DNA-Guided Delivery of Single Molecules into Zero-Mode

Subscriber access provided by Grand Valley State | University

Article

DNA-Guided Delivery of Single Molecules into Zero-Mode Waveguides Thomas Plénat, Satoko Yoshizawa, and Dominique Fourmy ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.7b11953 • Publication Date (Web): 21 Aug 2017 Downloaded from http://pubs.acs.org on August 24, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

DNA-Guided Delivery of Single Molecules into Zero-Mode Waveguides Thomas Plénat, Satoko Yoshizawa, and Dominique Fourmy * Institute for Integrative Biology of the Cell (I2BC), CEA, CNRS, Univ Paris-Sud, Université Paris-Saclay, 91198, Gif-sur-Yvette cedex, France. KEYWORDS: zero-mode waveguides, nanoapertures, non-Poissonian distribution, singlemolecule, fluorescence, condensed DNA, random coiled DNA, nanophotonics.

ABSTRACT Zero-mode waveguides (ZMWs) are powerful analytical tools corresponding to optical nanostructures fabricated in a thin metallic film capable of confining an excitation volume to the range of attoliters. This small volume of confinement allows single-molecule fluorescence experiments to be performed at physiologically relevant concentrations of fluorescently labelled biomolecules. Exactly one molecule to be studied must be attached at the floor of the ZMW for signal detection and analysis; however, the massive parallelism of these nanoarrays suffers from a Poissonian-limited distribution of these biomolecules. To date, there is no method available that provides full single molecule occupancy of massively arrayed ZMWs. Here we report the performance of a DNA-guided method that uses steric exclusion properties of large DNA molecules to bias the Poissonian-limited delivery of single molecules. Non-

ACS Paragon Plus Environment

1


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 23

Poissonian statistics were obtained with DNA molecules that contain a free-biotinylated extremity for efficient binding to the floor of the ZMW, which resulted in a decrease of accessibility for a second molecule. Both random coil and condensed DNA conformations drove non-Poissonian single-molecule delivery into ZMWs arrays. The results suggest that an optimal balance between rigidity and flexibility of the macromolecule is critical for favourable accessibility and single occupancy. The optimized method provides means for full exploitation of these massively parallelized analytical tools.

INTRODUCTION Zero-mode waveguide (ZMW) arrays 1 are powerful photonic nanostructures that have been developed to achieve single-molecule and real-time DNA sequencing.2 The technique has also allowed analyses of RNA modifications. 3 Furthermore, ZMWs have been used to collect data on the dynamics of protein synthesis at biologically relevant substrate concentrations (µM range) 4-5, to image movements of a myosin molecular motor, 6 to analyse protein-protein or ligand-protein interactions 7-8 and to monitor GTPase activation on single Ras-functionalized liposomes.9 The commercialized ZMW-based DNA sequencer has been customized for high-throughput singlemolecule studies of biological systems in real time.10 The ZMW nanophotonic structures are nanowells fabricated in a thin metal film with a typical thickness of about 100 nm.1 ZMWs are fabricated as regular arrays containing several thousand nanowells in this cladding metal layer on a glass substrate. Each nanowell has a sub-wavelength diameter, which restricts light to volumes in the attoliter range. The volume where fluorophores can be excited is small enough to allow a concentration of fluorescently labelled molecules in the micromolar range without significant fluorescence background. This concentration is orders of


2

Page 3 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


magnitude higher than in more traditional single-molecule studies and is close to physiological conditions in which rapid biomolecular recognition processes occur. Careful analysis of the effect of the cladding metal on FRET efficiencies opened the door for enhanced single-molecule FRET studies at physiological concentrations in ZMWs.11 Now, in ZMW-FRET experiments, single molecule resolution of binding events at up to mM concentration is feasible. 12 With ZMW technology, single active macromolecules to be studied are immobilized on the floor of ZMW nanowells. This is achieved by applying a diluted solution of biotinylated biomolecules or magnetic beads to the streptavidin-coated ZMWs and allowing the molecules to interact for a short period of time. This leads to a random distribution of the macromolecules limited by Poissonian statistics with a theoretical maximum single-molecule occupancy of 37%.13 Methods that overcome the limitations of these Poissonian statistics, positioning only a single molecule per ZMW over the entire array, will enable exploitation of the massive parallelism provided by these arrays. Toward this goal, several methods have been proposed. A DNA origami scaffold has been tested to surpass the Poissonian limited loading by positioning a single molecule dye in the centre of each nanowell of the ZMW for homogenized spectroscopic properties.14 Instead of this diffusion-based method, active methods that directly manipulate the macromolecule might provide a solution for nanometric positioning with single occupancy. AFM was proposed for single molecule delivery at the floor of each ZMW 15 and a hybrid nanopore/ZMW device has been developed that allows reversible positioning.16 As opposed to binding of individual molecules on accessible lithographically patterned surfaces where nearly full occupancy is readily reached 17-19, to date, there is no method available that provides full single molecule occupancy of massively arrayed ZMWs.


3


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 23

Here we tested a simple system of DNA-guided single-molecule delivery. The DNA is conjugated to biotin to link the DNA to the streptavidin-functionalized surface of the ZMW. We show that large DNA molecule with a random coiled conformation overcame the Poissonian statistics resulting in single-molecule occupancy that approached 70%. The use of a DNA condensing agent such as spermidine that triggered the formation of compact toroids 20 did not improve the efficiency of the single-molecule loading but strongly decreased the multiple occupancy levels. The results suggest that an optimal balance between rigidity and flexibility of the macromolecule might be critical for favourable accessibility and single occupancy inside ZMWs.

EXPERIMENTAL SECTION DNA design and preparation. We used a 5’-biotinylated and Cy3-labeled (8th position from 5’ end) forward primer (biotin- CGTAAAGCACTAAATCGGAACCCTAAAGGG, Eurofins MWG-Biotech)

and

two

reverse

primers

(TCGCTCCAAGCTGGGCTGT

and

AGAAGATGGTGCGCTCCTGGAC, Eurofins MWG-Biotech) to produce 1812-bp and 2802bp dsDNA molecules by PCR. PCR was performed using 1 U of Taq DNA Polymerase in 50 µL of ThermoPol Buffer (NEB) containing 200 µM dNTPs (GE Healthcare), 0.1 µM primers, and 4.5 ng of PRSET/emGFP plasmid (Invitrogen). PCR products were purified in an agarose gel in presence of urea (1% agarose, 1X TBE with 1 M urea).21 The urea-agarose gel was heated at 65 °C prior to loading. Electrophoresis was performed for 2 hours in a 1X TBE buffer also containing 1 M urea. After gel electrophoresis, the dsDNA band (visible under UV light) was excised and purified with a Gel DNA Recovery Kit (Zymo Research). To check the dsDNA sample purity, we performed a PAGE (1.8% acrylamide, in 1.5X TBE, sample pre-heated at 90


4

Page 5 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


°C for 2 minutes, 5 minutes migration at 400 W). PCR products purified through a heated ureaagarose gel were free of labelled primers, unlike those purified without heat and urea (Figure S1).

ZMW preparation. We used aluminum zero-mode waveguide arrays from Pacific Biosciences. The array is provided mounted on a conventional microscope coverslip. Each chip provides seven different ZMW diameters: 85, 100, 114, 126, 136, 144, and 200 nm. The glass floor of the ZMW is already functionalized with a mixture of PEG/biotinylated-PEG to allow immobilization of avidin. The aluminum surface is also already passivated with polyvinylphosphonic acid. The chip (sample volume ca. 100 µL) was first washed with 1 mL of MOPS buffer (50 mM MOPS, 75 mM KOAc and 12.5 mM MgOAc, pH 7) before incubation in 100 nM Neutravidin (Sigma-Aldrich) in MOPS buffer for 10 minutes.22 Excess Neutravidin was then removed by washing with 2 mL of MOPS buffer, and dsDNA samples were loaded and incubated for 1 h. The chip was finally rinsed with 2 mL of MOPS buffer before observation. Neutravidin was replaced by extravidin-FITC (Sigma-Aldrich) at the same concentration in the experiment analysing avidin coverage. We tested avidin-biotin binding specificity by adding 100 µM biotin in the MOPS buffer after neutravidin incubation and before biotin-DNA molecules addition.

Sample loading. For DNA loading, solutions of DNA (50 or 170 nM) in MOPS buffer were incubated on the ZMW chips for 10 min at room temperature. Chips were then rinsed with the same buffer. Experiments on the condensed DNA were performed in the same conditions except that spermidine was added at a concentration of 1 mM.


5


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 23

For experiments with a DNA destabilizing agent, we used the protocol previously described.22 Incubation was performed at 4 °C for 10 min in a buffer containing 50 mM MOPS, pH 7.5, 75 mM potassium acetate, 5 mM dithiothreitol, and 0.05% (v/v) Tween-20 (Sigma-Aldrich). Unbound DNA molecules were removed by washing five times with a buffer containing 50 mM ACES, pH 7.1, 75 mM potassium acetate, and 5 mM dithiothreitol.

Fluorescence microscopy. Observations were performed on an inverted microscope (Axio Observer, Zeiss). Cy3 fluorophores were excited with a 532-nm laser (0.025 kW/cm2, Roper Scientific), and fluorescence was collected through a 63X TIRF objective (Zeiss). The fluorescence signals from ~3000 nanowells were recorded at a rate of 10 frames/s onto a cooled EMCCD camera (Photometrics). Image acquisition was performed using the MetaMorph software package (Molecular Devices), and data analysis used home-made MATLAB scripts written for spot picking from the image movies and conversion to time traces and for automatic detection of fluorophore bleaching steps.

RESULTS AND DISCUSSION. Large DNA duplexes form random coils in solution with mechanical properties usually described by the worm-like chain model. At short length scale, DNA has a high bendability that deviates from the worm-like chain model.23 We reasoned that it would be possible to guide singlemolecule delivery within the ZMW cavity using a simple system that would prevent or decrease


6

Page 7 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


accessibility of a second molecule when the cavity is already occupied by a single macromolecule. Steric hindrance induced by a DNA in either random-coil or condensed conformation bound to a ZMW nanowell should limit the ability of a second DNA molecule to reach the glass surface at the floor of the ZMW. This should favour single molecule occupancy at the bottom of the cavity overcoming the Poissonian-limited delivery of molecules into the ZMW array (Figure 1).

85-200nm

Metal clad

100nm

Glass

Figure 1. Concept of DNA-assisted single molecule delivery into arrayed ZMWs. Binding of a long DNA molecule at the floor of the ZMW nanowell will limit accessibility to a second molecule thereby allowing non-Poissonian single-molecule delivery. DNA duplexes are shown in violet, PEG in green, and biotin/streptavidin in red.

We designed double-stranded DNA molecules of different lengths and Flory radii to evaluate binding to the nanocavities and to explore their exclusion properties once bound in the ZMW nanowell (Figure S2). Biotinylated and Cy3-labelled DNA molecules were generated using PCR reactions with one of the DNA primers containing a Cy3 dye at position 8 and a biotin at the 5’ end for attachment at the functionalized floor of the ZMWs. PCR products were purified using


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 23

commercially available columns. Following this purification step we verified by PAGE the purity and size of the Cy3-labelled DNAs (Figure S1). We noticed that the Cy3-labelled PCR products were contaminated by the residual Cy3-labelled oligonucleotide used as a primer for the PCR reaction. From fluorescence quantification, this contamination was estimated to be of approximately 4%, which would compromise analysis of the single DNA loading experiments. After multiple trials, we found that an agarose gel electrophoresis step performed in presence of a low concentration of urea 21 completely eliminated the contamination without disrupting the duplex conformations of the long DNA molecules (Figure S1). Prior to examining the binding of the large DNA molecules to the ZMWs, we investigated the biotin coverage of the floors of the ZMW nanowells and the specificity of DNA binding. We used ZMWs with nano-apertures of 85, 100, 114, 126, 136, 144, and 200 nm fabricated in a cladding aluminum layer of 100 nm. The metal is treated with polyvinylphosphonic acid (PVPA) to prevent non-specific binding. 13 We evaluated the biotin coverage by quantifying the binding of FITC-extravidin, a fluorescent conjugate of extravidin. The fluorescence from bound FITC-extravidin and the transmitted light within the apertures were measured (Figure S3 and S4) taking into account previous observations. 24-28 Fluorescence was observed in all apertures indicating specific binding of extravidin to the PEG/PEG-biotin layer with the fluorescence increasing regularly for 85-136 nm apertures (see Supporting Information). Finally, extravidin was loaded onto the devices as previously described 22, and the specificity of the interaction for extravidin was evaluated using a biotinylated and Cy5-fluorescently labelled DNA. DNA molecules bound in the ZMW were readily detected (Figure S5 A). A control


8

Page 9 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


experiment was performed in which the array, pre-loaded with extravidin, was incubated with a saturating concentration of free biotin. In these conditions, binding of DNA was not detected demonstrating the specificity of the DNA loading (Figure S5 B). We asked whether the accessibilities of the large DNAs to the different sizes of ZMW nanowells were dependent on Flory radii. ZMW arrays were loaded with biotinylated-Cy3-DNAs of different numbers of base pairs (bps), and the occupancy of single DNA molecules was measured by analysing the number of photobleaching steps. As expected, the accessibility of the large DNA constructs to the smallest apertures was significantly reduced. For instance, the 1812bp DNA did not bind in high yield to the 85-nm ZMWs even after overnight incubation, whereas the same DNA rapidly accessed larger cavities such as those with 114-nm diameter apertures (Figure 2). A larger DNA of 2802 bp did not bind to either 85- or 100-nm apertures and only bound slightly to 136-nm and wider cavities (Figure S6). These results indicate that, for a controlled time of incubation, the random coil conformation of the DNA limits its accessibility to nanowells suggesting that once a single molecule is bound in a cavity, the accessibility for a second would be diminished, which should favour non-Poissonian loading of single molecules.


9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 23

A

B

Figure 2. Accessibility of the 1812-bp DNA to ZMW nanowells of (A) 85-nm aperture and (B) 114-nm aperture. ZMWs (1007 nanowells) are represented individually by a square, and the molecule occupancy is highlighted with a colour code. The two arrays were located on different areas of a single chip. Colour code: wells not analysed (black), empty wells (blue), wells with one molecule (green), with two molecules (yellow), three molecules (orange), with more than one molecule in A and with more than three molecules in B (red). Having designed large duplex DNAs and verified their binding specificity and accessibility to the ZMWs, we next evaluated the capabilities of the random coiled DNAs to drive nonPoissonian single-molecule delivery. We incubated ZMWs with the 1812-bp DNA at different concentrations in the nanomolar range and measured the occupancy levels (Figure 3A).


10

Page 11 of 23

B

80%

114 nm ZMW

70% 60% 50%

fraction %

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


40% 30% 20% 10% 0% 0

1

2

3

4

biotin-Cy3-DNA per nanowell

Figure 3. Non-Poissonnian distribution of single Cy3-DNA molecule binding to ZMW nanowells. (A) The two horizontal axes represent the DNA molecules per well as a function of the well diameter, and the vertical axis displays the percentage of wells having the corresponding occupancy. (B) Extraction of the data for 114-nm apertures. Histogram in red displays the


11


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 23

distribution of molecule occupancy. In black is the theoretical distribution based on the Poisson law. In blue is the computed Poisson distribution.

Fluorescence intensities displayed heterogeneities inside the aperture similarly to what was observed previously for metallic apertures (Figure S7). 14-15 The 1812-bp DNA accessed ZMWs with a diameter of 100 nm or larger, and 66% single-molecule occupancy was observed for the 114-nm ZMW nanowells. This value might be an underestimate as a fraction of the Cy3 labels might have interacted with the floor of the nano-apertures in the vicinity of the metal sidewalls with alteration of Cy3 fluorescence properties such as quenching. 15, 29-33 As expected, the fractions of double, triple, and quadruple occupancies were decreased compared to levels expected for Poissonian statistics (Figure 3B). When testing the 1812-bp DNA loading efficiency, we observed that increasing the DNA concentration from 50 nM to 170 nM did not improve the efficiency of single-molecule loading. Longer time of incubation did not significantly modify the yield of loading neither. The duplex DNA used here is flexible, and the ends of our constructs should freely explore the functionalized floor of the ZMWs via a biotinylated end. Having verified that the biotin coverage of the ZMW is sufficient for binding of small DNA oligonucleotides, it is therefore unlikely that the biotin density limits single molecule loading efficiency of large DNAs. Buffer composition can drastically influence the structure of random coiled DNA. The use of a buffer containing the non-ionic detergent Tween-20, which is used for DNA loading in SMRT sequencing, 22 increased the accessibility of the 1812-bp DNA to all aperture sizes tested (Figure S8). This increase in accessibility was accompanied by a decrease in the level of single occupancy. In buffer containing Tween-20, single molecule occupancy ranged from 32 to 43%


12

Page 13 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(Figure S9). These results suggest that accessibility can be tuned by influencing the random coiled structure of the DNA but that an increase in flexibility impairs single-molecule occupancy efficiency. We next explored the single-molecule loading of compacted DNA molecules. Polycations can induce DNA condensation with the formation of toroids 20 of outer diameter of 100 to 200 nm depending on the conditions used. 34 Single plasmid molecules tend to form single condensed structures.35 Moreover, diameter and thickness as well as growth of toroids can be fine-tuned by specific solution conditions (e.g., ionic strength).36 We measured the single-molecule DNA loading efficiency for the compacted version of the 1812-bp DNA in presence of 1 mM spermidine, a polycation (Figure 4). In these conditions, the 1812-bp DNA accessed the 100-nm apertures with a loading efficiency of around 30%, a factor of two below the accessibility obtained in the absence of spermidine. For larger apertures, the loading efficiency increased to values between 40% and 50%. It is noticeable that levels of double occupancy were decreased by a factor 2 compared to the loading experiments performed in the absence of spermidine. This decrease was even more pronounced for the triple and quadruple loading rates that were lower by factors of 3 and 5, respectively. This might reflect a stronger effect of size exclusion generated by the toroidal shape of DNA versus the random coiled conformation. We conclude here that rigidifying the DNA in a condensed form decreases accessibility but increases selectivity of occupancy.


13


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 23

Figure 4. Single-molecule delivery of compacted Cy3-DNA. The 1812-bp DNA was incubated in a solution containing 1 mM spermidine to include condensation before loading on the ZMW array. The two horizontal axes represent the DNA molecules per well as a function of the well diameter, and the vertical axis displays the percentage of wells having the corresponding DNA occupancy.

CONCLUSIONS. We demonstrate here that random coiled or condensed DNA can be used to load single molecules inside ZMWs with non-Poissonian statistics. The steric hindrance due to the DNA bound inside the ZMW decreases the accessibility for a second molecule. Random coiled DNA has flexibility, which can be an advantage for efficient accessibility to the glass surface but might reduce the steric effect that is expected to play a strong role in inducing non-Poissonian statistics. We therefore explored the loading efficiencies of the DNA molecule in the presence of a condensing agent, spermidine. In these conditions, double-stranded DNA


14

Page 15 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


molecules can form highly compact structures such as toroids or rods of 100-200 nanometers in diameter.36 As expected, the addition of spermidine strongly decreased the number of ZMWs that were occupied by multiple DNA molecules. Despite leading to stronger non-Poissonian distribution, this came with a cost in the fraction of ZMWs loaded with a single molecule that plateaued at 50%. On the other hand, with random coiled DNA, we observed fractions of single-molecule occupancy approaching 70% for the arrayed ZMWs. This loading efficiency is largely superior to that of liposomes9 and higher than that obtained with DNA origami disks with dimensions matching those of the ZMWs.14 The DNA origami tiles contained two biotins, and the authors suspect that the DNA origami can only sample a small fraction of the glass surface of the ZMW and that in certain wells the area sampled did not contained any Neutravidin to capture the DNA origami. Our data of the condensed DNA suggests that rigidity negatively impacts the efficiency of single molecule loading. DNA origami tiles are rather rigid structures and this might also contribute to the observed limitations in single molecule loading of DNA tiles matching the size of the nanoapertures. 14 Our system used a random coiled DNA with a biotinylated end that should be flexible enough to thoroughly explore the ZMW glass surface. Our results suggest indeed that flexibility of the biotinylated DNA end and/or flexibility within the entire coiled structure does contribute to efficient binding inside the nanocavities. However, our yield of coverage remains below what is obtained for flat or nearly flat surfaces. For instance, placement of individual DNA origami molecules on fully accessible lithographically patterned flat surfaces is achieved with more than 90% of sites having an individual molecule. 17-19 In this case, the binding sites have dimensions and shape matching those of the DNA-origami in order to accept only one molecule per site.


15


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 23

Similarly, 90% of wide and nearly flat nanoapertures (less than 5 nm deepness) can be filled with single occupancy. 37 Reduced accessibility inside the deep and narrow ZMWs might have a role in the difficulty of obtaining full occupancy.

ASSOCIATED CONTENT Supporting Information. Supplementary text (computation of the Poisson distribution; biotin coverage of the ZMWs) and supplementary figures (S1-S9). This material is available free of charge via the Internet at http://pubs.acs.org.

AUTHOR INFORMATION Corresponding Author * E-mail: [email protected]. Author Contributions TP performed the experiments. The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. Funding Sources This work was supported by grants from the LIDEX BIG (Biologie Intégrative des Génomes) from University Paris-Saclay and “Région Ile-de-France” to DF and the Centre National de la Recherche Scientifique (CNRS).


16

Page 17 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ACKNOWLEDGMENT The authors thank Jonas Korlach for critical reading of the manuscript.

REFERENCES (1)

Zhu, P.; Craighead, H. G. Zero-Mode Waveguides for Single-Molecule Analysis. Annu. Rev. Biophys. 2012, 41, 269–293.

(2)

Eid, J.; Fehr, A.; Gray, J.; Luong, K.; Lyle, J.; Otto, G.; Peluso, P.; Rank, D.; Baybayan, P.; Bettman, B.; Bibillo, A.; Bjornson, K.; Chaudhuri, B.; Christians, F.; Cicero, R.; Clark, S.; Dalal, R.; Dewinter, A.; Dixon, J.; Foquet, M.; Gaertner, A.; Hardenbol, P.; Heiner, C.; Hester, K.; Holden, D.; Kearns, G.; Kong, X.; Kuse, R.; Lacroix, Y.; Lin, S.; Lundquist, P.; Ma, C.; Marks, P.; Maxham, M.; Murphy, D.; Park, I.; Pham, T.; Phillips, M.; Roy, J.; Sebra, R.; Shen, G.; Sorenson, J.; Tomaney, A.; Travers, K.; Trulson, M.; Vieceli, J.; Wegener, J.; Wu, D.; Yang, A.; Zaccarin, D.; Zhao, P.; Zhong, F.; Korlach, J.; Turner, S. Real-Time DNA Sequencing from Single Polymerase Molecules. Science 2009, 323, 133– 138.

(3)

Vilfan, I. D.; Tsai, Y.-C.; Clark, T. A.; Wegener, J.; Dai, Q.; Yi, C.; Pan, T.; Turner, S. W.; Korlach, J. Analysis of RNA Base Modification and Structural Rearrangement by SingleMolecule Real-Time Detection of Reverse Transcription. J. Nanobiotechnology 2013, 11, 8.

(4)

Uemura, S.; Aitken, C. E.; Korlach, J.; Flusberg, B. A.; Turner, S. W.; Puglisi, J. D. RealTime TRNA Transit on Single Translating Ribosomes at Codon Resolution. Nature 2010, 464, 1012–1017.


17


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(5)

Page 18 of 23

Tsai, A.; Puglisi, J. D.; Uemura, S. Probing the Translation Dynamics of Ribosomes Using Zero-Mode Waveguides. Prog. Mol. Biol. Transl. Sci. 2016, 139, 1–43.

(6)

Elting, M. W.; Leslie, S. R.; Churchman, L. S.; Korlach, J.; McFaul, C. M. J.; Leith, J. S.; Levene, M. J.; Cohen, A. E.; Spudich, J. A. Single-Molecule Fluorescence Imaging of Processive Myosin with Enhanced Background Suppression Using Linear Zero-Mode Waveguides (ZMWs) and Convex Lens Induced Confinement (CLIC). Opt. Express 2013, 21, 1189–1202.

(7)

Miyake, T.; Tanii, T.; Sonobe, H.; Akahori, R.; Shimamoto, N.; Ueno, T.; Funatsu, T.; Ohdomari, I. Real-Time Imaging of Single-Molecule Fluorescence with a Zero-Mode Waveguide for the Analysis of Protein-Protein Interaction. Anal. Chem. 2008, 80, 6018– 6022.

(8)

Goldschen-Ohm, M. P.; Klenchin, V. A.; White, D. S.; Cowgill, J. B.; Cui, Q.; Goldsmith, R. H.; Chanda, B. Structure and Dynamics Underlying Elementary Ligand Binding Events in Human Pacemaking Channels. eLife 2016, 5.

(9)

Christensen, S. M.; Triplet, M. G.; Rhodes, C.; Iwig, J. S.; Tu, H.-L.; Stamou, D.; Groves, J. T. Monitoring the Waiting Time Sequence of Single Ras GTPase Activation Events Using Liposome Functionalized Zero-Mode Waveguides. Nano Lett. 2016, 16, 2890–2895.

(10) Chen, J.; Dalal, R. V.; Petrov, A. N.; Tsai, A.; O’Leary, S. E.; Chapin, K.; Cheng, J.; Ewan, M.; Hsiung, P.-L.; Lundquist, P.; Turner, S. W.; Hsu, D. R.; Puglisi, J. D. HighThroughput Platform for Real-Time Monitoring of Biological Processes by Multicolor Single-Molecule Fluorescence. Proc. Natl. Acad. Sci. 2014, 111, 664–669.


18

Page 19 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(11) de Torres, J.; Ghenuche, P.; Moparthi, S. B.; Grigoriev, V.; Wenger, J. FRET Enhancement in Aluminum Zero-Mode Waveguides. Chemphyschem Eur. J. Chem. Phys. Phys. Chem. 2015, 16, 782–788. (12) Goldschen-Ohm, M. P.; White, D. S.; Klenchin, V. A.; Chanda, B.; Goldsmith, R. H. Observing Single-Molecule Dynamics at Millimolar Concentrations. Angew. Chem. Int. Ed Engl. 2017, 56, 2399–2402. (13) Korlach, J.; Marks, P. J.; Cicero, R. L.; Gray, J. J.; Murphy, D. L.; Roitman, D. B.; Pham, T. T.; Otto, G. A.; Foquet, M.; Turner, S. W. Selective Aluminum Passivation for Targeted Immobilization of Single DNA Polymerase Molecules in Zero-Mode Waveguide Nanostructures. Proc. Natl. Acad. Sci. U. S. A. 2008, 105, 1176–1181. (14) Pibiri, E.; Holzmeister, P.; Lalkens, B.; Acuna, G. P.; Tinnefeld, P. Single-Molecule Positioning in Zeromode Waveguides by DNA Origami Nanoadapters. Nano Lett. 2014, 14, 3499–3503. (15) Heucke, S. F.; Baumann, F.; Acuna, G. P.; Severin, P. M. D.; Stahl, S. W.; Strackharn, M.; Stein, I. H.; Altpeter, P.; Tinnefeld, P.; Gaub, H. E. Placing Individual Molecules in the Center of Nanoapertures. Nano Lett. 2014, 14, 391–395. (16) Larkin, J.; Foquet, M.; Turner, S. W.; Korlach, J.; Wanunu, M. Reversible Positioning of Single Molecules inside Zero-Mode Waveguides. Nano Lett. 2014, 14, 6023–6029. (17) Gopinath, A.; Rothemund, P. W. K. Optimized Assembly and Covalent Coupling of Single-Molecule DNA Origami Nanoarrays. ACS Nano 2014, 8, 12030–12040.


19


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 23

(18) Gopinath, A.; Miyazono, E.; Faraon, A.; Rothemund, P. W. K. Engineering and Mapping Nanocavity Emission via Precision Placement of DNA Origami. Nature 2016, 535, 401– 405. (19) Kershner, R. J.; Bozano, L. D.; Micheel, C. M.; Hung, A. M.; Fornof, A. R.; Cha, J. N.; Rettner, C. T.; Bersani, M.; Frommer, J.; Rothemund, P. W. K.; Wallraff, G. M. Placement and Orientation of Individual DNA Shapes on Lithographically Patterned Surfaces. Nat. Nanotechnol. 2009, 4, 557–561. (20) Gosule, L. C.; Schellman, J. A. Compact Form of DNA Induced by Spermidine. Nature 1976, 259, 333–335. (21) Hegedüs, E.; Kókai, E.; Kotlyar, A.; Dombrádi, V.; Szabó, G. Separation of 1-23-Kb Complementary DNA Strands by Urea-Agarose Gel Electrophoresis. Nucleic Acids Res. 2009, 37, e112. (22) Korlach, J.; Bjornson, K. P.; Chaudhuri, B. P.; Cicero, R. L.; Flusberg, B. A.; Gray, J. J.; Holden, D.; Saxena, R.; Wegener, J.; Turner, S. W. Real-Time DNA Sequencing from Single Polymerase Molecules. Methods Enzymol. 2010, 472, 431–455. (23) Vafabakhsh, R.; Ha, T. Extreme Bendability of DNA Less than 100 Base Pairs Long Revealed by Single-Molecule Cyclization. Science 2012, 337, 1097–1101. (24) Liu, Y.; Mahdavi, F.; Blair, S. Enhanced Fluorescence Transduction Properties of Metallic Nanocavity Arrays. IEEE J. Sel. Top. Quantum Electron. 2005, 11, 778–784.


20

Page 21 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(25) Rigneault, H.; Capoulade, J.; Dintinger, J.; Wenger, J.; Bonod, N.; Popov, E.; Ebbesen, T. W.; Lenne, P.-F. Enhancement of Single-Molecule Fluorescence Detection in Subwavelength Apertures. Phys. Rev. Lett. 2005, 95, 117401. (26) Gérard, D.; Wenger, J.; Bonod, N.; Popov, E.; Rigneault, H.; Mahdavi, F.; Blair, S.; Dintinger, J.; Ebbesen, T. W. Nanoaperture-Enhanced Fluorescence: Towards Higher Detection Rates with Plasmonic Metals. Phys. Rev. B 2008, 77, 045413. (27) Liu, Y.; Blair, S. Fluorescence Enhancement from an Array of Subwavelength Metal Apertures. Opt. Lett. 2003, 28, 507–509. (28) Foquet, M.; Samiee, K. T.; Kong, X.; Chauduri, B. P.; Lundquist, P. M.; Turner, S. W.; Freudenthal, J.; Roitman, D. B. Improved Fabrication of Zero-Mode Waveguides for Single-Molecule Detection. J. Appl. Phys. 2008, 103, 034301. (29) Ambrose, W. P.; Goodwin, P. M.; Keller, R. A.; Martin, J. C. Alterations of Single Molecule Fluorescence Lifetimes in Near-Field Optical Microscopy. Science 1994, 265, 364–367. (30) Xie, X. S.; Dunn, R. C. Probing Single Molecule Dynamics. Science 1994, 265, 361–364. (31) Anger, P.; Bharadwaj, P.; Novotny, L. Enhancement and Quenching of Single-Molecule Fluorescence. Phys. Rev. Lett. 2006, 96, 113002. (32) Malicka, J.; Gryczynski, I.; Gryczynski, Z.; Lakowicz, J. R. Effects of Fluorophore-toSilver Distance on the Emission of Cyanine-Dye-Labeled Oligonucleotides. Anal. Biochem. 2003, 315, 57–66.


21


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 23

(33) Jennings, T. L.; Singh, M. P.; Strouse, G. F. Fluorescent Lifetime Quenching near d = 1.5 Nm Gold Nanoparticles: Probing NSET Validity. J. Am. Chem. Soc. 2006, 128, 5462– 5467. (34) Hud, N. V.; Downing, K. H. Cryoelectron Microscopy of Lambda Phage DNA Condensates in Vitreous Ice: The Fine Structure of DNA Toroids. Proc. Natl. Acad. Sci. U. S. A. 2001, 98, 14925–14930. (35) Golan, R.; Pietrasanta, L. I.; Hsieh, W.; Hansma, H. G. DNA Toroids: Stages in Condensation. Biochemistry (Mosc.) 1999, 38, 14069–14076. (36) Conwell, C. C.; Vilfan, I. D.; Hud, N. V. Controlling the Size of Nanoscale Toroidal DNA Condensates with Static Curvature and Ionic Strength. Proc. Natl. Acad. Sci. U. S. A. 2003, 100, 9296–9301. (37) Huang, D.; Freeley, M.; Palma, M. DNA-Mediated Patterning of Single Quantum Dot Nanoarrays: A Reusable Platform for Single-Molecule Control. Sci. Rep. 2017, 7, 45591.


22

Page 23 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table of content (TOC) Coiled DNA

Zero Mode Waveguides

Single-molecule loading

empty

3 molecules

1 molecule

≥ 4 molecules

2 molecules


23

DNA-Guided Delivery of Single Molecules into Zero-Mode

Recommend Documents