DNA Colorimetric Logic Gates Based on Triplex–Helix Molecular

Article pubs.acs.org/JPCC

DNA Colorimetric Logic Gates Based on Triplex−Helix Molecular Switch Wan Gao, Li Zhang, Yun-Mei Zhang, Ru-Ping Liang, and Jian-Ding Qiu* Department of Chemistry, Nanchang University, Nanchang 330031, P. R. China ABSTRACT: A horseradish peroxidase (HRP)-mimicking DNAzyme sequence is first blocked by the triplex-based molecular beacon (tMB). Upon hybridization with singlestranded DNA inputs, triplex−helix molecular switch occurs, and the released product strand self-assembles into the hemin/ G-quadruplex-HRP-mimicking DNAzyme that biocatalyzes the formation of a colored product and provides an output signal for the different logic gates. On the basis of this principle, a series of logic gates (OR, XOR, INHIBIT, and AND) have been developed. Moreover, a multilevel circuit (MC) that enforces an overall OR Boolean behavior is developed by connecting the AND and XOR logic gates. The logic output signals can be recognized by naked eyes, thus providing a flexible, secure, economic, and simple method for designing a complex DNA-based logic device.

■

INTRODUCTION Electronic logic gates, transistor-based binary switches whose input conditions (0 or 1) determine their output state (0 or 1), form the basis of conventional computer microprocessors.1−3 Analogously, molecular logic gates, which generate responses to the inputs according to Boolean operations at a molecular level, have recently attracted significant attention.4−8 Particularly, nucleic acids are promising components in the construction of molecular logic gates due to its outstanding data-storage capacity, flexibility in design,9 and other unique features including the Watson−Crick base pairing, strand displacement, and its capacity of capturing certain targets such as ions, small molecules, and biological macromolecules by a highly specific manner.10 A number of DNA logic gates have been reported, which are usually activated by inputs of oligonucleotides or metal ions to produce the fluorescent output signals. However, the application of fluorescent labels, organic dyes, quantum dots, or nanoparticles in these designs inevitably increases the cost, insecurity, and complex handling procedures11 and thus impedes the development of DNA computing and its application in a broader field. In an alternative approach, colorimetry based on G-quadruplex formation has been attracting increasing interest as biocatalysts for the development of amplified biosensors12 and the activation of DNA machines.13 The color changes due to the formation of the hemin/G-quadruplex DNAzyme to catalyze the oxidation of 3,3′,5,5′-tetrazmethylbenzidine sulfate (TMB) or 2,2′-azinobis(3-ethylbenzthiazoline-6-sulfonic acid disodium salt) (ABTS2−) by H2O2 have also been utilized as the read-out labels for the logic gate constructions. 14−18 These Gquadruplex-based approaches can minimize or even dispel complex analysis processes, demonstrating great potential in economical and rapid on-site detection of analytes.19 © XXXX American Chemical Society

Additionally, with the realization of reactivity and recognition for molecular computing and information processing, extensive efforts have been directed to the research and development of “DNA machines”, which are devices that can switch between different conformational states upon changes in the environmental conditions or the introduction of catalyzing molecules.20−26 Among the DNA structures that perform mechanical functions, nucleic acid tweezers,27 walkers,28,29 molecular gears,30 tetrahedron,31 and scissors32 have been reported, and the application of such DNA machines for sensing,33,34 nanotransporting,35 nanomedicine,36 and logic-gate operations37 was proposed. For example, Yang and co-workers reported a triple-helix molecular switch machine for the designing the aptamer-based sensing platform and detecting the Hg2+, etc.38−40 Moreover, Mao and co-workers proposed a DNA nanomachine based on a duplex−triplex transition by H+ and OH− ions.41 It is of great interest to combine the computation and DNA machine to design modular and interconnected circuits for future logic operations. To explore the new dimensions of this interesting research area, we describe here a new molecular engineering mechanism, which can be used to design a novel, flexible, universal, label-free, and colorimetric logic gates platform based on the triplex−helix molecular switch combination with the horseradish peroxidase (HRP)-mimicking DNAzyme sequence. A series of DNA logic gates (OR, XOR, INHIBIT, and AND) are constructed by employing the triplex-based molecular beacon (tMB) device as the basic work unit with single-stranded DNA as the input. At first, the G-rich sequence (G4) is locked into the tMB tightly, Received: April 13, 2014 Revised: June 6, 2014

A

dx.doi.org/10.1021/jp503608t | J. Phys. Chem. C XXXX, XXX, XXX−XXX

The Journal of Physical Chemistry C

Article

phosphate-citric acid, pH 4.5, 300 mM NaCl, and 2.5 mM MgCl2). For the OR logic gate, 10 μL of 1.8 μM G4 solution was mixed with 10 μL of 2.6 μM tfMB solution, then 10 μL of ultra pure water [input = (0, 0)], 0.1 μM OR-Input A [input = (1, 0)], 0.1 μM OR-Input B [input = (0, 1)], or 0.1 μM ORInput A and OR-Input B [input = (1, 1)] was added, after that the respective mix solution was diluted to 450 μL with the buffer. Each solution was heated to 88 °C for 10 min to dissociate any intermolecular interaction, then they were naturally cooled to room temperature and incubated for 2 h. Finally, 10 μL of 2 μM hemin dissolved in the HEPES buffer (25 mM HEPES, pH 7.4, 20 mM KCl, 200 mM NaCl, 0.025% (w/v) Triton X-100, and 1% (v/v) DMSO) was added to the DNA solution. The mixtures were kept at room temperature for 1 h, allowing the G-quadruplex to bind hemin properly. In the catalytic reaction, an amount of 32 μL of TMB−H2O2 substrate solution (15 μL of 3 mg/mL TMB and 17 μL of 1 M H2O2) was added to each of the samples. An equal volume (500 μL) of 2 M H2SO4 was added to the solution after 4 min to stop the reaction. We recorded the UV−vis spectra and took the photos. The operation procedures of other logic gates were similar to the above OR gate, except that different singlestranded DNA were taken as input for different logic gates.

preventing the self-assembly of G4 into G-quadruplex. On the basis of hybridization of the input with tMB, the G4 is released, forming the G-quadruplex, which can intercalate hemin for the oxidation of TMB as the output (Scheme 1). On the basis of Scheme 1. Schematic Construction and Operation of the Molecular tMB Using Single DNA as Mechanical Activators

this reaction, the signal transmission can be performed among different gates without special enzymes. Additionally, the input and output of these gates are all DNA except for the last absorbance readout signal, which enables them to be easily cascaded into circuits and achieves more-complex functions. To the best of our knowledge, the application of colorimetric logic gate operation based on triplex−helix molecular switch and Gquarduplex has not been reported to date.

■

■

RESULTS AND DISCUSSION Design Principle of the Functional tMB. The tMB’s basic configuration and its mode of function are depicted in Scheme 1. In our design, a central, trigger-specific singlestranded DNA (ssDNA) (in green) flanked by two arm segments (in blue) is used as the triplex-forming molecular beacon (tfMB), while a G-rich DNA (G4) sequence (in red) serves as a signal transduction probe. The “Triplex-stem” structure is formed once the G4 is bounded with the two arm segments of the tfMB DNA via Watson−Crick and Hoogsteen base-pairing,42−45 which prohibits the formation of the hemin/ G-quadruplex DNAzyme. In contrast, upon hybridization with a complementary input, the tMB opens, resulting in the release of G4, which then forms the HRP-mimicking DNAzyme in the presence of hemin. The hemin/G-quadruplex structure can catalyze the H2O2-mediated oxidation of TMB to the TMB+ with clear yellow color as the output signal in the hybridization buffer.46,47 OR Logic Gate. Figure 1A depicts the design of the OR logic gate based on the basic work unit-tMB. The input DNA

EXPERIMENTAL SECTION Reagents and Apparatus. All oligonucleotides used in the present study were purchased from Invitrogen (Shanghai, China), and their sequences are provided in Table 1. Triton X100, TMB, and hemin were purchased from Sigma-Aldrich (USA). Other chemicals were reagent grade and were used without further purification. All water used to prepare buffer solutions was obtained by using a Milli-Q water system. A Shimadzu UV-2450 spectrophotometer (Tokyo, Japan) was utilized to collect UV−vis absorption spectra. The solution was blended by a QL-901 vortex mixer (Haimen, China). Circular dichroism (CD) spectra were recorded on CD spectrophotometer (Mos-450, Biologic, France). Spectra were recorded from λ = 200 to 320 nm in path length cuvettes (1 mm) and averaged from three scans. We subtracted the background of the buffer solution from the CD data. Logic Operation. We take the OR gate as an example to illustrate the process of logic gate operation and the execution of all logic gate devices in this study. All the gates were operated in the hybridization buffer (10 mM sodium hydrogen Table 1. All Oligonucleotides Used in the Present Study strand name

DNA sequence (5′ → 3′)

tfMB tfMB-1 G4 G4-1 AND-Input A AND-Input B OR-Input A OR-Input B XOR-Input A XOR-Input B INHIBIT-Input A INHIBIT-Input B MC-Input A MC-Input B

CCCTCCCGACCATCGACCTGCAGTGGATCGTCCCTCCC TTTCCCTTTCCCGATGTTGAGTTTAGGTCCCTTTCCCTTT GGGTAGGGAGGGTTGGGT GGGAAAGGGAAAGGGAAAGGG AACATCGGGAAAGGGAAA AAAGGGACCTAAACTC CACTGCAGGTCGATGGTCGGG GGGACGATCCACTGCAGGTCG CACTGCAGGTCGATGGTCGGGAATGACCATCGACCTGCAGTGGATCGT ACGATCCACTGCAGGTCGATGGTCATTCCCGACCATCGACCTGCAGTG ATTAATCCACTGCAGGTCGATGGTC GACCATCGACCTGCAGTGGATTAAT CACTGCAGGTCGATGGTCGGGAATGACCATCGACCTGCAGTGGATCGTAACATCGGGAAAGGGAAA AAAGGGACCTAAACTCACGATCCACTGCAGGTCGATGGTCATTCCCGACCATCGACCTGCAGTG B

dx.doi.org/10.1021/jp503608t | J. Phys. Chem. C XXXX, XXX, XXX−XXX

The Journal of Physical Chemistry C

Article

Figure 1. (A) Schematic representation of a tMB-based OR logic gate that is activated by two-nucleic acids inputs. (B) UV−vis absorption spectra with four input modes. (C) Bar graph with four input modes, derived from panel B. (D) Truth table and photos of OR logic gate.

Figure 2. (A) Schematic representation of a tMB-based XOR logic gate that is activated by two-nucleic acids inputs. (B) UV−vis absorption spectra with four input modes. (C) Bar graph with four input modes, derived from panel B. (D) Truth table and photos of XOR logic gate.

system to produce the colored radical TMB+. It can be observed that when either or both of the OR-Input A and ORInput B are added, the output is 1 with high absorbance intensity of TMB+ and an obvious color change; otherwise, it is 0 with low absorbance intensity (Figure 1B−D). These observations demonstrate that OR-Input A and OR-Input Bswitched tMB really functions as an OR logic gate for which the truth table is shown in Figure 1D. XOR Logic Gate. A XOR logic gate is then constructed as shown in Figure 2A, which has been previously proven to be quite difficult to achieve at the molecular level.50 In this gate, a true output of 1 is obtained when only one of the two inputs is

are devised to be complementary to the loop and arm sequence of the tMB device, OR-Input A is complementary to three bases of the left stem and 18 bases of loop domain of the tfMB, whereas OR-Input B is complementary to three bases of the right stem and 18 bases of loop domain of the tfMB. As a result of the hybridization, the tMB’s triplex-stem hairpin structure will be disrupted to form a double-stranded DNA (dsDNA) between the tfMB with the OR-Input A or OR-Input B,48,49 and the G4 will be released. Then the G4 can self-assemble into the G-quadruplex, which can intercalate hemin to form the HRP-mimicking DNAzyme. Next, the HRP-mimicking DNAzyme activity is characterized in the TMB−H2O2 reaction C

dx.doi.org/10.1021/jp503608t | J. Phys. Chem. C XXXX, XXX, XXX−XXX

The Journal of Physical Chemistry C

Article

Figure 3. (A) Schematic representation of a tMB-based INHIBIT logic gate that is activated by two-nucleic acids inputs. (B) UV−vis absorption spectra with four input modes. (C) Bar graph with four input modes, derived from panel B. (D) Truth table and photos of INHIBIT logic gate.

Figure 4. (A) Schematic representation of a tMB-based AND logic gate that is activated by two-nucleic acids inputs. (B) UV−vis absorption spectra with four input modes. (C) Bar graph with four input modes, derived from panel B. (D) Truth table and photos of AND logic gate.

HRP-mimicking DNAzyme with hemin. However, when both inputs are present simultaneously, since XOR-Input A and XOR-Input B are completely complementary to each other, the disassembling of the tMB is prohibited because both inputs preferentially hybridize to each other instead of hybridizing to the tMB device. In this case, G4 can be only released, which yields catalytically active DNAzyme structure when XOR-Input A or XOR-Input B exists alone, which characterizes the XOR logic gate. Figure 2B,C shows the absorbance intensity of TMB+ upon treatment of the tMB complex with four input modes. It can be observed that the biocatalytic HRP-mimicking DNAzyme can be formed to generate TMB+ with clear yellow color in the presence of either of the two inputs (Figure 2D). However, it leads to the low absorbance upon treatment of the tMB complex with both inputs simultaneously. These results

held at 1, whereas a false output of 0 is produced when both inputs are held at either 0 or 1. Similarly, the XOR gate is established based on the basic work unit-tMB just like that in the OR logic gate. The universal use of the same tMB device presents a quite benificial feature for our logic gate system that we can construct a variety of logic gates just by altering the input DNA while preserving the same tMB device as an universal component. The XOR-Input A is complementary to five bases of the left stem and 18 bases of loop domain of the tfMB with another 18 bases hanging at the 3′ end, whereas XOR-Input B is complementary to the entire bases of loop domain of the tfMB and has another 24 bases hanging at the 3′ end. The hybridization between either the XOR-Input A or XOR-Input B with the tfMB disassembles the triplex−helix stem and results in the release of G4, which self-assembles into D

dx.doi.org/10.1021/jp503608t | J. Phys. Chem. C XXXX, XXX, XXX−XXX

The Journal of Physical Chemistry C

Article

Figure 5. (A) Schematic representation of a tMB-based MC gate that is activated by two-nucleic acids inputs. (B) UV−vis absorption spectra with four input modes. (C) Bar graph with four input modes, derived from panel B. (D) Truth table and photos of MC logic gate.

of loop domain of the tfMB-1. In the presence of AND-Input A or AND-Input B, the AND-Input A or AND-Input B binds to the tfMB-1 and forms a stable duplex, resulting in the disassembly of the triplex-stem structure. It should be noticed that the G4-1 would not be released since the duplex region between G4-1 and tfMB-1 are thermally stable due to the 12 bases complementary to each other. The two-way junction DNA duplex complex can be stably formed through the cooperative binding of AND-Input A and AND-Input B to the tfMB-1 when both the inputs are applied, thereby disrupting the triplex-stem and resulting in the release of G4-1. The G4-1 self-assembles into the HRP-mimicking DNAzyme, which catalyzes the H2O2 oxidation of TMB to the colored radical, TMB+. Figure 4B,C shows the absorbance changes of TMB+ upon treatment of the tMB-1 complex with four input modes. The results indicate that the absorbance intensity of TMB+ is quite low in the presence of either of the inputs (1, 0) or (0, 1) or in the absence of any input (0, 0), while the absorbance intensity of TMB+ shows a sharp increase upon the treatment of the system with both of the inputs (1, 1). These spectral results combined with the distinct color change (Figure 4D) are consistent with the proper AND logic gate operation. Together, all of the implementation of the OR, XOR, INHIBIT, and AND logic gates at the molecular level demonstrates the promise of the tMB device as a universal platform for designing different types of logic gates. Combined XOR and AND Logic Gate. In order to demonstrate the performance of these novel functions through rational gate networking for the higher-order circuits with varying degrees of complexity, we connect the AND and XOR gates into a multilevel circuit (MC) that enforces an overall OR Boolean behavior (Figure 5A). Here, two newly designed inputs, namely, MC-Input A and MC-Input B are employed in addition to the originally used tMB and tMB-1 device from the above XOR and AND logic gates. Additionally, the MC-Input A consists of XOR-Input A and AND-Input A from the above XOR and AND logic gates (see Table 1); the MC-Input B consists of XOR-Input B and AND-Input B, similarly. In this logic gate, only one of the two inputs can disassemble the

demonstrate that the system indeed performs the XOR gate operation. INHIBIT Logic Gate. Likewise, an INHIBIT gate can be constructed based on the tMB system via introduction of the two Inputs A and B (Figure 3A). INHIBIT-Input A is complementary to 21 bases of loop domain of the tfMB and has another four bases hanging at the 5′ end, whereas INHIBITInput B is completely complementary to INHIBIT-Input A. Similarly, the hybridization of INHIBIT-Input A to the tfMB disassembles the triplex-stem and makes G4 release from the tMB structure. INHIBIT-Input B without any hybridization to the tfMB can not make the G4 release; thus, the DNAzyme sequence can not be activated. Therefore, INHIBIT-Input A makes the tMB probe opened, resulting in the release of G4 which can self-assemble in the presence of hemin to the biocatalytic DNAzyme to generate the colored TMB+, but the coexistence of INHIBIT-Input B prevents the tMB probe from disassembling since INHIBIT-Input B is completely complementary to INHIBIT-Input A. Figure 3B,C shows the absorbance changes of the system. It can be observed that when INHIBIT-Input A is input alone, the output is 1 with high absorbance intensity of TMB+ and an obvious color change; otherwise, it is 0 with low absorbance intensity (Figure 3B−D). These observations demonstrate that the system really functions as an INHIBIT logic gate for which the truth table is shown in Figure 3D. AND Logic Gate. Figure 4A shows the activation of an AND gate based on the triplex−helix molecular beacon platform, which gives an output of 1 only if both of the two inputs (AND-Input A and AND-Input B) are held at 1. In this gate, we design a different and more stable triple-helix molecular beacon (tMB-1), which consists of another tripleforming molecular beacon, namely, tfMB-1 and another signal DNA, namely, G4-1. Compared with the tMB used in the above logic gates, the G4-1 has 12 bases binding to the two arm segments of the tfMB-1. For the gate operation, AND-Input A is complementary to 12 bases of the left stem and six bases of loop domain of the tfMB-1, whereas AND-Input B is complementary to six bases of the right stem and ten bases E

dx.doi.org/10.1021/jp503608t | J. Phys. Chem. C XXXX, XXX, XXX−XXX

The Journal of Physical Chemistry C

Article

Figure 6. (A) CD spectra of OR logic gate operation in the absence of OR-Input A and OR-Input B (input 0, 0) and in the presence of 1.68 × 10−4 M OR-Input A (input 1, 0); 1.68 × 10−4 M OR-Input B (input 0, 1); and 1.68 × 10−4 M OR-Input A and 1.68 × 10−4 M OR-Input B together (input 1, 1). (B) CD spectra of AND logic gate operation in the absence of AND-Input A and AND-Input B (input 0, 0) and in the presence of 1.68 × 10−4 M AND-Input A (input 1, 0); 1.68 × 10−4 M AND-Input B (input 0, 1); and 1.68 × 10−4 M AND-Input A and 1.68 × 10−4 M AND-Input B together (input 1, 1).

a negative peak near at λ = 245 nm indicate that the Gquadruplex forms. So, the corresponding CD spectra results are consistent with the AND logic gate operation phenomenon and verify that this system executes the AND gate operation.

triplex-stem and make the G4 release through hybridization with tMB like the above XOR logic gate, while only when both the MC-Input A and MC-Input B are applied is the G4-1 released through the cooperative hybridization of the both inputs with the tMB-1 like the above AND logic gate. The release of G4 or G4-1 sequence results in the self-assembly of the HRP-mimicking DNAzyme, which could catalyze the H2O2-mediated oxidation of TMB to the colored product TMB+ in the presence of hemin. Figure 5B,D shows the absorption spectra and the color change of the system. When the system is subjected to either MC-Input A or MC-Input B, or MC-Input A and MC-Input B together, the colored TMB+ is generated (true value “1”). The results confirm that the MC logic gate established from the XOR and AND logic gates successfully performs the exclusive OR gate operation. CD Measurements. The molecular logic-gate operation and the consistency of our results are further confirmed by CD measurements. The CD spectra of OR logic gate is shown in Figure 6A. In the absence of OR-Input A and OR-Input B, the CD spectrum indicates that the tfMB in combination with G4 exhibits a chirality due to its triplex structure (a negative Cotton effect at 210−220 nm and near 240 nm and a positive Cotton effect at λ = 280 nm).43,44,47 However, in the presence either of the OR-Input A (input 1, 0) or OR-Input B (input 0, 1), or the two inputs together (input 1, 1), the positive band at near 265 nm and a new negative peak at λ = 245 nm appears and the characteristic negative band at 210−220 nm vanishes, indicating that the triplex-based molecular beacon opens and the Gquadruplex forms.51,52 The CD spectra of the four input modes confirm that the tMB structure forms in the absence of ORInput A or OR-Input B, then the tMB opens and the Gquadruplex forms in the presence of OR-Input A or OR-Input B or OR-Input A and OR-Input B together. Therefore, the results of CD spectra confirm that the system indeed executes the OR logic gate operation. Figure 6B shows the CD spectra of AND logic gate. In the absence of AND-Input A and ANDInput B (input 0, 0), a positive Cotton effect at λ = 278 nm and a negative Cotton effect at 210−220 nm and around 240 nm show that the dominant structure is a triplex DNA, namely, tMB-1. However, in the presence of either AND-Input A (input 1, 0) or AND-Input B (input 0, 1), the CD spectrum shows that the dominant structure is a B-form duplex. When both the inputs are applied, a new positive peak near at λ = 265 nm and

■

CONCLUSIONS

■

AUTHOR INFORMATION

In conclusion, we have successfully established a series of colorimetric logic gates (OR, XOR, INHIBIT, and AND) on the basis of triplex−helix molecular switch machine and Gquadruplex DNAzyme. Specifically, introducing the G-quadruplex DNAzyme into the logic system to modulate the output signal makes it flexible, enabling the design of various logic gates according to the requirements of the data processing. In addition, gates connecting into multilevel circuits is confirmed by wiring AND and XOR gates together, which allows the creation of molecular circuits with increased complexity and computational utility. Thus, our results demonstrate that colorimetric responses toward triplex−helix molecular switch over processes of a relatively simple molecule machine-tMB, in the presence of appropriate single DNA inputs, could express the complex language of information technology. This work provides a rigid experimental basis for researchers to establish more complex logic systems at the molecule level. It may also contribute to the advancement of molecular computation and DNA nanotechnology.

Corresponding Author

*(J.-D.Q.) Phone: +86-791-8396-9518. Fax: +86-791-83969518. E-mail: [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS

We gratefully acknowledge the supports from the National Natural Science Foundation of China (21163014, 21105044, and 21265017) and the Program for New Century Excellent Talents in University (NCET-11-1002 and NECT-13-0848). F

dx.doi.org/10.1021/jp503608t | J. Phys. Chem. C XXXX, XXX, XXX−XXX

The Journal of Physical Chemistry C

■

Article

(24) Leung, K.-H.; He, H.-Z.; Ma, V. P.-Y.; Zhong, H.-J.; Chan, D. S.H.; Zhou, J.; Mergny, J.-L.; Leung, C.-H.; Ma, D.-L. Detection of Base Excision Repair Enzyme Activity Using a Luminescent G-Quadruplex Selective Switch-on Probe. Chem. Commun. 2013, 49, 5630−5632. (25) He, H.-Z.; Chan, D. S.-H.; Leungbc, C.-H.; Ma, D.-L. A Highly Selective G-Quadruplex-Based Luminescent Switch-on Probe for the Detection of Gene Deletion. Chem. Commun. 2012, 48, 9462−9464. (26) Leung, K.-H.; He, H.-Z.; Ma, V. P.-Y.; Chan, D. S.-H.; Leung, C.-H.; Ma, D.-L. A Luminescent G-Quadruplex Switch-on Probe for the Highly Selective and Tunable Detection of Cysteine and Glutathione. Chem. Commun. 2013, 49, 771−773. (27) Chen, Y.; Wang, M.; Mao, C. An Autonomous DNA Nanomotor Powered by a DNA Enzyme. Angew. Chem., Int. Ed. 2004, 43, 3554−3557. (28) Shin, J. S.; Pierce, N. A. A Synthetic DNA Walker for Molecular Transport. J. Am. Chem. Soc. 2004, 126, 10834−10835. (29) Tian, Y.; He, Y.; Chen, Y.; Yin, P.; Mao, C. A DNAzyme That Walks Processively and Autonomously Along a One-Dimensional Track. Angew. Chem., Int. Ed. 2005, 44, 4355−4358. (30) Tian, Y.; Mao, C. D. Molecular Gears: A Pair of DNA Circles Continuously Rolls against Each Other. J. Am. Chem. Soc. 2004, 126, 11410−11411. (31) Pei, H.; Liang, L.; Yao, G.; Li, J.; Huang, Q.; Fan, C. Reconfigurable Three-Dimensional DNA Nanostructures for the Construction of Intracellular Logic Sensors. Angew. Chem., Int. Ed. 2012, 51, 9020−9024. (32) Elbaz, J.; Wang, F.; Remacle, F.; Willner, I. pH-Programmable DNA Logic Arrays Powered by Modular DNAzyme Libraries. Nano Lett. 2012, 12, 6049−6054. (33) Shlyahovsky, B.; Li, D.; Weizmann, Y.; Nowarski, R.; Kotler, M.; Willner, I. Spotlighting of Cocaine by an Autonomous Aptamer-Based Machine. J. Am. Chem. Soc. 2007, 129, 3814−3815. (34) Li, D.; Wieckowska, A.; Willner, I. Optical Analysis of Hg2+ Ions by Oligonucleotide−Gold−Nanoparticle Hybrids and DNA-Based Machines. Angew. Chem., Int. Ed. 2008, 47, 3927−3931. (35) Bath, J.; Green, S. J.; Turberfield, A. J. A Free-Running DNA Motor Powered by a Nicking Enzyme. Angew. Chem., Int. Ed. 2005, 44, 4358−4361. (36) Win, M. N.; Smolke, C. D. Higher-Order Cellular Information Processing with Synthetic RNA Devices. Science 2008, 322, 456−460. (37) Elbaz, J.; Shlyahovsky, B.; Li, D.; Willner, I. Parallel Analysis of Two Analytes in Solutions or on Surfaces by Using a Bifunctional Aptamer: Applications for Biosensing and Logic Gate Operations. ChemBioChem 2008, 9, 232−239. (38) Zheng, J.; Li, J.; Jiang, Y.; Jin, J.; Wang, K.; Yang, R.; Tan, W. Design of Aptamer-Based Sensing Platform Using Triple-Helix Molecular Switch. Anal. Chem. 2011, 83, 6586−6592. (39) Zheng, J.; Jiao, A.; Yang, R.; Li, H.; Li, J.; Shi, M.; Ma, C.; Jiang, Y.; Deng, L.; Tan, W. Fabricating a Reversible and Regenerable Raman-Active Substrate with a Biomolecule-Controlled DNA Nanomachine. J. Am. Chem. Soc. 2012, 134, 19957−19960. (40) Zheng, J.; Nie, Y.; Hu, Y.; Li, J.; Li, Y.; Jiang, Y.; Yang, R. TimeResolved Fluorescent Detection of Hg2+ in a Complex Environment by Conjugating Magnetic Nanoparticles with a Triple−Helix Molecular Switch. Chem. Commun. 2013, 49, 6915−6917. (41) Chen, Y.; Lee, S.-H.; Mao, C. A DNA Nanomachine Based on a Duplex−Triplex Transition. Angew. Chem., Int. Ed. 2004, 43, 5335− 5338. (42) Salunkhe, M.; Wu, T.; Letsinger, R. L. Control of Folding and Binding of Oligonucleotides by Use of a Nonnucleotide Linker. J. Am. Chem. Soc. 1992, 114, 8768−8772. (43) Lee, H.-T.; Khutsishvili, I.; Marky, L. A. DNA Complexes Containing Joined Triplex and Duplex Motifs: Melting Behavior of Intramolecular and Bimolecular Complexes with Similar Sequences. J. Phys. Chem. B 2010, 114, 541−548. (44) Dohno, C.; Nakatani, K.; Saito, I. Guanine of the Third Strand of C·G*G Triplex Serves as an Effective Hole Trap. J. Am. Chem. Soc. 2002, 124, 14580−14585.

REFERENCES

(1) Bi, S.; Yan, Y.; Hao, S.; Zhang, S. Colorimetric Logic Gates Based on Supramolecular DNAzyme Structures. Angew. Chem., Int. Ed. 2010, 49, 4438−4442. (2) Zhang, Y.-M.; Zhang, L.; Liang, R.-P.; Qiu, J.-D. DNA Electronic Logic Gates Based on Metal-Ion-Dependent Induction of Oligonucleotide Structural Motifs. Chem.Eur. J. 2013, 19, 6961−6965. (3) Chen, J.; Fang, Z.; Lie, P.; Zeng, L. Computational Lateral Flow Biosensor for Proteins and Small Molecules: A New Class of Strip Logic Gates. Anal. Chem. 2012, 84, 6321−6325. (4) Xia, F.; et al. Label-Free, Dual-Analyte Electrochemical Biosensors: A New Class of Molecular-Electronic Logic Gates. J. Am. Chem. Soc. 2010, 132, 8557−8559. (5) de Silva, A. P.; McClenaghan, N. D. Molecular-Scale Logic Gates. Chem.Eur. J. 2004, 10, 574−586. (6) Pischel, U. Chemical Approaches to Molecular Logic Elements for Addition and Subtraction. Angew. Chem., Int. Ed. 2007, 46, 4026− 4040. (7) Park, K. S.; Jung, C.; Park, H. G. “Illusionary” Polymerase Activity Triggered by Metal Ions: Use for Molecular Logic-Gate Operations. Angew. Chem., Int. Ed. 2010, 49, 9757−9760. (8) Adleman, L. M. Molecular Computation of Solutions to Combinatorial Problems. Science 1994, 266, 1021−1024. (9) Carell, T. Molecular Computing DNA as a Logic Operator. Nature 2011, 469, 45−46. (10) Yang, J.; Shen, L. J.; Ma, J. J.; Schlaberg, H. I.; Liu, S.; Xu, J.; Zhang, C. Fluorescent Nanoparticle Beacon for Logic Gate Operation Regulated by Strand Displacement. ACS Appl. Mater. Interfaces 2013, 5, 5392−5396. (11) Zhang, C.; Yang, J.; Xu, J. Circular DNA Logic Gates with Strand Displacement. Langmuir 2010, 26, 1416−1419. (12) Shimron, S.; Wang, F.; Orbach, R.; Willner, I. Amplified Detection of DNA through the Enzyme-Free Autonomous Assembly of Hemin/G-Quadruplex DNAzyme Nanowires. Anal. Chem. 2012, 84, 1042−1048. (13) Shimron, S.; Elbaz, J.; Henning, A.; Willner, I. Ion-induced DNAzyme Switches. Chem. Commun. 2010, 46, 3250−3252. (14) Elbaz, J.; Moshe, M.; Willner, I. Coherent Activation of DNA Tweezers: A ″Set-Reset″ Logic System. Angew. Chem., Int. Ed. 2009, 48, 3834−3837. (15) Zhu, J. B.; Li, T.; Zhang, L. B.; Dong, S. J.; Wang, E. K. GQuadruplex DNAzyme Based Molecular Catalytic Beacon for LabelFree Colorimetric Logic Gates. Biomaterials 2011, 32, 7318−7324. (16) Shimron, S.; Magen, N.; Elbaz, J.; Willner, I. pH-Programmable DNAzyme Nanostructures. Chem. Commun. 2011, 47, 8787−8789. (17) Li, T.; Wang, E. K.; Dong, S. J. Potassium-Lead-Switched GQuadruplexes: A New Class of DNA Logic Gates. J. Am. Chem. Soc. 2009, 131, 15082−15083. (18) Moshe, M.; Elbaz, J.; Willner, I. Sensing of UO22+ and Design of Logic Gates by the Application of Supramolecular Constructs of IonDependent DNAzymes. Nano Lett. 2009, 9, 1196−1200. (19) Xu, W.; Xue, X.; Li, T.; Zeng, H.; Liu, X. Ultrasensitive and Selective Colorimetric DNA Detection by Nicking Endonuclease Assisted Nanoparticle Amplification. Angew. Chem., Int. Ed. 2009, 48, 6849−6852. (20) Shlyahovsky, B.; Li, Y.; Lioubashevski, O.; Elbaz, J.; Willner, I. Logic Gates and Antisense DNA Devices Operating on a Translator Nucleic Acid Scaffold. ACS Nano 2009, 3, 1831−1843. (21) Campolongo, J. M.; Kahn, J. S.; Cheng, W.; Yang, D.; GuptonCampolongo, T.; Luo, a. D. Adaptive DNA-Based Materials for Switching,Sensing, and Logic Devices. J. Mater. Chem. 2011, 21, 6113−6121. (22) Ma, D.-L.; Chan, D. S.-H.; Man, B. Y.-W.; Leung, C.-H. Oligonucleotide-Based Luminescent Detection of Metal Ions. Chem. Asian. J. 2011, 6, 986−1003. (23) He, H.-Z.; Leung, K.-H.; Wang, W.; Chan, D. S.-H.; Leung, C.H.; Ma, D.-L. Label-Free Luminescence Switch-on Detection of T4 Polynucleotide Kinase Activity Using a G-Quadruplex-Selective Probe. Chem. Commun. 2014, 50, 5313−5315. G

dx.doi.org/10.1021/jp503608t | J. Phys. Chem. C XXXX, XXX, XXX−XXX

The Journal of Physical Chemistry C

Article

(45) Tarköy, M.; Phipps, A. K.; Schultze, P.; Feigon, J. Solution Structure of an Intramolecular DNA Triplex Linked by Hexakis(Ethylene Glycol) Units: d(AGAGAGAA-(EG)6-TTCTCTCT-(EG)6TCTCTCTT). Biochemistry 1998, 37, 5810−5819. (46) Miyoshi, D.; Inoue, M.; Sugimoto, N. DNA Logic Gates Based on Structural Polymorphism of Telomere DNA Molecules Responding to Chemical Input Signals. Angew. Chem., Int. Ed. 2006, 45, 7716− 7719. (47) Li, T.; Ackermann, D.; Hall, A. M.; Famulok, M. InputDependent Induction of Oligonucleotide Structural Motifs for Performing Molecular Logic. J. Am. Chem. Soc. 2012, 134, 3508−3516. (48) Tsourkas, A.; Behlke, M. A.; Bao, G. Structure−Function Relationships of Shared-Stem and Conventional Molecular Beacons. Nucleic Acids Res. 2002, 30, 4208−4215. (49) Riccelli, P. V.; Merante, F.; Leung, K. T.; Bortolin, S.; Zastawny, R. L.; Janeczko, R.; Benight, A. S. Hybridization of Single-Stranded DNA Targets to Immobilized Complementary DNA Probes: Comparison of Hairpin Versus Linear Capture Probes. Nucleic Acids Res. 2001, 29, 996−1004. (50) Liu, Y.; Offenhäusser, A.; Mayer, D. An Electrochemically Transduced Xor Logic Gate at the Molecular Level. Angew. Chem., Int. Ed. 2010, 49, 2595−2598. (51) Zhao, C.; Ren, J.; Qu, X. G-Quadruplexes Form Ultrastable Parallel Structures in Deep Eutectic Solvent. Langmuir 2013, 29, 1183−1191. (52) Rachwal, P. A.; Findlow, I. S.; Werner, J. M.; Brown, T.; Fox, K. R. Intramolecular DNA Quadruplexes with Different Arrangements of Short and Long Loops. Nucleic Acids Res. 2007, 35, 4214−4222.

H

dx.doi.org/10.1021/jp503608t | J. Phys. Chem. C XXXX, XXX, XXX−XXX