860
Bioconjugate Chem. 2008, 19, 860–865
Display of a Peptide Mimotope on a Crystalline Bacterial Cell Surface Layer (S-layer) Lattice for Diagnosis of Epstein–Barr Virus Infection Helga Tschiggerl,†,‡ Joanne L. Casey,§ Kathy Parisi,§ Michael Foley,§ and Uwe B. Sleytr*,† Center for NanoBiotechnology, University of Natural Resources and Applied Life Sciences, Gregor-Mendel-Strasse 33, A-1180 Vienna, Austria, Nano-S Biotechnologie GmbH, Gregor-Mendel-Strasse 33, A-1180 Vienna, Austria, and AdAlta Pty Ltd, Department of Biochemistry, La Trobe University, VIC 3086, Australia. Received September 12, 2007; Revised Manuscript Received November 8, 2007
Fusion proteins based on the crystalline bacterial cell surface layer (S-layer) proteins SbpA from Bacillus sphaericus CCM 2177 and SbsB from Geobacillus stearothermophilus PV72/p2 and a peptide mimotope F1 that mimics an immunodominant epitope of Epstein–Barr virus (EBV) were designed and overexpressed in Escherichia coli. Constructs were designed such that the peptide mimotope was presented either at the C-terminus (SbpA/F1) or at the N-terminus (SbsB/F1) of the respective S-layer proteins. The resulting S-layer fusion proteins, SbpA/F1 and SbsB/F1, fully retained the intrinsic self-assembly capability of the S-layer moiety into monomolecular lattices. As determined by immunodot assays and ELISAs using monoclonal antibodies, the F1 mimotope was wellpresented on the outer surface of the S-layer lattices and accessible for antibody binding. Further comparison of the two S-layer fusion proteins showed that the S-layer fusion protein SbpA/F1 had a higher antibody binding capacity than SbsB/F1 in aqueous solution and in immune sera, illustrating the importance of epitope orientation on the performance of solid-phase immunoassays. To assess the diagnostic values of S-layer mimotope fusion protein SbpA/F1, we screened a panel of 83 individual EBV IgM-positive, EBV negative, and potential crossreactive sera for their reactivities. This resulted in 98.2% specificity and 89.3% sensitivity, and furthermore no cross-reactivity with related viral disease states including rheumatoid factor was observed. This study shows the potential of S-layer fusion proteins as a matrix for site-directed immobilization of small ligands in solid-phase immunoassays using EBV diagnostics as a model system.
INTRODUCTION The use of peptide epitopes as diagnostic antigens in commercial diagnostics is a promising approach toward simpler and cheaper ELISA-based diagnostic assays. Diagnostic antigens may appear as complexes of more than one protein that are often highly glycosylated; therefore, it would be highly advantageous if, instead of the whole protein, one or more peptides mimicking diagnostically important epitope(s) could be used (1). Optimal presentation of peptide ligands is essential for the sensitivity of detection in solid-phase immuno-assays like ELISA. Peptides have to be immobilized in such a way that their threedimensional structure, functionality, and binding sites are retained (2). Conventional immobilization procedures for small ligands used in ELISAs are based on covalent binding and adsorption/absorption of peptides on a solid surface. However, the accessibility of the peptide for capture of target antibodies has been recognized as the central problem of immobilized peptide ligands. For better exposition, spacer molecules, e.g., long alkyl chains, polyamino acids, or proteins, can be introduced, but common to all these spacers is nonspecific adsorption and overflexibility that may counteract the exposition of the ligands (3, 4). Furthermore, since the peptides are attached on the surface in random orientation, the signal-to-noise ratio can be high due to nonspecific binding (5). * Corresponding author. Center for NanoBiotechnology, University of Natural Resources and Applied Life Sciences, Gregor-MendelStrasse 33, A-1180 Vienna, Austria. Tel: +43-1-47654 2201, Fax: +431-4789112, E-mail:
[email protected]. † University of Natural Resources and Applied Life Sciences. ‡ Nano-S Biotechnologie GmbH. § AdAlta Pty Ltd.
The S-layer self-assembly systems introduce new possibilities for site-directed peptide epitope immobilization. As a novel approach, we have designed two chimeric proteins by fusing a peptide epitope to crystalline bacterial cell surface (S-layer) proteins. The suitability of S-layer protein lattices as matrices for the covalent immobilization of peptides has already been demonstrated for immunochemical-based assays such as ELISA (6–9). S-layers, in general, are monomolecular proteinaceous arrays that represent the outermost cell envelope component of many prokaryotic organisms (10–14). They are composed of identical (glycol) protein species that are aligned into 2D crystalline arrays. Isolated S-layer subunits usually have the intrinsic capability to self-assemble in suspension, on the air–liquid interface, on lipid films, or on solid supports (12, 13, 15, 16). By genetic engineering, discrete functions could be introduced into S-layer proteins (17–26). On the basis of the high density and regular display of the introduced functions, a broad spectrum of applications of S-layer fusion proteins is envisaged, particularly in the fields of biotechnology, molecular nanotechnology, and biomimetics (14, 16, 27). Regarding peptide epitope immobilization, the advantages offered by the S-layer self-assembly system are (i) the requirement of only a simple, one-step incubation process for site-directed immobilization without preceding surface activation of the support, (ii) the provision of a cushion to the peptide epitope through the S-layer moiety of the fusion protein preventing denaturation, and precluding a loss of detection sensitivity upon immobilization, (iii) the principle applicability of the “S-layer tag” to any peptide epitope, and (iv) the high flexibility for variation of peptide epitope groups within a single S-layer array by cocrystallization of different peptide epitope/S-layer fusion proteins.
10.1021/bc7003523 CCC: $40.75 2008 American Chemical Society Published on Web 04/01/2008
S-Layer Mimotope Fusion Protein
In this study, the feasibility of fusing a peptide epitope to both the C-terminus and the N-terminus of an S-layer protein was investigated. For the setup of S-layer fusion proteins, two different types of proteins were used as S-layer protein moieties. The 200 amino acid deletion mutant of the 1268 amino acid S-layer protein SbpA of Bacillus sphaericus CCM 2177 (MW: 109.9 kDa) was chosen to fuse via its N-terminus toward the S-layer protein. This approach was based on previous structure–function studies revealing that the C-terminal deletion of SbpA resulted in a significant increase of the spatial accessibility of the C-terminus, while fully retaining the self-assembly capability of the proteins into a square (p4) S-layer lattice with a center-to-center spacing of the tetrameric morphological units of 13.1 nm (Figure 2A, inset) (18). An advantage of the SbpA system for nanobiotechnological applications is the dependence of its in Vitro recrystallization on the presence of calcium ions, thus allowing control over lattice formation by varying the calcium ion concentration (28). Furthermore, the peptide epitope was attached to the N-terminus of mature full-length S-layer protein SbsB of Geobacillus stearothermophilus PV72/p2 (MW: 95.0 kDa). SbsB is generated from a 920 amino acid long preprotein by cleavage of a 31-aa signal sequence and assembles into an oblique (p1) lattice type with the lattice parameters a ) 10.4 nm, b ) 7.9 nm, and base angle γ ) 81° (Figure 2B, inset) (29). An understanding of the protein’s structure–function relationship was gained in a preliminary study from the production and analysis of truncated forms, sequence analysis, and electron microscopy. The knowledge was used to select sequence positions for functional fusion (24, 29, 30). As a peptide epitope fusion partner, we selected a 20 amino acid long peptide (F1) that mimics an immunodominant epitope of Epstein–Barr virus (EBV). In our previous study, we showed that the F1 mimotope can be used for the detection of IgM antibodies typically generated after infection with EBV. F1 was selected from a random peptide library displayed on phage by binding to the parent antibody thereby mimicking the threedimensional conformational features of the epitope (1). The monoclonal antibody was generated by immunizing mice with crude EBV antigen. The exact antigen that the F1 peptide mimics is not known. In this study, we constructed S-layer/F1 peptide fusion proteins to investigate the presentation and orientation of the peptide mimotope within the S-layer lattice and have characterized the structure of the lattices. Following the successful proof of concept studies, this article deals with the investigation of the suitability of the system for diagnostic purposes. Therefore, we have also screened a panel of EBV clinical samples to evaluate the performance of the S-layer/F1 fusion proteins in diagnosis of Epstein–Barr virus infection.
EXPERIMENTAL PROCEDURES Cloning of the Chimeric SbpA/F1 and SbsB/F1 Genes. Two constructs were synthesized with F1 peptide fused at the C-terminus (SbpA/F1) and F1 fused to the N-terminus (SbsB/ F1) using pairs of complementary oligonucleotides. These were annealed to generate 10 amino acid inserts containing a (gly)4 linker with the appropriate overhang for the ligation into restriction sites BamHI-XhoI and NcoI-EcoRI (Table 1). For annealing, an equimolar mixture of one pair of phosphorylated oligonucleotides was heated to 98 °C for 2 min and cooled slowly to room temperature, allowing the complementary sequences to anneal. The two double-stranded inserts, SbpA/ F1 and SbsB/F1, phosphorylated at both 5′-termini and, with the appropriate overhang at each end, were integrated into a pET28a (+) vector (Novagen), which contained the truncated S-layer protein gene SbpA93–3204 with BamHI-XhoI sites and SbsB96–2760 with NcoI-EcoRI sites, respectively (18). Digestion of DNA with restriction endonucleases, separation of DNA
Bioconjugate Chem., Vol. 19, No. 4, 2008 861 Table 1. Amino Acid Sequence of F1 Mimotope Fused to the S-Layer Proteinsa peptide
amino acid sequence
F1
-YTDSSMAVTLMKFASNFLF-
oligonucleotide Oligo_SbsB/NcoI Oligo_SbsB/EcoRI Oligo_SbpA/BamHI Oligo_SbpA/XhoI
base sequence (5′-3′) CATGTATACGGATAGCAGTATGGCTGTTAC TCTTATGAAGTTCGCTTCTAATTTTCTCT TTGGGGGGGGGGGGG AATTCCCCCCCCCCCCCAAAGAGAAAATT AGAAGCGAACTTCATAAGAGTAACAGCC ATACTGCTATCCGTATA GATCCGGGGGGGGGGGGGCGTATACGGAT AGCAGTATGGCTGTTACTCTTATGAAGTT CGCTTCTAATTTTCTCTTTTAAC TCGAGTTAAAAGAGAAAATTAGAAGCGAA CTTCATAAGAGTAACAGCCATACTGCT ATCCGTATACGCCCCCCCCCCCCCG
a
Base sequence of oligonucleotides used to generate the F1 encoding gene.
fragments by agarose gel electrophoresis, ligation of DNA fragments, and transformation procedures were performed as described by Sambrook (31). DNA fragments were recovered from agarose gels by Qiaex II gel extraction kit (QIAgen). The constructs SbpA93–3204/F1 and SbsB96–2760/F1 were transformed into E. coli DH10b cells (Invitrogen) by electroporation. Overexpression and Purification of SbpA/F1 and SbsB/ F1 Fusion Proteins. S-layer fusion proteins were overexpressed in E. coli BL21(DE3)star cells (Invitrogen) in a 4-l fermenter according to the pET System Manual (Novogen) and monitored by SDS-PAGE with Coomassie staining (32). For isolation of SbpA/F1 and SbsB/F1 proteins, the B-PER bacterial protein extraction reagent (Pierce) was used as an efficient method of extracting proteins from bacteria following the protocol provided by the manufacturer. The S-layer fusion proteins accumulated in the insoluble fraction and were extracted with 50 mM TrisHCl/150 mM NaCl/5 M guanidine hydrochloride (GHCl) buffer pH 7.2. The suspension was then centrifuged at 36 000g for 30 min at 4 °C, and the supernatant containing the S-layer fusion protein was diluted 1:2 with 50 mM Tris-HCl buffer pH 7.2. The clear solution was subjected to permeation chromatography (GPC) using a Superdex 200 column (Pharmacia) equilibrated in 2.5 M GHCl in 50 mM Tris-HCl buffer pH 7.2. Fractions belonging to the peak corresponding to the expected molecular weight were pooled and dialyzed against four changes of MilliQ water for 18 h at 4 °C. Following dialysis, the protein solution was lyophilized and stored at –20 °C. Self-Assembly and Recrystallization Properties of the S-Layer Fusion Proteins. In order to investigate the capability of the S-layer fusion protein, SbpA/F1 and SbsB/F1, to selfassemble in solution a series of refolding steps were carried out. Purified fusion proteins (3 mg) were dissolved in 1 mL of 5 M GHCl in 0.5 mM Tris-HCl, pH 7.2, and the solution was dialyzed against 10 mM CaCl2 for 18 h at 4 °C with 5 buffer changes in the first 6 h. S-layer self-assembly products were adsorbed onto EM grids coated with pioloform and carbon. Negative staining was performed with uranylacetate (2% in distilled water, pH 4.3) for 2 min. Monomeric protein solutions of SbpA/F1 and SbsB/F1 were obtained after dialysis with 3 buffer changes of the GHCl extract against distilled water for 3 h at 4 °C and centrifugation of the dialysate at 16 000g for 5 min at 4 °C (AvantiJ-25, Beckman Coulter). Recrystallization of SbpA/F1 and SbsB/F1 monomers on 300 mesh copper grids, coated with pioloform and carbon, was investigated by transmission electron microscopy (33). For recrystallization on silicon wafers with a native silicon oxide layer (p-type, 100 orientation; 7 × 7 mm; IMEC) and polystyrene slides (Bilek), wafers and slides were washed with 70% ethanol immersed with 100 µL
862 Bioconjugate Chem., Vol. 19, No. 4, 2008
Figure 1. (A) SDS-PAGE analysis after Coomassie staining. Lane 1, purified SbpA/F1 fusion protein (MW: 112.4 kDa); lane 2, benchmark ladder (All blue, Biorad laboratories); lane 3, purified SbsB/F1 fusion protein (MW: 97.5 kDa). (B) Immunodot analysis of SbsB/F1 (1) and SbpA/F1 (2) of self-assembly products (SA), soluble S-layer fusion protein (S), and sole S-layer protein SbsB and SbpA, respectively, as control (C).
SbpA/F1 and SbsB/F1 (at 0.1 mg/mL) in 0.5 mM Tris-HCl/10 mM CaCl2, pH 9.0, and incubated at 25 °C for 4 h. Atomic force microscopy (AFM) analysis was performed as described previously (28). Immunodot Assays for Investigation of the Accessibility of Fused Mimotopes. To investigate the accessibility of the fused F1-domain in the water-soluble and recrystallized S-layer fusion proteins, 20 µL of SbpA/F1 and SbsB/F1 with an S-layer content of 1 mg/mL was dried onto a nitrocellulose membrane. After blocking with 2% Top Block (derivative of gelatine to block unspecific binding sites on surfaces, Fluka) in Tris-buffered saline (TBS) and incubation with 20 ng F1 monoclonal antibody (mAb) in 5 mL of TBS containing 2% Top Block with gentle agitation for 1 h at 25 °C, the membrane was washed three times with 0.5% Tween in TBS and subsequently incubated with an anti-Mouse IgG (whole molecule) alkaline phosphatase conjugate (antimouse AP, Sigma) diluted 1:5000 in blocking solution with gentle agitation for 1 h at 25 °C. After three further washing steps, detection was accomplished by treatment with 5-brom-4-chloro-3-indolyl phosphate and nitroblue tetrazolium chloride (BCIP/NBT, Roche). Reactivity of F1 in SbpA/F1 and SbsB/F1 Fusions by ELISA. The presence of the F1 moiety in the S-layer fusion proteins was confirmed by performing ELISAs. S-layer fusion proteins (200 µL at 0.1 mg/mL) were coated onto microtiter plates (Greiner Bio-one) in 0.5 mM Tris-HCl/10 mM CaCl2, pH 9.0, at 25 °C with gentle agitation for 4 h. For stabilization, the coated plates were incubated with a biomolecular stabilizator (StabilGuard, Surmodics) diluted 1:1 with phosphate buffered saline containing 0.1% Triton X-100 (PBS/ Triton) for 4 h at 25 °C. Subsequently, the microtiter plates were dried overnight at 37 °C. For ELISA, the coated microtiter plates were blocked with 2% Top Block in PBS/Triton overnight at 4 °C. Subsequently, 100 µL per well of serial dilutions of anti-F1 antibody in PBS/Triton containing 2% Top Block (w/ v) were added for 1 h with gentle agitation. The plates were washed three times with PBS/Triton and 110 µL per well antimouse peroxidase conjugate (Sigma) diluted 1: 2000 in PBS/ Triton containing 2% Top Block was added and incubated as above. Subsequently, the plates were washed again as above, and the ELISA was developed with 3,3′,5,5′-tetramethylbenzidine substrate (TMB, Sigma). All samples were analyzed in duplicate, and wells coated with the wild-type S-layer protein SbpA without F1 peptide were used as controls.
Tschiggerl et al.
Clinical Samples. Individual human serum samples were obtained from Queensland Medical Laboratory (Brisbane, Australia), and these had been previously tested with a commercial kit for EBV diagnosis. Samples (n ) 28) defined as IgM positive were collected from individuals with recent or early-stage infectious mononucleosis. Negative sera (n ) 40) were obtained from patients without EBV IgM or EBV IgG antibodies. Putative cross-reactive sera (n ) 15) were also obtained that may cause false positive readings in EBV diagnostic tests; we analyzed 4 Parvovirus (Parvo), 2 Herpes Simplex virus (HSV), 3 cytomegalovirus (CMV), 3 Varicella Zoster (Zoster), and 2 Rheumatoid factor (RF) samples. Screening of Clinical Samples by ELISA. Coated plates were blocked with 200 µL/well 2% BSA/PBS Tween 20 (0.1%) overnight at room temperature and washed twice with PBSTween to remove blocking agent. Serum samples were diluted 1/100 in fish gelatin diluent (PBS containing 2% fish gelatin [Sigma], 1% Tween-20, and 1% bovine serum albumin) and 100 µL applied to blocked wells in duplicate; the plate was incubated for 1 h shaking. Wells were washed 5 times with PBSTween, and 100 µL per well of sheep antihuman IgM conjugated to horse radish peroxidase (HRP, Chemicon) at 1/3500 dilution in fish gelatin diluent was added. After 1 h incubation and washing as above, bound IgM antibodies were detected with TMB substrate. All samples were analyzed in duplicate, and wells coated with the wild type S-layer protein SbpA without F1 peptide were used as controls.
RESULTS AND DISCUSSION Cloning of the Chimeric S-Layer Fusion Proteins SbpA/ F1 and SbsB/F1. Studies of the structure–function relationship of the S-layer proteins SbpA of Bacillus sphaericus CCM 2177 and SbsB Geobacillus stearothermophilus PV72/p2 were considered as presupposition for the construction of two novel S-layer fusion proteins, which retained assembly and recrystallization properties of the S-layer moiety, as well as the functionality of the fused peptide sequence (17–26). In attempt to optimize peptide presentation, a C-terminally truncated SbpA form and the full-length S-layer protein SbsB were selected as base forms for the construction of S-layer fusion proteins comprising the sequence of the 20-aa-long peptide F1 which mimics an immunodominant epitope of Epstein–Barr virus (EBV). Two inserts encoding F1 peptide with overhangs of respective restriction sites were derived from alignment of two pairs of oligonucleotides. The inserts were ligated via the corresponding restriction sites into plasmid pET-28 (+)-SbpA93–3204 and plasmid pET-28 (+)-SbsB96–2760, containing the encoding sequence of the C-terminally truncated form of S-layer protein SbpA and the full-length S-layer protein SbsB, respectively. Sequence accuracy of the two S-layer mimotope fusion protein genes was proven by the sequencing service of Invitrogen. Expression, Isolation, and Purification of the Chimeric S-Layer Fusion Proteins SbpA/F1 and SbsB/F1. The S-layer/ F1 fusion proteins were overexpressed in E. coli BL21Star (DE3) cells harboring pET-28 (+)-SbpA93–3204/F1 and pET-28 (+)-SbsB96–2760/F1, respectively. For isolation of SbpA/F1 and SbsB/F1, the biomass harvested from a 3-l expression culture was treated with B-PER reagent. As previously observed for the sole recombinant S-layer proteins, the fusion proteins accumulated as inclusion bodies (18). SbpA/F1 and SbsB/F1 were extracted by treatment with 5 M GHCl (3 mL g-1 inclusion bodies) and finally enriched by GPC to high purity with overall yields of purified, monomeric protein chimera of 0.44 g (SbpA/ F1) and 0.21 g (SbsB/F1) per liter of E. coli BL21Star(DE3) expression culture. The molecular masses of the purified chimeric proteins shown on SDS PAGE corresponded well to
S-Layer Mimotope Fusion Protein
Bioconjugate Chem., Vol. 19, No. 4, 2008 863
Figure 2. Atomic force microscopical images of the square lattice of SbpA/F1 (A) and the oblique lattice of SbsB/F1 (B) recrystallized on polystyrene slides. Bar, 100 nm.
Figure 3. IgG binding capacity (F1 mAb offered: µg/mL) of S-layer mimotope fusion proteins SbpA/F1 and SbsB/F1 recrystallized on microtiter plates in comparison to wild-type S-layer protein SbpA.
the calculated molecular masses of 112.4 kDa (SbpA/F1) and 97.5 kDa (SbsB/F1) shown in Figure 2A. Investigation of the Self-Assembly Properties of the SLayer Fusion Proteins. Triggered by the S-layer moiety, the S-layer fusion proteins were capable of intrinsically selfassembling in Vitro into flat sheets. The electron micrographs of negatively stained preparations clearly revealed the formation of S-layer self-assembly products of both S-layer fusion proteins in solution. The S-layer fusion protein SbpA/F1 exhibited the square lattice structure of native SbpA with a center-to-center spacing of tetrameric units of 13.1 nm (12). S-layer fusion protein SbsB/F1 showed the typical oblique lattice characteristic of native SbsB with the lattice parameters a ) 10.4 nm, b ) 7.9 nm, and base angle γ ) 81° (13) (electron micrographs not shown). Investigations of Accessibility of Fused Mimotope Groups. Dot blot assays were performed to investigate the accessibility of the fused F1 for binding to IgG in monomeric and selfassembled S-layer fusion proteins. Immunodot experiments showed that the mimotope groups of the S-layer fusion proteins SbpA/F1 and SbsB/F1 were clearly accessible for IgG binding. According to the dots intensities, alignment of the mimotopes within the protein lattice resulted in better accessibility for IgG binding than when provided as monomeric S-layer fusion protein (Figure 1B). Immobilization of the S-Layer Fusion Protein on Solid Supports. The capability of the two S-layer fusion proteins, SbpA/F1 and SbsB/F1, to recrystallize on solid supports was confirmed by AFM evidence. On silicon wafers (data not shown) as well as on polystyrene slides which present the material of ELISA wells, the S-layer fusion proteins exhibited the square (Figure 2A) and oblique (Figure 2B) lattice structures characteristic of native S-layer protein SbpA and SbsB, respectively. These microscopic analyses confirmed that the obtained S-layer
fusion proteins can be considered model systems for the S-layerbased site-directed immobilization of small peptides used in diagnostics. Investigation of the Reactivity of F1 in SbpA/F1 and SbsB/F1 Fusions by ELISA. Due to the specific physicochemical properties of the S-layer moieties (18), the S-layer fusion proteins were recrystallized onto microtiter wells, thereby exposing the F1 moiety at the C- or N-terminus in SbpA/F1 and SbsB/F1, respectively. The defined orientation of SbpA/F1 and SbsB/F1 was demonstrated via ELISA techniques that confirmed the ability of the F1 mimotope to bind parent F1 mAb in the formed monolayers (Figure 3). The S-layer fusion protein SbpA/F1 showed a better antibody binding capacity than S-layer fusion protein SbsB/F1 as shown by higher binding to the parent F1 mAb. The wild-type S-layer protein SbpA/wt chosen as the blank did not show any nonspecific binding of F1 mAb, giving a good signal-to-noise ratio (Figure 3). We also compared SbpA/F1 and SbsB/F1 with a small set of EBV clinical samples. It was apparent in Figure 4A that F1 peptide when attached to SbpA was superior for recognizing IgM antibodies in the sera of patients with EBV. The better performance of the SbpA-based S-layer fusion protein was likely to be caused by the different molecular orientation of the mimotope F1 within the S-layer lattice. Fused via its N-terminus, the mimotope could fully deploy its functionality as IgM antibodies recognized this peptide conformation preferentially. The results obtained with the two different S-layer systems refer to different accessibilities of the functional groups within different S-layer lattices. SbpA/F1 for Diagnosis of EBV. According to the data above, a more accurate assessment of the diagnostic value of the S-layer fusion protein rSbpA/F1 with a larger panel of positive, negative, and putative cross-reactive sera was performed. S-layer fusion protein SbpA/F1 was used in ELISAs as a solid phase for capture of IgM antibodies in clinical samples obtained from patients with EBV. To correct for background levels, the reactivity to SbpA/wt was also measured, and these values were subtracted from the SbpA/F1 readings. We analyzed 28 individual EBV samples and could identify IgM antibodies in 25 of these, resulting in 89.3% sensitivity (Figure 4B). Forty negative sera were analyzed and only 1 false positive was observed (98.2% specificity). In addition, very low reactivity was observed in 15 putative cross-reactive samples including rheumatoid factor, which is a common false positive in many commercial diagnostic tests (1). These results were in good accordance with currently used commercially available assay systems based on the capture of IgM antibodies using complex EBV antigens (34). Due to the
864 Bioconjugate Chem., Vol. 19, No. 4, 2008
Tschiggerl et al.
mimotope on planar surfaces. Linking the mimotope to the S-layer protein resulted in a biological function comparable to currently used commercially available assay systems using complex EBV antigens. This immobilization technology is applicable to any peptide and can be important for the development of novel diagnostic assays. Furthermore, this technology may facilitate the use of peptides as surrogate antigens in diagnostic assay.
ACKNOWLEDGMENT We wish to thank Graham Street of Queensland Medical laboratory (Brisbane, Australia) for providing the clinical samples.
LITERATURE CITED
Figure 4. Screening of clinical samples using S-layer/F1 fusion proteins. (A) Detection of IgM antibodies in individual EBV-positive sera with SbpA/F1 and SbsB/F1 compared to wild-type SbpA/wt containing no F1 peptide, by ELISA. Mean values are plotted; error bars indicate the ranges of individual values. (B) ELISA showing the reactivity of SbpA/ F1 fusion protein with EBV IgM positive (n ) 28), negative (n ) 40), and sera that could potentially be cross-reactive (n ) 15): Parvovirus (Parvo, n ) 4), Herpes Simplex virus (HSV, n ) 2), cytomegalovirus (CMV, n ) 4), Varicella Zoster (Zoster, n ) 3), and Rheumatoid factor (RF, n ) 2). Absorbencies for SbpA/F1 were subtracted from SbpA/ wt readings and plotted. The cutoff level is defined as the mean of the negative population (n ) 40) + 3 SD, shown as a horizontal line in the dot plot. The cutoff value for SbpA/F1 was 0.18.
high sensitivity and specificity of S-layer-based solid-phase immunoassays, S-layer proteins can be used as an immobilization matrix in ELISA-based diagnostics (9). Antibody capture with surface-displayed peptides is crucially affected by the accessibility of key residues of peptide ligands (35).The presentation of the small mimotope sequence within the S-layer lattice led to accurate accessibility and consequently reactivity of the displayed peptides. Furthermore, immobilization of peptides may cause partial denaturation at the site of adhesion to the support (5). It is conceivable that, with S-layer fusion proteins, the S-layer moiety acts as a cushion preventing denaturation of the mimotope upon immobilization.
CONCLUSION The data presented here clearly demonstrate that S-layer-based self-assembly systems for functionalizing solid supports could have importance for the introduction of small peptide mimotopes in diagnostic assays. By exploiting the intrinsic self-assembly property of the S-layer protein moiety, the chimeric protein SbpA/F1 was used for spatial control over the display of the
(1) Casey, J. L., Coley, A. M., Street, G., Parisi, K., Devine, P. L., and Foley, M. (2006) Peptide mimotopes selected from random peptide library for diagnosis of Epstein-Barr virus infection. J. Clin. Microbiol. 44, 764–771. (2) Angenendt, P. (2005) Progress in protein and antibody microarray technology. Drug DiscoVery Today 10, 503–511. (3) Hahn, R., Berger, E., Pflegerl, K., and Jungbauer, A. (2003) Directed immobilization of peptide ligands to accessible pore sites by conjugation with placeholder molecule. Anal. Chem. 75, 543–548. (4) Hermanson, G. T., Mallia, A. K., and Smith, P. K. (1992) Immobilization Affinity Ligand Techniques. Academic Press Inc., San Diego, CA. (5) Zhu, H., and Snyder, M. (2003) Protein chip technology. Curr. Opin. Chem. Biol. 7, 55–63. (6) Breitwieser, A., Kupcu, S., Howorka, S., Weigert, S., Langer, C., Hoffmann-Sommergruber, K., Scheiner, O., Sleytr, U. B., and Sára, M. (1996) 2-D protein crystals as an immobilization matrix for producing reaction zones in dipstick-style immunoassays. Biotechniques 21, 918–925. (7) Breitwieser, A., Mader, C., Schocher, I., Hoffmann-Sommergruber, K., Aberer, W., Scheiner, O., Sleytr, U. B., and Sára, M. (1998) A novel dipstick developed for rapid Bet v 1-specific IgE detection: recombinant allergen immobilized via a monoclonal antibody to crystalline bacterial cell-surface layers. Allergy 53, 786–793. (8) Sleytr, U. B., and Sára, M. (1997) Bacterial and archaeal S-layer proteins: structure-function relationships and their biotechnological applications. Trends Biotechnol. 15, 20–26. (9) Völkel, D., Zimmermann, K., Breitwieser, A., Sára, M., Pable, S., Glatzl, M., Scheiflinger, F., Schwarz, H. P., Sleytr, U. B., and Dorner, F. (2003) Immunochemical detection of prion protein on dipsticks prepared with crystalline bacterial cell-surface layers. Transfusion 43, 1677–1681. (10) Sára, M., and Sleytr, U. B. (2000) S-Layer proteins. J. Bacteriol. 182, 859–68. (11) Sleytr, U. B., and Beveridge, T. J. (1999) Bacterial S-layers. Trends Microbiol. 7, 253–260. (12) Sleytr, U. B., Messner, P., Pum, D., and Sára, M. (1999) Crystalline bacterial cell surface layers (S-layers): from supramolecular cell structure to biomimetics and nanotechnology. Angew. Chem., Int. Ed. 38, 1034–1054. (13) Sleytr, U. B., Sara, M., Pum, D., and Schuster, B. (2005) Crystalline bacterial cell surface layers (S-layers): a versatile selfassembly system, In Supramolecular Polymers (Ciferri, A., Ed.) pp 583–612, CRC Press LLC, Boca Raton, FL. (14) Sleytr, U. B., Sára, M., Pum, D., and Schuster, B. (2002) Molecular nanotechnology and nanobiotechnology with twodimensional protein crystals (S-layers), In Nano-Surface Chemistry (Rosoff, M., Ed.) pp 333–389, Marcel Dekker Inc., New York. (15) Sleytr, U. B., Egelseer, E., Ilk, N., Pum, D., and Schuster, B. (2007) S-layers as a basic building block in a molecular construction kit. FEBS J. 274, 323–334.
S-Layer Mimotope Fusion Protein (16) Sleytr, U. B., Huber, C., Ilk, N., Pum, D., Schuster, B., and Egelseer, E. (2007) S-layers as a tool kit for nanobiotechnological applications. FEMS Microbiol. Lett. 267, 131–144. (17) Ilk, N., Küpcü, S., Moncayo, G., Klimt, S., Ecker, R. C., Hofer-Warbinek, R., Egelseer, E. M., Sleytr, U. B., and Sára, M. (2004) A functional chimaeric S-layer-enhanced green fluorescent protein to follow the uptake of S-layer-coated liposomes into eukaryotic cells. Biochem. J. 379, 441–448. (18) Ilk, N., Völlenkle, C., Egelseer, E. M., Breitwieser, A., Sleytr, U. B., and Sára, M. (2002) Molecular characterization of the S-layer gene, sbpA, of Bacillus sphaericus CCM 2177 and production of a functional S-layer fusion protein with the ability to recrystallize in a defined orientation while presenting the fused allergen. Appl. EnViron. Microbiol. 68, 3251–3260. (19) Breitwieser, A., Egelseer, E. M., Moll, D., Ilk, N., Hotzy, C., Bohle, B., Ebner, C., Sleytr, U. B., and Sára, M. (2002) A recombinant bacterial cell surface (S-layer)-major birch pollen allergen-fusion protein (rSbsC/Bet v1) maintains the ability to self- assemble into regularly structured monomolecular lattices and the functionality of the allergen. Protein Eng. 15, 243–249. (20) Pleschberger, M., Neubauer, A., Egelseer, E. M., Weigert, S., Lindner, B., Sleytr, U. B., Muyldermans, S., and Sára, M. (2003) Generation of a functional monomolecular protein lattice consisting of an s-layer fusion protein comprising the variable domain of a camel heavy chain antibody. Bioconjugate Chem. 14, 440– 448. (21) Pleschberger, M., Saerens, D., Weigert, S., Sleytr, U. B., Muyldermans, S., Sára, M., and Egelseer, E. M. (2004) An S-layer heavy chain camel antibody fusion protein for generation of a nanopatterned sensing layer to detect the prostate-specific antigen by surface plasmon resonance technology. Bioconjugate Chem. 15, 664–671. (22) Völlenkle, C., Weigert, S., Ilk, N., Egelseer, E., Weber, V., Loth, F., Falkenhagen, D., Sleytr, U. B., and Sára, M. (2004) Construction of a functional S-layer fusion protein comprising an immunoglobulin G-binding domain for development of specific adsorbents for extracorporeal blood purification. Appl. EnViron. Microbiol. 70, 1514–1521. (23) Huber, C., Egelseer, E. M., Ilk, N., Sleytr, U. B., and Sára, M. (2006) S-layer-streptavidin fusion proteins and S-layerspecific heteropolysaccharides as part of a biomolecular construction kit for application in nanobiotechnology. Microelectron. Eng. 83, 1589–1593. (24) Moll, D., Huber, C., Schlegel, B., Pum, D., Sleytr, U. B., and Sára, M. (2002) S-layer-streptavidin fusion proteins as template for nanopatterned molecular arrays. Proc. Natl. Acad. Sci. U.S.A. 99, 14646–14651.
Bioconjugate Chem., Vol. 19, No. 4, 2008 865 (25) Schäffer, C., Novotny, R., Küpücü, S., Zayni, S., Scheberl, A., Friedman, J., Sleytr, U. B., and Messner, P. (2007) Novel types of biocataysts based on the S-layer self-assembly system from Geobacillus stearothermophilus NRS 2004/3a, exemplified with glucose-1-phosphate thymidylyltransferase RmlA: a nanobiotechnological approach. Small 3, 2–12. (26) Tschiggerl, H., Breitwieser, A., de Roo, G., Verwoerd, T., Schäffer, C., and Sleytr, U. B. (2008) Exploitation of the S-layer self-assembly system for site directed immobilization of enzymes demonstrated for an extremophilic laminarinase from Pyrococcus furiosus. J. Biotechnol. 133, 403–441. (27) Sára, M., Egelseer, E. M., Huber, C., Ilk, N., Pleschberger, M., Pum, D., and Sleytr, U. B. (2006) S-layer proteins: Potential application in nano(bio)technology, In Microbial. Bionanotechnology: Biological Self-Assembly Systems and Biopolymer-Based Nanostructures, pp 307–338, Horizon Bioscience Bernd Rehm Massey University, P. N. New Zealand. (28) Györvary, E. S., Stein, O., Pum, D., and Sleytr, U. B. (2003) Self-assembly and recrystallization of bacterial S-layer proteins at silicon supports imaged in real time by atomic force microscopy. J. Microsc. 212, 300–306. (29) Kuen, B., Koch, A., Asenbauer, E., Sára, M., and Lubitz, W. (1997) Molecular characterization of the Bacillus stearothermophilus PV72 S-layer gene sbsB induced by oxidative stress. J. Bacteriol. 179, 1664–1670. (30) Howorka, S., Sára, M., Wang, Y., Kuen, B., Sleytr, U. B., Lubitz, W., and Bayley, H. (2000) Surface-accessible residues in the monomeric and assembled forms of a bacterial surface layer protein. J. Biol. Chem. 275, 37876–37886. (31) Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual, 2nd ed., Cold Spring Harbor Labratory Press, Cold Spring Harbor, NY. (32) Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680– 685. (33) Pum, D., Sára, M., and Sleytr, U. B. (1989) Structure, surface charge, and self-assembly of the S-layer lattice from Bacillus coagulans E38–66. J. Bacteriol. 171, 5296–5303. (34) Svahn, A., Magnusson, M., Jägdahl, L., Schloss, L., Kahlmeter, G., and Linde, A. (1997) Evaluation of three commercial enzyme-linked Immunosorbent assays and two latex agglutination assays for diagnosis of primary Epstein-Barr virus infection. J. Clin. Microbiol. 35, 2728–2732. (35) Andresen, H., Grötzinger, C., Zarse, K., Kreuzer, O. J., Ehrenreich-Förster, and Bier, F. K. (2006) Functional peptide microarrays for specific and sensitive antibody diagnostics. Proteomics 6, 1376–1384. BC7003523
