs are shown on the left hand-side. The open triangle on the top of the gel denotes increasing concentrations of KCl (5, 25, 50, 75 and 100 mM, lanes 2-6 and 7-11, respectively).


Page 45 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(C) (i)-(ii), TMPyP4 inhibits Taq polymerase catalyzed primer extension on ACC1 promoter I and II in a concentration dependent manner. The position of primer, full-length product and the product terminated consequent to the formation of G-quarduplex DNA is indicated on the righthand side. The closed triangle on the top of the gel denotes increasing concentrations of TMPyP4 (0, 0.5, 1. 1.5, and 2 mM, lanes 2-6 and 7-11), respectively. (D), MD simulated complex structures of TMPyP4 with ACC1 G-quadruplex DNA models, (A) Model-1, (B) Model-2, and (C) Model-3 revealing the mode of ligand-DNA interaction. Figure 9. Human nucleolin binds to the intramolecular G-quadruplex DNA formed by wild-type ACC1 promoter I and II in a concentration-dependent manner. (A) and (B), Representative gels showing binding of human nucleolin to the G-quadruplex DNA formed from ACC1 wild-type PI and PII promoters. The assay was performed as described under Materials and Methods. Reaction mixtures contained 20 mM Tris-HCl (pH 7.4) buffer, 120 mM KCl and 1 mM DTT, 1 nM 32P-labeled DNA in the absence (lane 1) or presence of nucleolin as indicated below: 40, 60, 80, 100, 120, 140, 155, 170, 185, 200 and 250 nM, lanes 2-11, respectively. (C) and (D), Representative gels showing binding of human nucleolin to the G-quadruplex DNA formed from ACC1 mutant PI and PII promoters. The closed triangle on the top of the gel denotes increasing concentrations of nucleolin. The position of free and nuleolin-bound DNA is indicated on right and left hand-side of the figure. Figure 10. ACC1 gene expression is negatively regulated by the formation of G-quadruplex DNA in its promoter.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 46 of 59

(A) Relevant portion of ACC1 PI and PII promoters containing G-rich sequences. The corresponding mutant promoters were generated by changing the indicated G residues to T residues by site-directed mutagenesis. Plasmid pACC1WTPI and pACC1WTPII contains Gquadruplex DNA forming sequence, while plasmids pACC1MtPI and pACC1MtPII contain mutant sequences. The point mutations abrogated the capacity of the sequence to fold into a Gquadruplex (see Fig. 2-3). (B) Results of dual luciferase assay with wild-type and mutant plasmids show that the activity of the ACC1 promoter I and II is increased by the presence of the point mutations that destabilize G-quadruplex formation. HeLa cells were cotransfected with wild-type and mutant plasmids independently and luciferase expression was measured after 24 h. Experiments were repeated in triplicate, and the data reflect average ± s.e. (C-D) TMPyP4, a known G-quadruplex-stabilizing porphyrin ligand, inhibits transcription of ACC1 in a concentration dependent manner. Transient transfection experiments in HeLa cells reveal the effect of increasing concentrations of TMPyP4 on luciferase expression driven by the wild-type ACC1 PI or PII promoters. The ordinate represents luciferase activity shown as a percentage relative to the control. Experiments were repeated in triplicate, and the data reflect average ± s.e. (E) CBM, a known G-quadruplex stabilizing ligand, inhibits transcription of ACC1 in a concentration dependent manner. Treatment of HeLa cells with increasing concentration of CBM for 24 hrs. followed by RT-PCR results reveals transcriptional repression in ACC1 expression. Figure 11. Model depicting a possible mechanism underlying the downregulatory effect of Gquadruplex DNA on ACC1 gene expression. Cartoon shows a part of the 5' region upstream of


Page 47 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ACC1 gene with promoter I and II, folded into intramolecular G-quadruplexes and transcription start site (TSS). ChIP assays have revealed that SREBP-1 and Sp1 bind to ACC1 promoter II and GC-rich regions, respectively (13, 18). In combination with other transcription factors such as AP1, SREBP, NF-Y, Sp1 positively regulates ACC1 gene expression at the transcriptional level. The existence of G-quadruplex DNA and binding of G4 DNA-specific proteins may affect the binding of these and other transcription factors to promoter I and II, and consequently, negatively regulate ACC1 gene expression.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 48 of 59

Table 1: Hoogsteen hydrogen bonding between Guanines involved in tetrad formation Model-1

I-II

II-III

III-IV

IV-I

T1

(4-8)33.36

(8-12)94.52

(12-16)76.92

(16-4)15.40

T2

(5-9)24.04

(9-13)83.72

(13-17)37.68

(17-5)15.00

T3

(6-10)71.60

(10-14)106.72

(14-18)42.00

(18-6)13.40

Model-2

I-II

II-III

III-IV

IV-I

T1

(8-12)67.92

(12-16)14.92

(16-20)20.44

(20-8)101.92

T2

(9-13)42.04

(13-17)13.76

(17-21)44.08

(21-9)79.28

T3

(10-14)35.52

(14-18)27.80

(18-22)81.92

(22-10)72.04

Model-3

I-II

II-III

III-IV

IV-I

T1

(5-9)67.67

(9-16)93.04

(16-20)37.81

(20-5)28.84

T2

(6-10)29.62

(10-17)39.88

(17-21)27.99

(21-6)31.11

T3

(7-11)91.21

(11-18)47.75

(18-22)22.65

(22-7)57.06

T1, T2, T3 represent first second and third tetrad respectively. I, II, III, IV denote first second third and fourth strand of guanine repeats. Values in brackets are two interacting guanines. Values outside the brackets denote the % occupancy of hydrogen bonding for respective guanine pair.


Page 49 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 2: Other hydrogen bonding interaction primarily among the 5' and 3'-end bases.

Model-1

%Occupancy

Model-2

%Occupancy

Model-3

%Occupancy

1-16

14.88

1-19

27.68

3-15

2.57

1-19

23.48

2-19

13.60

4-6

32.86

1-20

19.16

3-19

18.44

4-7

17.46

2-21

7.60

4-19

9.54

10-15

9.90

3-22

63.00

4-20

2.24

10-14

8.65

3-24

8.64

5-20

10.64

The numbering for each model in column (1, 3, 5) in indicate the residue number (considering 5′ to 3′ direction)



Figure 1 pPy/pPutract -208

TSS

-189

Promoter I -289

+1

GGGCGGGCGGGCGGGCGGG

pPy/pPu tract

TSS

-40

-59

Promoter II -442

+1 GGGGCGGGGCGGGGGCGGG TSS Promoter III

-180

No GC rich sequence +1

Figure 2A-D (A)

(B) Mutant Promoter I Wild type Promoter I

Promoter I WT

GCTGGGCGGGCGGGCGGGCGGGTGG

Promoter I Mutant

GCTTGTCTGTCTGTCTGTCTGTTGG

Promoter II WT

ACAGGGGCGGGGCGGGGGCGGGTCA

Promoter II Mutant ACATGTGCTGTGCTGTGTCTGTTCA

60

CD (mdeg)

60

Oligomer Sequence (5’-3’)

CD (mdeg)

Promoter

40

20

0

40

0

-20 250

300

350

(C) Promoter I

Promoter II

(D)

1.0

CD (Normalized)

0.8 0.6 0.4

5 uM G4 7.5 uM G4 10 uM G4

0.2 0.0 30

40

50

60

70

80

90 100

0 Temperature ( C)

Promoter II WT

0.8

250

300

350

Wavelength (nm)

Wavelength (nm)

1.0

Mutant Promoter II Wild type promoter II

20

-20

CD (Normalized)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 50 of 59

Promoter I

Mutant

WT

Mutant

0.6

Inter G4 Inter G4 Substrate Intra G4

0.4

5 uM G4 7.5 uM G4 10 uM G4

0.2 0.0 30

40

50

60

70

80

90 100

Temperature (0C)

12 3 4 5 6

7 8 9 10 11 12

1 2 3 4 5

6 7 8 9 10


Page 51 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3A-D



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 52 of 59

Figure 4A-C (A)

(B)

(C)

Figure 5A-C

(A)

(B)

(C)


Page 53 of 59

Figure 6A-C (B)

(A)

(C)

(A) 0.7 0.6 0.5

Promoter I-TMPyP4

1.0

(B)

0.9 0.8 0.7

5

6.0x10

0.6 0.5 0.4 0.0

0.2

0.4

0.6

0.8

1.0

[DNA]/[Ligand]

0.4 0.3 0.2

F. I. (a.u.)

A/A0 (λ = 420 nm)

Figure 7A-B

Absorbance

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


5

4.0x10

5

2.0x10

0.1 0.0 300

400

500

600

0.0 600

Wavelength (nm)

700

800

Wavelength (nm)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 54 of 59

Figure 8A-D (A) Promoter

Oligomer Sequence (5′-3′)

Promoter I WT

GCTGGGCGGGCGGGCGGGCGGGTGGCGGAGCGCGAGC CCCTCTAGCGGGACTAGGGAGAA

Promoter I Mutant

GCTTGTCTGTCTGTCTGTCTGTTGGCGGAGCGCGAGCCC CTCTAGCGGGACTAGGGAGAA

Promoter II WT

ACAGGGGCGGGGCGGGGGCGGGTCAGGCCCCTGAAGC CCCGCCCCTTCTCCGTGTGCCGG

Promoter II Mutant

ACATGTGCTGTGCTGTGTCTGTTCAGGCCCCTGAAGCCC CGCCCCTTCTCCGTGTGCCGG Wild-type PII

(B)

Mutant PII

5-100 mM KCl

5-100 mM KCl

M Full-length product 70-mer

5'

60-mer 50-mer 40-mer

3'

30-mer 3'

Primer

20-mer

1

(C) (i)

5'

Wild-type PI

2

3

Mutant PI

TMPyP4

4

5

6

7

(ii)

TMPyP4

8

9

10 11

Wild-type PII

Mutant PII

TMPyP4

TMPyP4 Full-length product 5'

3' 3' 5'

Figure 8C 1

2

3

Primer 4

5

6

7

8

9

10 11

1

2

3

4

5

6

7

8

9 10 11


Page 55 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 8D

(i)

(ii)

(iii)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 56 of 59

Figure 9A-D

(A)

Wild-type PI Nucleolin

(B)

Wild-type PII Nucleolin

G4 DNA protein complex

Free G4

(C)

1 2 3 4 5 6 7 8 9 10 11 1 2 3 4 5 6 7 8 9 10 (D) Mutant PI Mutant PII Nucleolin Nucleolin

Free G4

1 2 3 4 5 6 7 8 9 10 11 1 2 3 4 5 6 7 8 9 10 11


Page 57 of 59

Figure 10A-E

(A) 5’ –GCTGGGCGGGCGGGCGGGCGGGTGG- 3’ -Wild type promoter I 5’ -GCTGTGCGGGCGTGCGTGCGGGTGG- 3’ -Mutant 5’ –ACAGGGGCGGGGCGGGGGCGGGTCA- 3’ –Wild type Promoter II 5’ -ACAGTTGCGTTGCGGGGGCGGGTCA- 3’ -Mutant

4.0×10 0 6

2.6

2.0×10 0 6

9.7

1000000 0

Promoter 1 HeLa Cells

150

67%

100 50 0

0

Promoter II

% Luciferase expression

Promoter I

(C)

WT Mutant

3.0×10 0 6

0.1 1 10 25 TMPyP4 (µM)

(D) Promoter 2 HeLa Cells

150 100

84%

RLU/mg protein

(B)

% Luciferase expression

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


50 0

0

0.1 1 10 25 TMPyP4 (µM)

CBM

(E) ACC1 GAPDH C

5

10

20

µM



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 58 of 59

Figure 11

Promoter 1 -208 -442

TSS

TSS

-189 +1

-59

-40

+1

Promoter 2 ACC1

ACC1

Acetyl-CoA Carboxylase

Sp1 transcription factor


Page 59 of 59

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TOC Graphic

Promoter 1 -208 -442

TSS

TSS

-189 +1

ACC1

-59

-40

+1

Promoter 2 ACC1 Acetyl-CoA Carboxylase

Sp1 transcription factor


Discovery and Structural Characterization of G ... - ACS Publications

Recommend Documents