Article pubs.acs.org/ac
Antibodies Directed to RNA/DNA Hybrids: An Electrochemical Immunosensor for MicroRNAs Detection using Graphene-Composite Electrodes H. V. Tran,† B. Piro,† S. Reisberg,† H. T. Duc,‡ and M.C. Pham*,† †
Univ. Paris Diderot, Sorbonne Paris Cité, ITODYS, UMR 7086 CNRS, 15 rue J-A de Baïf, 75205 Paris Cedex 13, France Université Paris XI, INSERM U-1014, Groupe Hospitalier Paul Brousse-94800 Villejuif, France
‡
S Supporting Information *
ABSTRACT: We report a simple and sensitive label-free immunosensor for detection of microRNAs (miRNA) based on a conducting polymer/reduced graphene oxide-modified electrode to detect miR-29b-1 and miR-141. Square wave voltammetry is used to record the redox signal. Current increases upon hybridization (signal on) from 1 fM to 1 nM of target miRNA. The limit of quantification is ca. 5 fM. The sensor exhibits high selectivity as it distinguishes mismatch. To double-check its selectivity, two specific RNA−DNA antibodies recognizing miRNA−DNA heteroduplexes, antipoly(A)−poly(dT) and anti-S9.6, were used. The antibody complexation with the hybrid leads to a current decrease that confirms the presence of miRNA, down to a concentration of 8 fM. The antibody−hybrid complex can be then dissociated by adding miRNA−DNA hybrids in solution, causing a shift-back on the signal, i.e., an increase in the current density (signal-on). This On−Of f−On detection sequence was used as a triple verification to increase the reliability of the results.
M
We recently designed a label-free and reagentless microRNA electrochemical sensor based on an interpenetrated network of carbon nanotubes and electroactive polymer16 to detect a prostate cancer biomarker, miRNA-141, with a limit of detection of 8 fM. In this work, we develop a combination of the hybridization assay with an immunological process to make triple verification of the microRNA concentration. A related procedure has been very recently described by Labib et al.27 The authors describe in a very detailed way three sequential transduction modalities based on hybridization (signal-on), p19 protein binding (signal-off), and competitive protein displacement (shift-back to signal-on). We propose here a simple and sensitive label-free electrochemical sensor based on conducting polymer/reduced graphene oxide-modified glassy carbon electrodes (CP/RGO/ GCE). Square wave voltammetry is used to record the redox signal. The system is signal-on as the current increases upon hybridization with a detection limit around 5 fM. The sensor is selective and able to discriminate a mismatch on the target sequence. We combine the hybridization assay with the specific binding of anti-DNA−RNA antibody to DNA−RNA hybrids to double-check the signal and increase its reliability: on the electrode surface, antibodies complexation leads to a current decrease that confirms the presence of miRNA. By this means,
icroRNA (miRNAs) are a class of small, noncoding RNAs which play an important role in various regulatory functions and disorders such as cancers and heart diseases. Current standard methods for identification and quantification of miRNAs are based on traditional molecular biology techniques (Northern blot,1,2 microarray,3,4 qRT-PCR5,6). These approaches although very sensitive and reliable are often expensive and time-consuming. That is why a real challenge is to develop devices able to detect and quantify easily and simultaneously different miRNA sequences at subpicomolar levels. Electrochemical biosensors are considered as one of the most appealing techniques in terms of cost, ease of operation, and automation.7−13 Moreover, nanomaterials combined with electrochemical biosensors are emerging options for miRNA detection including silver nanocluster,9 nanostructured platinum electrodes,10,12 silicon nanowires,13 gold nanoparticles,14 ruthenium oxide nanoparticles,15 carbon nanotubes16 or graphene.17,18 An original strategy using monoclonal and polyclonal antibodies recognizing RNA−DNA and RNA−RNA duplexes has been developed in a hybridization-based assay to detect nucleic acid targets.19−23 Anti-RNA−DNA antibodies used to recognize miRNAs were previously reported by S.H. Leppla’s group24 based on fluorescence assays and by H. Sipova et al.25 and A.J. Qavi et al.26 based on SPR detection. This immunological approach is extremely interesting because it adds the highly selective recognition properties of antibodies to the high intrinsic selectivity of hybridization; miRNAs can be detected at the pM level using such an approach. © 2013 American Chemical Society
Received: July 15, 2013 Accepted: August 9, 2013 Published: August 9, 2013 8469
dx.doi.org/10.1021/ac402154z | Anal. Chem. 2013, 85, 8469−8474
Analytical Chemistry
Article
Table 1. List of DNA and miRNA Sequences ODN name
function
bases
pDNA-141 miR-141 pDNA-29b-1 tDNA-29b-1 miR-29b-1
probe DNA target RNA probe DNA target DNA target RNA
22 22 23 23 23
sequences 5′ 3′ 5′ 3′ 3′
NH2-CCATCTTTACCAGACAGTGTTA 3′ GGUAGAAAUGGUCUGUCACAAU 5′ NH2-AACACTGATTTCAAATGGTGCTA 3′ TTGTGAGTAAAGTTTACCACGAT 5′ UUGUGACUAAAGUUUACCACGAU 5′
Electropolymerization of Poly(JUG-co-JUGA) on RGO/ GCE (CP/RGO/GCE). RGO/GCEs were immersed into a solution containing 50 mM JUG + 3.75 mM JUGA + 1 mM 1NAP in ACN, and electropolymerization was carried out by potential cycling in the range of 0.4−1.1 V vs SCE for 25 cycles at 50 mV s−1. Electrodes were then washed with ACN and ethanol to remove adsorbed monomers, to obtain conducting polymer-coated RGO-modified GC electrodes (CP/RGO/ GCE). Probe Grafting, miRNA Hybridization, and miRNA/ DNA Heteroduplex Complexation by RNA/DNA Antibodies. NH2-modified DNA probes were covalently grafted on CP/RGO/GCE in 0.1 M MES buffer containing 150 mM EDC + 300 mM NHS. The reaction was carried out overnight at 37 °C. Electrodes were then washed with water and PBS and incubated in PBS at 37 °C for 1 h to release physisorbed DNA probes. Hybridization solutions containing miRNA targets were prepared and heated for 5 min above the melting temperature of the corresponding duplex; then, the probe-modified electrodes were dipped into this solution at 45 °C for 1 h. After hybridization, electrodes were washed with 1× SSC (saline sodium citrate) buffer for 1 min at 45 °C and then dipped into 1× PBS at 37 °C for 30 min in order to wash out physisorbed targets. For complexation with antibodies, after hybridization, miRNA/DNA/CP/RGO/GCE electrodes were incubated in a solution containing 20 μg mL−1 of S9.6 or poly(A)−poly(dT) antibodies for 1 h at 37 °C and then washed twice with 0.05% Tween 20 in PBS and thrice with PBS.
we reached a low limit of detection of ca. 8 fM. The antibody− hybrid complex can be then dissociated by adding miRNA− DNA hybrids in solution, causing an increase in the current density (signal-on). This On−Of f−On detection sequence was used as a triple verification to increase the reliability of the results.
■
EXPERIMENTAL SECTION Materials and Reagents. 3-(5-Hydroxy-1,4-dioxo-1,4dihydronaphthalen-2(3)-yl) propanoic acid (JUGA) was synthesized in our lab from 5-hydroxy-1,4-naphthoquinone (JUG) and succinic acid.28 Other reagents (sodium hydroxide, NaOH; hydrochloric acid, HCl; trisodium citrate, sodium acetate, sodium chloride, NaCl) and solvents (acetonitrile, ACN; methanol, MeOH; dichloromethane, DCM; ethyl acetate, EtOAc; toluene) were PA grade. 1-Naphthol (1NAP) was provided by Acros. Epigallocatechin gallate (EGCG), 2-(N-morpholino)ethanesulfonic acid (MES), sodium saline citrate (SSC, 0.15 M sodium chloride, 15 mM trisodium citrate, adjusted to pH 7.0 with HCl), phosphate buffer saline (PBS, 137 mM NaCl; 2.7 mM KCl; 8.1 mM Na2HPO4; 1.47 mM KH2PO4, pH 7.4), Tween 20 (polyoxyethylene 20 sorbitan monolauratelithium), perchlorate (LiClO4), and 5-hydroxy-1,4-naphthoquinone (JUG, purity 97%) were purchased from Sigma-Aldrich. 1-(3-Dimethylamino-propyl)-3-ethylcarbodiimide hydrochloride (EDC, purity 98%) and N-hydroxysuccinimide (NHS, purity 98%) were from Alfa Aesar (Ward Hill, MA). Single-layer grapheme oxide (diameter 1−5 μm; thickness 0.8−1.2 nm) was purchased from ACS Material LLC (Medford, MA, USA) and synthesized using the modified Hummer’s method. Aqueous solutions were made with ultrapure (18 MΩ cm) water. Glassy carbon working electrodes (3 mm diameter, S = 0.07 cm2) were purchased from BAS Inc. All oligonucleotides were purchased from Eurogentec (Belgium) and are detailed in Table 1. We used NH2-modified ODN probes complementary to miRNAs typical for myocardial infarction (miR-29b-1) and prostate cancer (miR-141). Antipoly(A)−poly(dT) antibody was provided by Prof. B. D. Stollar (Tufts University, Medford, MA). S9.6 antibody was provided by Dr. S.H. Leppla (US NIH, Bethesda, MD). Preparation of RGO-Modified Electrodes. Twenty-four mg of graphene oxide (GO) was dispersed in water under ultrasonication for 30 min. Ten mg of epigallocatechin gallate (EGCG) in water was added to the GO dispersion; then, the mixture was heated to 80 °C under stirring for 8 h. The resulting slurry was cooled down to room temperature, filtered, and washed by distillated water to obtain reduced graphene oxide (RGO) as a black precipitate. After reduction, RGO is easily dispersed in water (Figure SI.1, Supporting Information). The procedure to quantify RGO is given in Figure SI.2, Supporting Information. In order to modify glassy carbon electrodes (GCEs) by RGO, 5 μL of a solution containing 0.5 mg mL−1 RGO suspended in water was dropped on freshly polished GCE and allowed to evaporate at room temperature.
■
RESULTS AND DISCUSSION Characterization of RGO. UV−vis spectra of GO, EGCG, and RGO are given in Figure SI.3A, Supporting Information. GO shows a peak at 234 nm and a shoulder at 300 nm. The peak at 234 nm is attributed to π → π* transition of CC bonds. After reduction to graphene, the aromatic CC bonds red-shifted to 269 nm (Figure SI.3A, curve b, Supporting Information) indicating the restoration of a π-conjugation network. This is in good agreement with the literature.29−34 FT-IR spectra are given and described in Figure SI.3B, Supporting Information; absorption bands are summarized in Table 2. An AFM picture of RGO/GCE is provided in Figure SI.3C, Supporting Information. RGO sheets have a thickness of about 2 nm; that is larger compared with the commercial GO for which thickness is around 1.2 nm. This could be due to intercalation of EGCG molecules in between sheets, even if no measurable bands from EGCG are present on the FT-IR spectrum of RGO. Preparation and Characterization of CP/RGO/GC Electrodes. Electrooxidation of a mixture of 5 × 10−2 M JUG, 3.75 × 10−3 M JUGA (JUGA/JUG = 0.075), 0.1 M LiClO4, and 10−3 M 1-naphthol in ACN was performed on RGO/GCE. Solutions were deoxygenated by bubbling Ar for 8470
dx.doi.org/10.1021/ac402154z | Anal. Chem. 2013, 85, 8469−8474
Analytical Chemistry
Article
Table 2. FT-IR Band Wavenumbers (cm−1) of GO and RGOa assignment wavenumbers νexp/ cm−1 3400 1718 1618 1346 1208 1059 a
GO νO−H (hydroxyl), strong νCO (carboxyl), strong νCC (aromatic ring), strong νC−OH (hydroxyl) νO−H (hydroxyl) νC−O−C (epoxide group), strong
RGO νO−H (hydroxyl), strong disappear νCC (aromatic ring), strong νC−OH (hydroxyl), weak νO−H (hydroxyl) νC−O−C (epoxide group), weak
By transmission, in KBr pellets.
about 10−15 min prior to experiments, and Ar was continuously passed over the solution during measurements. The potential was scanned from 0.4 to 1.1 V (vs SCE) at a scan rate of 50 mV s−1 for 20 cycles (Figure SI.4, Supporting Information). The redox peaks situated at +0.95/+0.85 V vs SCE develop continuously under scanning, indicating poly(JUG-co-JUGA) film formation on RGO-modified electrode surface (CP/RGO/GCE). Cyclic voltammetry and SWV were performed on CP/RGO/GCE, for different surface densities of RGO (Figure SI.5, Supporting Information). The observed peaks are due to quinone electroactivity. Charge integration (faradic current only) for a poly(JUG-co-JUGA) film (formed after 25 polymerization cycles) on bare GCE gives a surface density Γ = (3.51 ± 0.48) 10−9 mol cm−2 electroactive quinone, while in the same conditions with RGO/GCE electrode, Γ is ca. (10.57 ± 1.43) 10−9 mol cm−2 (RGO density used is 35.7 μg cm−2, details given in Figure.SI.5D, Supporting Information). In the following, we selected a surface density of 35.7 μg cm−2, i.e., 5 μL of 0.5 mg mL−1 RGO suspended in water. The electroactivity of freshly prepared CP/GCE and CP/ RGO/GCE films was investigated in deaerated PBS by cyclic voltammetry (Figure 1A). For CP/GCE, two redox couples typical for quinone electroactivity in PBS appeared: a main couple situated at −0.50/−0.60 V and a secondary one at −0.78/−0.85 V. For CP/RGO/GCE, the corresponding couples were seen at −0.37/−0.49 V (its intensity increased with respect to RGO density) and −0.69/−0.75 V (its intensity remained independent of RGO density). The anodic and cathodic peak currents, ipa and ipc, are linearly proportional to the square root of scan rate, ν1/2 indicating an expected diffusion-controlled process (Figure SI.6, Supporting Information). Typical square wave voltammograms are given in Figure 1B for CP/GCE and CP/RGO/GCE. A main peak appears at −0.41 V with a shoulder around −0.74 V, corresponding to the two redox couples observed in the cyclic voltammograms. DNA Probe Immobilization and miRNAs Detection. 5′Amino-modified DNA probes were immobilized on CP/RGO/ GCE with a surface concentration (ΓODN) estimated around (10 ± 5) pmol cm−2.16 For such surface concentration, ODN probe strands are closely packed on the electrode surface. This leads to strong steric hindrance which decreases the apparent diffusion coefficient of counterions, therefore decreasing the faradic current. That is why SWVs give more intense variations than CVs, for which both faradic and capacitive currents appear (Figure SI.7, Supporting Information). Conversely, hybridization causes conformational reorganization of the double strands which creates free space on the electrode surface and
Figure 1. (A) CVs and (B) SWVs of (dashed line) poly(JUG-coJUGA)/GCE and (blue solid line) poly(JUG-co-JUGA)/RGO/GCE. RGO density: 35.7 μg cm−2. Medium: PBS. Scan rate: 50 mV s−1.
induces a significant current increase.16 This phenomenon has been previously investigated by impedance spectroscopy35 and corroborated by a mechanistic investigation.36 As shown in Figure 2A, the SWV current increases upon hybridization, depending on the target (miR-29b-1) concentration in the range of 1 fM to 10 nM (Figure 2B). The practical limit of quantification is ca. 5 fM. In order to confirm that current changes were due to hybridization, melting curves were obtained by incubation of miR-29b-1/p-29b-1/CP/RGO/GC electrodes in PBS for 5 min at different temperatures between 25 and 70 °C. Electrodes were then cooled down to room temperature, and SWV were recorded in fresh PBS (Figure 3A). Control samples corresponded to p-29b-1/CP/RGO/GCE, onto which no miR-29b-1 has been hybridized. Figure 3B shows the relative current changes as a function of temperature. For p-29b-1/CP/ RGO/GCE, the current decreases gradually versus temperature (Figure 3B, curve a), while for miR-29b-1/p-29b-1/CP/RGO/ GCE, the relative current change ΔI/I (I = Ibefore hybridization and ΔI = Iafter hybridization − Ibefore hybridization) presents a sigmoidal shape that can be attributed to the melting of the heteroduplexes (Figure 3B, curve b). From this curve, one can estimate an apparent melting temperature of ca. 55 °C 8471
dx.doi.org/10.1021/ac402154z | Anal. Chem. 2013, 85, 8469−8474
Analytical Chemistry
Article
Figure 3. (A) (a) SWV recorded at room temperature of a p-29b-1/ CP/RGO/GCE (control). (b and curves below) SWVs recorded at room temperature after incubation at different temperatures between 25 and 70 °C for a miR-29b-1/p-29b-1/CP/RGO/GCE. (B) Relative current decreases obtained from (A). p-29b-1/CP/RGO/GCE (curve a, control) and miR-29b-1/p-29b-1/CP/RGO/GCE (curve b). ΔI/I = (IT − Iprobe)/Iprobe, with IT as the current intensity at a given temperature T and Iprobe as the current intensity of the same electrode before hybridization.
Figure 2. (A) SWVs (green curve) after pDNA-29b-1 probe grafting, (red curve) after hybridization with 10 fM of miR-29b-1 and (black curve) after hybridization with 10 nM of miR-29b-1. (B) Calibration curve: ΔI/I (%) vs miR-29b-1 target concentration. Density of RGO: 35.7 μg cm−2. Medium: PBS. Relative current changes were calculated as follows: I = Ibefore hybridization and ΔI = Iafter hybridization − Ibefore hybridization.
(corresponding to half the current difference between curves (a) and (b), at 70 °C), which is consistent with the miR-29b-1 sequence (the melting point of the corresponding DNA/DNA duplex is ca. 47 °C in homogeneous conditions). Selectivity of the Biosensor. This was investigated by cross-hybridization using two different DNA probes (p-DNA29b-1 and p-DNA-141) and two different miRNA targets (miR29b-1 and miR-141). As shown in Figure 4, miR-141/p-DNA141 and miR-29b-1/p-DNA-29b-1 hybridizations lead to significant current increases whereas miR-141/p-DNA-29b-1 and miR-29b-1/p-DNA-141 hybridizations lead to much lower current increases. These results definitely demonstrate that the current changes are specific to the hybridization event. Cross-hybridization experiments were also performed in a mixture of the two targets (SWV are given in Figure SI.8, Supporting Information). A p-29b-1/CP/RGO/GCE was first immersed in a solution containing 1 pM of miR-141; the current showed a 4% increase. After addition of 1 pM miR-29b1 into the same solution, the current showed an increase of 21%. This demonstrates the specificity of the miRNA sensor. miRNA−DNA Hybrids Recognition by RNA−DNA Antibodies. In addition to miRNA detection through classical hybridization, we also took profit from a very original approach based on the use of antibodies able to bind specifically, with high-affinity, DNA−RNA hybrids (these antibodies are
nucleotide sequence-independent).19−26 More precisely, we used two different anti-RNA−DNA antibodies, one kindly provided by Prof. B. David Stollar (a polyclonal antipoly(A)− poly(dT)22) and the other kindly provided by Dr. S.H. Leppla (a mouse monoclonal antibody S9.624), to recognize miRNA− DNA hybrids on the surface of our sensor. Following this approach, antibodies that bind to miRNA−DNA hybrids consequently generate steric hindrance which slows down ion exchange at the electrode surface and leads to current decrease. Relative current changes on SWVs were recorded before and after antipoly(A)−poly(dT) binding on miR-29b-1/p-29b-1/ CP/RGO/GCE (hybridization with 1 nM of miR-29b-1, Figure 5A). As shown, the current change is significant, even for low antibody concentrations (blue circles). Experiments were also performed using a completely nonspecific antibody, i.e., antiNEF (NEF is a 25 kD protein related to HIV infection, having no affinity with RNA−DNA hybrids), instead of antipoly(A)− poly(dT). In this case, the current decreased less than 2% for all concentrations, which demonstrates that current changes are due to specific recognition of miRNA/DNA hybrids. Figure 5B presents the current decrease, after complexation with a given antibody concentration (20 μg mL−1), as a function of the target miR-29b-1 concentration. Taking into account errors, it appears that the two antibodies cause 8472
dx.doi.org/10.1021/ac402154z | Anal. Chem. 2013, 85, 8469−8474
Analytical Chemistry
Article
Figure 4. (a, b) SWVs of p-DNA-141-modified electrode before (dash black curve) and after (solid red curve) hybridization with 1 nM of miR-141(a) and miR-29b-1 (b); (c, d) p-DNA 29b-1-modified electrode before (dash black curve) and after (solid red curve) hybridization with 1 nM of miR-29b-1 (c) and miR-141 (d).
comparable current decrease for each miRNA concentration, down to a detection limit ca. 8 fM. Figure 5C presents results obtained after complexation with antipoly(A)−poly(dT) or S9.6 antibodies, on miR-29b-1/p29b-1, miR-141/p-29b-1, tDNA-29b-1/p-29b-1, and p-29b-1 (no target strand) CP/RGO/GC electrodes (columns a, b, c, and d, respectively). As shown, the mean current decreases are 25%, 6%, 2%, and 1.5%, respectively. SWV curves are given in Figure SI.9A, Supporting Information, for antipoly(A)−poly(dT) with different concentrations of miR-29b-1 (curves a−g) and for control experiments (curves h−j); Figure SI.9B, Supporting Information, shows SWVs for S9.6 antibody under the same experimental conditions. The antibody/hybrid complexation is reversible. The decomplexation process was investigated by designing a competitive assay: after miR-29b-1/p-29b-1/CP/RGO/GCE complexation with the S9.6 antibody, electrodes were incubated in a solution containing 6.4 nM of miR-29b-1/p-29b-1 hybrids free into solution (details are given in Figure SI.10, Supporting Information); then, SWVs were recorded. It was shown that the current increased after incubation, which indicates a decomplexation of the antibodies from the electrode surface.
Figure 5. (A) Relative current decrease (ΔI/I) versus antipoly(A)− poly(dT) concentration (blue circles) and anti-NEF, a nonspecific antibody (red squares), after complexation on miR-29b-1/p-29b-1/ CP/RGO/GC electrodes (hybridized with 1 nM miR-29b-1). (B) Relative current decrease (ΔI/I) after complexation with antibodies (black columns correspond to S9.6 while red columns correspond to antipoly(A)−poly(dT)), for different miR-29b-1 hybridization concentrations. (C) Relative current decrease (ΔI/I) after complexation with antibodies (black columns correspond to S9.6 while red columns correspond to antipoly(A)−poly(dT)), for (a) miR-29b-1/p-29b-1, (b) miR-141/p-29b-1, (c) tDNA-29b-1/p-29b-1, and (d) p-29b-1 (no target, blank sample) CP/RGO/GC electrodes. Hybridization concentration: 1 nM. ΔI/I = (Iafter complexation − Ibefore complexation)/ Ibefore complexation.
■
CONCLUSION In this work, we have prepared a suspension of reduced graphene oxide in water and used it for easy fabrication of an electrochemical biosensor. We have designed and developed a label-free and reagentless electrochemical miRNA sensor based
on a conducting polymer/graphene oxide (CP/RGO) nanocomposite-modified electrode. This sensor was used to sense miRNAs by hybridization on immobilized ODN probes. Taking advantage of the strong affinity of miRNA for DNA, we 8473
dx.doi.org/10.1021/ac402154z | Anal. Chem. 2013, 85, 8469−8474
Analytical Chemistry
Article
(8) Bettazzi, F.; Hamid-Asl, E.; Esposito, C. L.; Quintavalle, C.; Formisano, N.; Laschi, S.; Catuogno, S.; Iaboni, M.; Marrazza, G.; Mascini, M.; Cerchia, L.; Franciscis, V. D.; Condorelli, G.; Palchetti., I. Anal. Bioanal. Chem. 2013, 405, 1025−1034. (9) Dong, H.; Jin, Shi; Ju, H.; Hao, K.; Xu, L.-P.; Lu, H.; Zhang., X. Anal. Chem. 2012, 84, 8670−8674. (10) Yang, H.; Hui, A.; Pampalakis, G.; Soleymani, L.; Liu, F.-F.; Sargent, E. H.; Kelley., S. O. Angew. Chem., Int. Ed. 2009, 48, 8461− 8464. (11) Gao, Z.; Peng, Y. Biosens. Bioelectron. 2011, 26, 3768−3773. (12) Fang, Z.; Soleymani, L.; Pampalakis, G.; Yoshimoto, M.; Squire, J. A.; Sargent, E. H.; Kelley, S. O. ACS Nano 2009, 3, 3207−3213. (13) Zhang, G. J.; Chua, J. H.; Chee, R. E.; Agarwal, A.; Wong, S. M. Biosens. Bioelectron. 2009, 24, 2504−2508. (14) Xia, N.; Zhang, L.; Wang, G.; Feng, Q.; Liu, L. Biosens. Bioelectron. 2013, 47, 461−466. (15) Peng, Y.; Yia, G.; Gao, Z. Chem. Commun. 2010, 46, 9131− 9133. (16) Tran, H. V.; Piro, B.; Reisberg, S.; Tran, L. D.; Duc, H. T.; Pham, M. C. Biosens. Bioelectron. 2013, 49, 164−169. (17) Yin, H.; Zhou, Y.; Zhang, H.; Meng, X.; Ai, S. Biosens. Bioelectron. 2012, 33, 247−253. (18) Dong, H.; Ding, L.; Yan, F.; Ji, H.; Ju, H. Biomaterials 2011, 32, 3875−3882. (19) Stollar, B. D. Science 1970, 169, 609−611. (20) Boguslawski, S. J.; Smith, D. E.; Michalak, M. A.; Mickelson, K. E.; Yehle, C. O.; Patterson, W. L.; Carrico, R. J. J. Immunol. Methods 1986, 89, 123−130. (21) Schwartz, E. F.; Stollar, B. D. Biochem. Biophys. Res. Commun. 1969, 35, 115−120. (22) Kitagawa, Y.; Stollar, B. D. Mol. Immunol. 1982, 19, 413−420. (23) Rudkin, G. T.; Stollar, B. D. Nature 1977, 265, 472−473. (24) Hu, Z.; Zhang, A.; Storz, G.; Gottesman, S.; Leppla, S. H. Nucleic Acids Res. 2006, 37, No. e52. (25) Sípová, H.; Zhang, S.; Dudley, A. M.; Galas, D.; Wang, K.; Homola, J. Anal. Chem. 2010, 82, 10110−10115. (26) Qavi, A. J.; Kindt, J. T.; Gleeson, M. A.; Bailey, R. C. Anal. Chem. 2011, 83, 5949−5956. (27) Labib, M.; Khan, N.; Ghobadloo, S. M.; Cheng, J.; Pezacki, J. P.; Berezovski, M. V. J. Am. Chem. Soc. 2013, 135, 3027−3038. (28) Piro, B.; Kapella, A.; Le, V. H.; Anquetin, G.; Zhang, Q. D.; Reisberg, S.; Noel, V.; Tran, L. D.; Duc, H. T.; Pham, M. C. Electrochim. Acta 2011, 56, 10688−10693. (29) Hu, Y.; Li, F.; Bai, X.; Li, D.; Hua, S.; Wang, K.; Niu, L. Chem. Commun. 2011, 47, 1743−1745. (30) Hu, Y.; Wang, K.; Zhang, Q.; Li, F.; Wu, T.; Niu, L. Biomaterials 2012, 33, 1097−1106. (31) Feng, L.; Chen, Y.; Ren, J.; Qu, X. Biomaterials 2011, 32, 2930− 2937. (32) Feng, L.; Wu, L.; Wang, J.; Ren, J.; Miyoshi, D.; Sugimoto, N.; Qu, X. Adv. Mater. 2012, 24, 125−131. (33) Wu, L.; Wang, J.; Feng, L.; Ren, J.; Wei, W.; Qu, X. Adv. Mater. 2012, 22, 2447. (34) Wang, Y.; Shi, Z.; Yin, J. ACS Appl. Mater. Interfaces 2011, 3, 1127−1133. (35) Rubin, A.; Piro, B.; Haccoun, J.; Pham, M. C.; Tran, L. D.; Perrot, H.; Gabrielli, C. J. Electroanal. Chem. 2005, 577, 155−165. (36) Piro, B.; Reisberg, S.; Noel, V.; Pham, M. C. Biosens. Bioelectron. 2007, 22, 3126−3131.
obtained a very low detection limit ca. 5 fM, through an On signal, i.e., a current increase upon hybridization. We also demonstrated that antibodies developed for RNA/DNA hybrids can be used to complex hybrids on the electrode surface. On the basis of a simple steric hindrance principle, antibodies generate an Of f signal (a current decrease) which depends on the initial miRNA concentration used for hybridization and therefore provides a double verification of the miRNA concentration. At last, we have demonstrated that this Of f signal can be turned back into an On signal if RNA/ DNA hybrids are introduced into solution. This triple On− Of f−On transduction sequence is powerful as it combines the high affinity and selectivity provided by both nucleic acids and antibodies. Specially, the On signals guarantee an efficient discrimination of all nonspecific adsorptions (adsorption of proteins generates Of f signal). MiR-29b-1 (infarctus biomarker) and miR-141 (prostate cancer biomarker) were used in this work, but these results pave the way for easy electrochemical detection of any type of miRNA biomarkers in body fluids. The low limit of detection can be reached without using PCR or any other enzyme-based amplification process.
■
ASSOCIATED CONTENT
S Supporting Information *
Procedures for reduction of graphene oxide, FT-IR and UV−vis characterizations of poly(JUG-co-JUGA)/RGO, preparation of the modified electrodes and results related to miRNA hybridization, antibody complexation, and competitive decomplexation. This material is available free of charge via the Internet at http://pubs.acs.org.
■
AUTHOR INFORMATION
Corresponding Author
*Tel. +33-1-57277223. E-mail:
[email protected]. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS H.V.T. thanks the University of Sciences and Technology of Hanoi (USTH) for a Ph.D. grant. The authors are very grateful to Prof. B.D. Stollar (TUFTS University) for providing us the poly(A)−poly(dT) antibody. We thank Dr. S.H. Leppla and C.E. Leysath (U.S. National Institutes of Health) for supplying the S9.6 antibody.
■
REFERENCES
(1) Válóczi, A.; Hornyik, C.; Varga, N.; Burgyán, J.; Kauppinen, S.; Havelda., Z. Nucleic Acids Res. 2004, 32, No. e175. (2) Pall, G. S.; Codony-Servat, C.; Jane Byrne, L. R.; Hamilton., A. Nucleic Acids Res. 2007, 35, No. e60. (3) Liang, R.-Q.; Li, W.; Li, Y.; Tan, C.; Li, J. X.; Jin, Y. X.; Ruan., K. C. Nucleic Acids Res. 2005, 33, No. e17. (4) Nelson, P. T.; Baldwin, D. A.; Scearce, L. M.; Oberholtzer, J. C.; Tobias, J. W.; Mourelatos., Z. Nat. Methods 2004, 1, 155−161. (5) Chen, C.; Ridzon, D. A.; Broomer, A. J.; Zhou, Z.; Lee, D. H.; Nguyen, J. T.; Barbisin, M.; Xu, N. L.; Mahuvakar, V. R.; Andersen, M. R.; Lao, K. Q.; Livak, K. J.; Guegler., K. J. Nucleic Acids Res. 2005, 33, e179. (6) Li, J.; Yao, B.; Huang, H.; Wang, Z.; Sun, C.; Fan, Y.; Chang, Q.; Li, S.; Wang, X.; Xi., J. Anal. Chem. 2009, 81, 5446−5451. (7) Gao, Z.; Deng, H.; Shen, W.; Ren., Y. Anal. Chem. 2013, 85, 1624−1630. 8474
dx.doi.org/10.1021/ac402154z | Anal. Chem. 2013, 85, 8469−8474
