DNA Microgels as a Platform for Cell-Free Protein ... - ACS Publications

Subscriber access provided by TULANE UNIVERSITY

Article

DNA Microgels as a Platform for Cell-free Protein Expression and Display Jason Samuel Kahn, Roanna C.H. Ruiz, Swati Sureka, SongMing Peng, Thomas L. Derrien, Duo An, and Dan Luo Biomacromolecules, Just Accepted Manuscript • DOI: 10.1021/acs.biomac.6b00183 • Publication Date (Web): 25 Apr 2016 Downloaded from http://pubs.acs.org on April 27, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biomacromolecules is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

DNA Microgels as a Platform for Cell-free Protein Expression and Display Jason S. Kahn,† Roanna C.H. Ruiz,‡ Swati Sureka,† Songming Peng,† Thomas L. Derrien,† Duo An,† and Dan Luo*,†,§

†

Department of Biological and Environmental Engineering, Cornell University, Ithaca, NY

14853 USA. E-mail: [email protected] ‡

Department of Biomedical Engineering, Cornell University, Ithaca, NY 14853, USA.

§

Kavli Institute at Cornell for Nanoscale Science, Cornell University, Ithaca, NY, 14853, USA.

ACS Paragon Plus Environment

1

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 31

ABSTRACT

Protein expression and selection is an essential process in the modification of biological products. Expressed proteins are selected based on desired traits (phenotypes) from diverse gene libraries (genotypes), whose size may be limited due to the difficulties inherent in diverse cell preparation. In addition, not all genes can be expressed in cells, and linking genotype with phenotype further presents a great challenge in protein engineering. In this paper, we present a DNA gel-based platform that demonstrates the versatility of two DNA microgel formats to address fundamental challenges of protein engineering, including high protein yield, isolation of gene sets, and protein display. We utilize microgels to show successful protein production and capture of a model protein green fluorescent protein (GFP), which is further used to demonstrate a successful gene enrichment through fluorescent activated cell sorting (FACS) of a mixed population of microgels containing the GFP gene. Through psoralen crosslinking of the hydrogels, we have synthesized DNA microgels capable of surviving denaturing conditions while still possessing the ability to produce protein.

Lastly, we demonstrate a method of

producing extremely high local gene concentrations of up to 32,000 gene repeats in hydrogels 12 µm in diameter. These DNA gels can serve as a novel cell-free platform for integrated protein expression and display, which can be applied towards more powerful, scalable protein engineering and cell-free synthetic biology with no physiological boundaries and limitations.

KEYWORDS: DNA · hydrogel · directed evolution · protein expression · protein display


2

Page 3 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

INTRODUCTION

The engineering of proteins through directed evolution holds enormous potential in both academia and industry. Phenomena ranging from binding specificity to enzymatic catalysis have been enhanced through this methodology.1–4 In such evolutionary processes, the final characteristics are a direct outcome of the starting system, selection pressures, and ability to access a full mutation space, where greater control over and access to potential mutations is the ultimate goal. The majority of current methods involve the use of live cells in protein expression and selection, and the need to sustain a fully-functioning cell system both minimizes mutant variability by selecting against those harmful to the cell and reduces selection pressures to those that will not kill the cells. In order to test a larger mutation space, an entirely cell-free system would minimize these factors. The potential of cell-free directed evolution, specifically gene enrichment, was demonstrated by the SELEX method,5,6 and has become a commonly used and effective procedure for affinity selections based on large pools of RNAs. This process has proven to be a powerful method to evolve short RNA sequences towards stronger target binding by enriching the gene pool based on binding strength. SELEX possesses the benefit of having the phenotype of the process be the gene itself, and thus bypasses the need for a phenotype-genotype connection. After the introduction of SELEX, multiple processes have been developed that have concerned selection and enrichment of proteins based on binding/interaction assays, notably mRNA7, ribosome8, and yeast/phage display9–14,7. More recently, efforts have been made to expand the field of directed evolution in selecting for phenotypes beyond binding. In vitro compartmentalization (IVC) as well as


3

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 31

artificial/synthetic cells have made strides in this regard,15–27 but often combine protein synthesis and activity assays in the same volume, limiting the potential of both, or require complex protocols. In this paper, we develop a cell-free platform for high-yield protein production that allows for a phenotype-genotype connection, allowing for gene enrichment in an open system We utilize the emergent capabilities that arise from creating chemically-modified, microscale gel systems (microgels) by either chemically crosslinked or physically entangled DNA, termed protein-producing gel (P-gel)28–30 and DNA bird nest gels, respectively (Figure 1). Our laboratory has demonstrated that hydrogels, consisting of purely of DNA28–30 or DNA mixed with other gelation compounds such as clay31, produce not only high protein expression levels but also offer protection against degradation of the incorporated DNA. Notably, gels incorporating DNA encoding for proteins provide higher protein yields than in vitro compartmentalization systems and serve to localize the components required for expression while maintaining an open system and a stable and robust material basis. The combination of proteins and hydrogels, even DNA hydrogels, has been explored previously, mostly in in the context of delivery and cell-interaction applications,32,33 but also in the context of directed evolution where gel-shell beads can encapsulate proteins linked to their respective DNA sequences.34 Nevertheless, these systems do not involve the combined synthesis and display of protein while maintaining any form of genotype-phenotype linking. From the aforementioned properties, we show that DNA microgels offer a platform with which protein expression and display are integrated with further potential towards directed evolution applications. In addition, we demonstrate how the synthesis of gels from the two methods of preparation, chemically and physically networked matrices, leads to different and


4

Page 5 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

unique capabilities, such as thermostable microgels and gels containing high copy numbers of isolated gene sets.

Figure 1. Illustration of the formation mechanism of the two microgel formats and the process of protein expression and display. The P-gel is formed through covalent linking of genes into an XDNA network while the DNA bird nest is formed through continuous amplification of a singlestranded, circular template involving both rolling circle amplification (RCA) and multi-primed chain reaction (MCA). RCA defines the continuous copying of a circular template by phi29 polymerase, while MCA includes further phi29 amplification of the RCA products by two other additional primers. The molecular linker for protein display is attached to the terminal end of XDNA in the P-gel format and to a primer used in the amplification process of the DNA bird nests.


5

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 31

EXPERIMENTAL SECTION

X-DNA preparation: All oligonucleotide sequences in this study were ordered from Integrated DNA Technologies (IDT). The constituent DNA strands making up X-DNA are listed in 5’-3’ format: Strand 1 – /5Phos/CGCGCGACCGATGAATGACGGTCAGATCCGTACCTACTCG, Strand 2 – /5Phos/CGCGCGAGTGGTACGGATCTGCCGTATTGCGAACGACTCG, Strand 3 – /5Phos/CGCGCGAGTCGTTCGCAATACGGCTAGTCGTGATGTCTCG, Strand 4 – /5Phos/CGCGCGAGACATCACGACTAGCACCGTCATTCATCGGTCG. X-DNA was prepared according to previously published literature from our group.28,29,35 Briefly, the four constituent DNA strands were mixed in equimolar concentrations and then subjected to a thermal annealing process. Non-hybridized structures were removed by filtering in 30 kDa centrifugal filter columns from EMD Millipore.

Plasmid preparation: The plasmid pIVEX2.3d-wtGFP was prepared by the Gibson assembly (Gibson Assembly® Master Mix, NEB) of pIVEX2.3d from the company 5 Prime and wtGFP taken from the control plasmid pIVEX2.3-GFP from 5 Prime. Site-directed mutagenesis was performed to introduce an MluI restriction site, which was used for the linearization of the plasmid. The site was introduced at a location opposite the wtGFP sequence to minimize effects of the gel ligation on gene expression. MluI was selected based on the overhang sequence, which provided strong hybridization affinity sticky ends for both the linearized plasmid and the prepared X-DNA, while not being present in either the gene sequence or at other locations within the expression plasmid. Consult Figure S1 for a detailed plasmid map.


6

Page 7 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Preparation

of

P-gel

microgels:

P-gel

microgels

were

produced

in

a

PDMS

(polydimethylsiloxane) microfluidic device bonded to glass, according to previously published literature from our laboratory,30 with dimensions and junction images shown in Figure 2. PDMS was purchased from Dow Corning as the Sylgard® 184 Silicone Elastomer Kit, and the mineral oil (Sigma-Aldrich) used during droplet production was mixed with 4% surfactant (ABIL EM 90, Evonik Industries, Essen, Germany). The two aqueous syringe input solutions, and the effects of flow rate on microgel size, are presented in Tables S1 and S2.

Input 1

Oil

Input 2

Oil

Figure 2. (A) Filters at the head of each input and (B) the double junction where aqueous inputs meet the oil phase. The smallest filter channels are 10 µm, with the aqueous channels being 15 µm and the oil channels being 25 µm.

Maleimide-C3-NTA functionalization of oligonucleotides: The modification of the X-DNA structure was achieved by modifying Strand 4 of X-DNA with a 5’-thiol rather than the typical 5’-phosphorylation used in the gel formation, and then chemically linking the maleimido-C3NTA (MC3N) group, purchased from Dojindo Molecular Technologies, Inc. Modification of the DNA bird nests is performed by a thiol modification of the second primer, followed by linking


7

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 31

with the MC3N group. Deprotection of the thiolated DNA is undertaken through addition of a 1000x excess of TCEP (tris(2-carboxyethyl)phosphine), Sigma-Aldrich). The MC3N structure and linking process is demonstrated in Figures S5 and S6. Confirmation of functionalization was shown through mass spectroscopy data, Figure S7, and was acquired by an AB/Sciex (Foster City, CA USA) 4000 Q Trap outfitted with the Turbo Ion Spray source. Further operating conditions are described in Table S4.

Cell-free expression: 50 µL reactions were shaken at 30OC for 4 hours, the components of which are described in detail in Table S3. Gene concentrations of P-gel microgels were standardized by reconstituting the synthesized microgels in buffer volumes twice the original starting volume. For example, if the total volume of the gelation mix (inputs 1 and 2 in the microfluidic device) is 200 µL, the final volume of microgel solution will be 400 µL. We assume assume full incorporation of linearized plasmid.

Fluorescence measurements and imaging: wtGFP expression levels and standard were measured in 96-well plates using the Biotek Synergy 4 plate reader. Fluorescent gel images were recorded using an Olympus BX61 with a Hamamatsu ORCA-ER digital camera and xenon arc lamp as light source. The filter set pairing were 420 nm and 525 nm for excitation and emission, respectively. Fluorescent images are adjusted to have the same dynamic range, using values determined by the minimum and maximum values measured in the sample containing MC3Nmodified gels as a basis.


8

Page 9 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Preparation of expression lysate: E. coli lysate was produced according to previously published literature,

36–38

with two different formulations provided in Table S3. Spermidine

lysate solution has been shown to provide slightly higher protein yields, yet presence of spermidine also disrupts the DNA gels, as seen in Figure S2. In addition, DTT leads to reduction of the Ni2+ ions, thus causing disruption of His-tag binding, as shown using Ni2+-agarose beads (Figure S3). Based on these experimental results, the final lysate solution replaced spermidine with polyethylene glycol (PEG) and was prepared with a 10x lower concentration of DTT.

FACS selection and gene amplification: Fluorescence activated cell sorting

(FACS)was

performed on the BD FACSAria Fusion flow cytometry instrument. PCR amplification was performed over 25 cycles, using the following listed 5’ to 3’: Forward – TATAGGGAGACCACAACGGT Reverse – AGTGTGCTGGAATTCGC

Psoralen crosslinking: Formation of the psoralen-crosslinked X-DNA is based off of a modified protocol from our previous literature39 and redesigned sequences for X-DNA, 5’-phosphorylated and listed 5’ to 3’ as: Strand 1 – /5Phos/CGCGCGACTCGAGAAGACTAGTCGTACGCT GACTCACTCG, Strand 2 – /5Phos/CGCGCGAGTGAGTCAGCGTACGAGTACTTCGAACG ACTCG, Strand 3 - /5Phos/CGCGCGAGTCGTTCGAAGTACTGCTAGTCGTGCTGTCTCG, Strand 4 - /5Phos/CGCGCGAGTCGTTCGAAGTAGCACTAGTCTTCTCGAGTCG. Briefly, psoralen-crosslinked DNA samples were prepared by mixing with psoralen (trioxsalen, Sigma Aldrich) at a 12.5:1 molar ratio between psoralen and X-DNA, diluted in 50 mM NaCl Tris buffer, 50 mM NaCl, pH 7.5, to a total volume of 500 µL (final concentration X-DNA of 10


9

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 31

µM) and transferred to a 24-well plate for cross-linking. Photo irradiation was performed using an XL-1000 UV Crosslinker (Spectrolinker), and samples were exposed to 365 nm UV-A illumination at 2.5 mW/cm2 for 5 minutes at room temperature. Confirmation of X-DNA formation was carried out on 2.5% agarose gel, run for 1 hour at 90 V (Figure S9). Stability under denaturing conditions was confirmed with 15% Ready Gel TBE-urea polyacrylamide denaturing gel (BioRad). Samples were run at 150 V for 45 minutes at room temperature before post-staining with GelRed (Bioneer). Experiments monitoring the dehybridization of DNA gels over a temperature ramp were measured on the Shimadzu UV-3600 UV-VIS Spectrophotometer, equipped with a Peltier temperature controller, measuring absorbance at 260 nm.

DNA bird nest synthesis: The protocol for production of bird nest DNA gels is based off of the protocol present in our previous literature,40 with the additional mechanical breakup of the bulk meta-gel into discrete gels through manual pipetting. Briefly, single-stranded circular template was prepared from pIVEX2.3d-wtGFP through enzymatic nicking with nickase and digestion with exonuclease (New England Biolabs), subjected to rolling circle amplification (RCA) for 8 hours, and then to a multi-chained amplification (MCA) for an additional 16 hours at room temperature. Quantification of DNA bird nest concentrations was gathered through use of a hemocytometer. The three primer sequences used are listed as follows, in 5’ to 3’ format: Primer 1 (RCA) – CCAGCGTTTCTGGGTGAGCAAAAACAGGAA, Primer 2 (MCA) – /5ThioMC6-D/TATTACCGCCTTTGAGTGAGCTGATACCGC, Primer 3 (MCA) – GCGGTGTGAAATA CCGCACAGATGCGTAAG. The second primer is thiol-modified to allow for further functionalization with MC3N. SEM images of the DNA bird nests were obtained using the LEO 1550 FESEM. Samples were freeze-


10

Page 11 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

dried on silicon wafer and held under vacuum until imaging, where they underwent 20 seconds of Au/Pd sputter coating.

RESULTS AND DISCUSSION

P-Gel Protein Expression and Display

The P-gel consists of a network of genes covalently crosslinked within a ligated X-DNA network that provides the hydrogel structure. The X-DNA is formed prior to ligation, and the gene of interest is linearized with a restriction enzyme that provides overhangs that match the sticky ends of the X-DNA, which in this case is designed to be the MluI overhang. In order to achieve gene isolation in this format, the genes must be isolated through dilution and subsequent gelation in discrete volumes; thus, gelation in microscale emulsions was an ideal format. Microgels were synthesized within water-in-oil emulsions using a microfluidic setup. To introduce the ability to display expressed protein, the chemical linker maleimido-C3-NTA (MC3N) was introduced into the network by modifying one thiolated, single stranded DNA out of the four making up the X-DNA.41–43 The maleimide functional group enables covalent linking with a deprotected, thiolated DNA, while the NTA group can chelate nickel ion to capture Histagged proteins. As this functionalization effectively prevented one arm of the X-DNA from participating in ligation, the modified X-DNA was then introduced in a 1:10 ratio of MC3N-XDNA:X-DNA during the gelation process so as not to significantly disrupt gel formation by reducing crosslinking density.


11

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 31

In our cell-free expression setup, the final yield of the expressed model protein, wild type Green Fluorescent Protein or wtGFP, from microgels as compared to a solution phase system (SPS) control is shown in Figure 3A. The expression was performed in E. coli lysate, and the protein yield was approximately two-fold greater than the solution-phase control. Additionally, the lysate makeup was an important consideration in the experimental design. Optimization of the expression lysate was achieved in order to maintain distinct microgels and downstream protein display, as the choice of crowding reagent, meant to increase viscosity of the reaction solution, significantly altered the stability of the hydrogel; spermidine actually led to the breakdown of the hydrogel while the use of polyethylene glycol (PEG) maintained distinct microgels throughout incubation, as seen in Figure S2. Furthermore, DTT concentration was significantly reduced (10x reduction) in the formulations so as to minimize the reduction of Ni2+, which would interfere with the ability of the gels to capture expressed protein. The concentrations present in commonly used solutions were sufficient to reduce protein capture by commercially available agarose-NTA-Ni2+ resin (Figure S3).


12

Page 13 of 31

12.0

wtGFP conc. (ng/µL)

(A)

10.0 8.0 6.0 4.0 2.0 0 0

10

20

30

40

50

Gene Concentration (ng/µL)

(B)

(C) wtGFP conc. (ng/µL)


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

0.8 0.6 0.4 0.2

2.5 2.0 1.5 1.0 0.5

0 Buffer

1 mM Ni 2+ 10 mM Ni2+

(D)

20 µm

0

P-Gel

MC3N P-gel

20 µm

Figure 3. (A) Comparison of cell-free expression yields among solution phase (SPS, blue) and MC3N-modified P-gel (green) systems, sample size of 5 expressions. Error bars represent one standard deviation above and below mean value (for experiments throughout this study). (B) Fluorescence of displayed GFP using unmodified (red) and MC3N-P-gel (green) microgels prepared with different concentrations of Ni2+ (1 mM and 10 mM), incubated in 50 µL buffer containing 100 ng His-tagged wtGFP, followed by buffer washing. Results based on 3


13

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 31

repetitions. (C) Fluorescence of displayed GFP in cell-free protein synthesis using unmodified Pgel (red) and MC3N-P-gel (green) microgels prepared with 10 mM Ni2+ in 50 µL of cell lysate, followed by buffer washing. Results based on 3 repetitions. (D) Fluorescence comparison of displayed wtGFP produced from a cell-free protein synthesis between MC3N-modified (left) and unmodified P-gel microgels (right). The dynamic range for this set of images matched the lowest and highest values within the MC3N-P-gel sample.

In order to test the ability of the microgels to display His-tagged proteins, non-modified microgels and MC3N-modified microgels were incubated for 1 hour with different concentrations of Ni2+ (1 mM and 10 mM) before mixing in either 50 µL buffer (10 mM Tris, 25 mM NaCl, pH 8.0) containing 100 ng His-tagged wtGFP or E. coli lysate solution, to test whether the binding was functional under conditions in which expression would take place. It should be noted that although incubation of the gels took place at differing concentrations of Ni2+, the 10 mM Ni2+ solution incubation was washed and brought to 1 mM Ni2+ before use due to the known interference of Ni2+ at higher concentrations in cell free expressions. After incubation with wtGFP or expression in E. coli lysate, the gels were washed with buffer two times to remove unbound GFP. Results presented in Figure 2 B,C are gathered over 3 expressions. Over a 200% increase in binding is seen in the solution containing only the GFP in buffer (Figure 3B), and in the solution where the display was taking place in lysate, an approximately two-fold increase is seen (Figure 3C). The high background in lysate can be explained by the presence of various salts and a large number of biomacromolecules within the lysate, including many proteins, that can increase non-specific binding. For selection purposes, this background should not create significant difficulties, as the selection is based off where


14

Page 15 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

selection gating is introduced and a large difference is still seen within this sample. Furthermore, the background can be further reduced by further washing steps. The success of this functional modification in a system where the His-tagged GFP is being produced during incubation can be seen in Figure 3D, which shows fluorescent P-gel microgels after buffer washing. The nonfunctionalized gels display little perceivable fluorescence signal after washing, confirming that the modified microgels were, in fact, specifically retaining synthesized GFP in lysate. Thus far, we have demonstrated the ability to produce and capture protein through modified P-gels; the functionality of this platform for gene enrichment based on fluorescent signal was tested next. Since all microgels produce protein in an open system, it must be shown that gels will, on average, display a representative sample of protein from its own gene set rather than a representative display from the bulk solution. In order to achieve this, we mixed two sets of MC3N-modified P-gels – one set containing GFP gene and the other a blank set - in a cell free protein synthesis and then performed FACS selection to select for the brightest hydrogels. The cell free reactions consisted of 50 µL starting volumes, which were brought to 250 µL with buffer once the reaction had completed. We gated the system to collect the top 10% of events, while also collecting the bottom 75% of events. We aimed to show that we could select without the need for multiple washing steps, and we used the diluted reaction volume directly. The collected solutions were centrifuged at 200 rcf for 5 minutes to gather hydrogels at the tube bottom, 10 µL of solution was pipetted from the bottom of the centrifuged tube and diluted into 90 µL buffer, followed by heating to 95°C for 15 minutes to dehybridize the hydrogels and make the GFP gene more accessible for PCR amplification. The scatter and gating plots, shown in Figure 4A and 4B, show how the microgels were collected both in the sample and in the control. This region was selected based on sample run


15

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 31

containing P-gel microgels in buffer incubated with pure, His-tagged GFP, shown in Figure S4. The control consisted of the same volume of reaction mixture with P-gels substituted with .750 µg of circular plasmid containing GFP (the approximate recommended plasmid addition based on commercial kits, notably Promega). Though this leads to a plasmid concentration nearly 25 times higher than the microgel sample, this represents the best comparison for commonly used cell-free reactions. In order to conduct PCR amplification, 2 µL of the solutions prepared from FACS were used as template for a 50 µL PCR amplification. After 25 cycles of PCR amplification using primers flanking the wtGFP gene in the plasmid, samples were run on agarose to compare the density of resulting bands (Figure 4C). The control bands show essentially equivalent gene density between high and low gating, where lane 4 represents the low fluorescence gated samples while lane 5 shows the results for the high gating, which is accounted for the fact that no selection has occurred and the signal comes from free gene in solution. Lanes 1 and 2, which represent the low and high gating respectively, for the P-gel microgel display sample, show a strong difference in band density, where the higher fluorescence gating has a significantly stronger signal. This nearly five-fold difference gene concentration difference (as measured by total signal within band) represents a successful enrichment of gene concentration through FACS selection of brighter gels.


16

Page 17 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Figure 4: Scatter and gating plots for FACS sorting of (A) in-vitro wtGFP expression containing a mixed population of MC3N-P-gel microgels containing GFP or no gene and (B) control invitro wtGFP expression from circular plasmid. Gating levels were maintained based on collecting the top 10% of gating events (P5) as positive events in the P-gel sorting, and the bottom 75% (P6) as negative events. (C) 1.0% agarose gel showing comparison of gene amounts after PCR amplification microgels collected after FACS selection. Lane 1: 2-log DNA ladder (NEB). Lanes (2-5) are PCR samples from the following templates: (2) low fluorescence microgels, (3) high fluorescence microgels, (4) control reaction – low fluorescence gating events, (5) control reaction – low fluorescence gating events (6) pure pIVEX2.3d-wtGFP plasmid

P-gel microgel production and subsequent MC3N modification allows for a direct connection between the crosslinked gene (genotype) and the protein displayed (phenotype), mimicking the natural connection inherent in living cell systems. However, the advantage of an in-vitro system to expand the available mutation space and ability to use a wider range of


17

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 31

selection pressures can be taken further by modifying the DNA hydrogels to demonstrate stability under conditions that would normally be harmful to live cells. As the individual X-DNA crosslinking units themselves do not possess DNA contributing to the final protein product, and they are prepared before ligation into the gel matrix, they were mixed with a DNA intercalator that covalently links hybridized DNA, resulting in a stronger, thermostable gel even under dehybridizing conditions. This capability provides an alternative to live cells to express and engineer proteins in conditions that may hinder or obviate cell growth, such as high temperature or low/high pH, and can thus can expand both the types of protein engineered and the mutation space available for screening. In further detail, to create a DNA gel that could withstand denaturing conditions, we incorporated a protocol that was used to produce branched DNA structures that were resistant to heat denaturation during PCR through covalent crosslinking with psoralen.39 Inspired by our previous work, redesigned X-monomer units were crosslinked with the intercalator psoralen, which covalently binds thymine residues under UV exposure, showing the highest levels of intercalation efficiency of ‘5 – TA – 3’ pairs followed by ‘3 – TA – 5’. The sequence redesign (Figures 5A and 5B) clustered the covalent, cross-strand linking sequences homogeneously at the center of the X-DNA as opposed to randomly throughout the structure while maintaining similar hybridization efficiencies of the X-DNA. Furthermore, the conditions required for crosslinking large amounts of X-DNA as required for gel formation led us to modify the existing psoralen crosslinking protocol from our previous literature, notably, by reducing the excess of psoralen used and to reduce UV exposure. The goal was to crosslink the double-stranded structures without damaging the single-stranded overhangs, an effect that would cause a decrease in ligation efficiency during microgel formation. The result of these changes is seen in Figure 5C,


18

Page 19 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

where lane 2 shows a fully psoralen-crosslinked X-DNA and lane 5 shows an X-DNA structure subject to our conditions. In order to demonstrate the thermostability of the resulting microgels, there is not a necessity to have every X-DNA fully crosslinked. The psoralen-crosslinked XDNAs were used to form P-gel microgels with the same microfluidic methodology discussed previously.

Figure 5: (A) Original X-DNA sequences based on previous literature.28,29,44 (B) X-DNA sequences redesigned for psoralen crosslinking. Bases highlighted in red depict a directed crosslinking site, while sequences in blue represent the MluI restriction site overhang. Inset: Ligated X-DNAs with the melting temperature of ligated network based on longest continuous double-strand length (C) X-DNA and psoralen-crosslinked X-DNA (XTS) stability in denaturing SDS-PAGE gel. Lane 1: LMW-Plus Ladder (NEB). Lane 2: XTS (1000:1 psoralen:X-DNA, 15 min UV exposure). Lane 3: YTS (1000:1 psoralen:Y-DNA, 15 min UV exposure) Lane 4: noncrosslinked X-DNA. Lane 5: XTS (15:1 psoralen:X-DNA, 5 min UV exposure). Crosslinked Y-


19

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 31

DNA, which should run faster than X-DNA based on it consisting of three hybridized ssDNAs, was used as a control based on our previous literature39 to have further confidence in the crosslinked X-DNA band.

In order to test the functionality and robustness of the system, the psoralen-crosslinked gels were subjected to heating to 95°C at a ramp rate of 0.1°C/min. The gels were then cooled to room temperature for imaging to see whether they retained their microgel format. Figure 6A shows that microgels are still visible in the crosslinked system after heating while in the nonmodified gel sample no microgels are present. As a further confirmation, Figure 6B shows the absorbance at 260 nm of the supernatant during heating of the microgels. Within this time course, there were two regions in which absorbance increased – one in the early stages of heating and the other at the melting temperature of the gel network’s longest continuous double strands (Figure 5, inset). These two regimes are explained by the gel design. Our X-DNA structures initially hybridize by the four base MluI overhang, and thus minimal heating was sufficient to release unligated X-DNA (the first regime). However, above 65°C, the hybridized, networked structure itself began to dehybridize, unraveling the gel and releasing strands into solution (the second regime). Importantly, the longest uninterrupted stretches of double stranded DNA in the P-gel is the length of two ligated arms, which possesses a melting temperature of approximately 65°C (Figure 5, inset). This final absorbance increase was not seen in the psoralen-crosslinked Pgels, which maintained linked X-DNA structures even at high temperatures.


20

Page 21 of 31

P-Gel Microgels

(A)

Psoralen-P-Gel Microgels

25OC

100 µm

95OC

100 µm

25OC

100 µm


(B) 4.5 4.0 3.5

Absorbance (A.U.)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

3.0 2.5

8.0 6.0 4.0 2.0 0 Psoralen-P-Gel

P-Gel

2.0 1.5 1.0 0.5 0 20

P-Gel Psoralen-P-Gel

Release of unligated DNA 25

30

35

40

45

50

55

60

65

70

75

80

85

90

95

Temperature (OC)

Figure 6. (A) Optical microscopy of the microgels before and after heating of solutions containing either P-gel or psoralen-P-gel microgels (B) Absorbance (260 nm) of solution containing microgels of P-gel and psoralen-P-gel. Inset: Cell-free expression levels of P-gel and psoralen-P-gel microgels.


21

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 31

DNA Bird Nest Protein Expression and Display

DNA bird nest gels are physically entangled gels that possess the novel ability to create isolated gene sets with extremely high copy numbers, which have previously only been achieved through emulsion PCR. In our work, bulk gels were formed through a combination of rolling circle amplification (RCA) and multi-primed chain reaction amplification (MCA) on a singlestranded circular DNA template. Mechanistic studies of the process revealed shape-memory properties40,45 and a microstructure that consisted of compact, high-density regions of DNA40. DNA bird nests are derived from these high density-regions, as upon physical disruption, such as pipetting, of the bulk gel, these regions dissociated to form distinct microspheres46. Figure 7A shows the system before and after the physical breaking. This morphology was attributed to the formation mechanism, whereby the DNA template was continually amplified into a dense, physically entangled gel. These regions may also be condensed by magnesium pyrophosphate crystals, as has been shown for RNA microsponges.47


22

Page 23 of 31

(A)

2 µm

2 µm

(B)

6.0


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

5.0 4.0 3.0 2.0 1.0 0 4750 BN/ µL

9500 BN/ µL

SPS

(C)

10 µm

10 µm

Figure 7. (A) SEM images of DNA bird nest gel format before physical breaking (left) and DNA bird nests after disruption (right) (B) Cell-free wtGFP expression from DNA bird nests (BN) in 50 µL reactions compared to a solution phase control (SPS) containing .750 µg linear plasmid. (C) Fluorescence imaging demonstrating GFP display on MC3N-modified (left) and unmodified


23

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 31

(right) DNA bird nests. The dynamic range for this set of images matched the lowest and highest values within the MC3N-bird nest image.

Based on this formation mechanism, each of the distinct bird nests, 1-2 µm in diameter, consists of approximately 32,000 copies of the same template. For the application of protein display, the template was the same pIVEX2.3d-wtGFP used in the P-gel system, but digested into a single-stranded plasmid. To our knowledge, this was the first time that a high copy number of gene repeats has been physically linked without the need for in vitro compartmentalization techniques, such as droplet-based PCR.48 The bird nest structure was a mix of single-stranded and double-stranded DNA, and according to our previous work, the ratio stood at approximately 70% ssDNA to 30% dsDNA, with a template copy number of approximately 32,000. This number is calculated by first counting the number of DNA bird nests in solution with a standard hemacytometer. The bird nests are then digested with DNAse and the nucleotide concentration measured, providing an average mass of approximately 0.15 pg per bird nest which is then divdided by the molecular weight of the plasmid to achieve a template copy number. Though the template copy number is already extremely high, further synergistic effects of high density packing and protection from breakdown within the lysate may lead to even higher ‘effective’ gene concentrations. This effective gene concentration was calculated by comparing the levels of protein expression to a free plasmid standard. The expression levels shown in Figure 7B demonstrated that each bird nest expressed the equivalent of 500,000 linear gene copies from a single gene isolate. To the best of our knowledge, both the template copy number and the effective linear gene concentration are the highest synthesized in literature.


24

Page 25 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

The protein display methodology presented for the P-gel system can be applied in the bird nest system as well, though through a different incorporation mechanism. Of the three primers used in the bird nest gel synthesis, two of the primers were dedicated to the MCA process, and thus should be present in high concentrations within the bird nest. We modified Primer 2 through the same mechanism presented earlier – in short, by using a 5’ thiolated strand, deprotecting with TCEP, and incubating with MC3N (Figure S3). After 10 mM Ni2+ incubation, followed by washing and incubation in E. coli lysate, the gels displayed the expressed wtGFP (Figure 7C). In contrast, the DNA bird nests produced from non-modified primers displayed minimal protein, confirming that this procedure works across our gel platform.

SUMMARY AND CONCLUSIONS

We have developed a DNA microgel platform that can be utilized for protein expression and display, and demonstrated that through that our microgels can be sorted through FACS to enrich gene concentration based on fluorescent signal of the model protein wtGFP. In addition to gene isolation and protein display, with further chemical modification of the gel format, we tested the system under extreme conditions that would be harmful to live cell systems. Furthermore, DNA bird nests demonstrate a novel method for creating extremely high-copy numbers of physically isolated genes that have been previously unattainable. We expect that use of these systems will be expanded into directed evolution applications as the need for more flexible, cell-free methodologies and materials grows rapidly. These cell-sized microgels truly exploit the dual nature of DNA as both a genomic and a structural polymer, and integrating


25

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 31

protein expression and display within a hydrogel platform provides an important advancement in evolution applications where phenotype must be connected to the gene sequence responsible for the desired activity. This gel system can also be extended to synthetic biology, where new materials can pave the way towards artificial cells and expanding cell-free functionality.

ASSOCIATED CONTENT Supporting Information The following files are available free of charge. Supplementary data and characterization (PDF) AUTHOR INFORMATION Corresponding Author *E-mail: [email protected] Author Contributions The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. Notes The authors declare no competing financial interest. ACKNOWLEDGMENT


26

Page 27 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

We wish to acknowledge financial support from the USDA-AFRI. J. S. Kahn acknowledges support from the DOE Office of Science Graduate Fellowship, administered by ORISE- ORAU under contract no. DE-AC05-06OR23100. R.C.H. Ruiz acknowledges the NDSEG, NSF, and Sloan Foundation Minority Fellowship. T.L. Derrien acknowledges NSF IGERT under agreement number DGE-0903653.

REFERENCES

(1)

Goldsmith, M.; Tawfik, D. S. Curr. Opin. Struct. Biol. 2012, 22 (4), 406–412.

(2)

Romero, P. A.; Arnold, F. H. Nat. Rev. Mol. Cell Biol. 2009, 10 (12), 866–876.

(3)

Packer, M. S.; Liu, D. R. Nat. Rev. Genet. 2015, 16 (7), 379–394.

(4)

Hoogenboom, H. R. Nat. Biotechnol. 2005, 23 (9), 1105–1116.

(5)

Famulok, M.; Szostak, J. W. Angew. Chemie Int. Ed. English 1992, 31 (8), 979–988.

(6)

Tuerk, C.; Gold, L. Science (80-. ). 1990, 249 (4968), 505–510.

(7)

Lipovsek, D.; Pluckthun, A. J. Immunol. Methods 2004, 290 (1-2), 51–67.

(8)

Roberts, R. W.; Szostak, J. W. Proc. Nat. Acad. Sci., U. S. A. 1997, 94 (23), 12297– 12302.

(9)

Lichty, J. J.; Malecki, J. L.; Agnew, H. D.; Michelson-Horowitz, D. J.; Tan, S. Protein Expr. Purif. 2005, 41 (1), 98–105.

(10)

Gera, N.; Hussain, M.; Rao, B. M. METHODS 2013, 60 (1), 15–26.

(11)

Rader, C.; Barbas, C. F. Curr. Opin. Biotechnol. 1997, 8 (4), 503–508.

(12)

Pande, J.; Szewczyk, M. M.; Grover, A. K. Biotechnol. Adv. 2010, 28 (6), 849–858.

(13)

Bratkovic, T. Cell. Mol. LIFE Sci. 2010, 67 (5), 749–767.

(14)

Seelig, B. Nat. Protoc. 2011, 6 (4), 540–552.


27

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 31

(15)

Noireaux, V.; Maeda, Y. T.; Libchaber, A. Proc. Nat. Acad. Sci. 2011, 108 (9 ), 3473– 3480.

(16)

Libchaber, V. N. and R. B.-Z. and J. G. and H. S. and A. Phys. Biol. 2005, 2 (3), P1.

(17)

Chalmeau, J.; Monina, N.; Shin, J.; Vieu, C.; Noireaux, V. Biochim. Biophys. Acta Biomembr. 2011, 1808 (1), 271–278.

(18)

Noireaux, V.; Libchaber, A. Proc. Nat. Acad. Sci., U.S.A. 2004, 101 (51 ), 17669–17674.

(19)

Blain, J. C.; Szostak, J. W. Annu. Rev. Biochem. 2014, 83 (1), 615–640.

(20)

Elani, Y.; Law, R. V; Ces, O. Nat. Commun. 2014, 5.

(21)

Martino, C.; Lee, T. Y.; Kim, S.-H.; deMello, A. J. Biomicrofluidics 2015, 9 (2), -.

(22)

Saeki, D.; Sugiura, S.; Kanamori, T.; Sato, S.; Ichikawa, S. J. Biosci. Bioeng. 2014, 118 (2), 199–204.

(23)

Bae, S. J.; Song, W. C.; Jung, S. H.; Cho, S.-W.; Kim, D.-I.; Um, S. H. Langmuir 2012, 28 (49), 17036–17042.

(24)

Karzbrun, E.; Tayar, A. M.; Noireaux, V.; Bar-Ziv, R. H. Science 2014, 345 (6198 ), 829– 832.

(25)

Peters, R. J. R. W.; Marguet, M.; Marais, S.; Fraaije, M. W.; van Hest, J. C. M.; Lecommandoux, S. Angew. Chem. Int. Ed. 2014, 53 (1), 146–150.

(26)

Kamat, N. P.; Katz, J. S.; Hammer, D. A. J. Phys. Chem. Lett. 2011, 2 (13), 1612–1623.

(27)

Martino, C.; Kim, S.-H.; Horsfall, L.; Abbaspourrad, A.; Rosser, S. J.; Cooper, J.; Weitz, D. A. Angew. Chem. Int. Ed. 2012, 51 (26), 6416–6420.

(28)

Park, N.; Um, S. H.; Funabashi, H.; Xu, J.; Luo, D. Nat. Mater. 2009, 8 (5), 432–437.

(29)

Park, N.; Kahn, J. S.; Rice, E. J.; Hartman, M. R.; Funabashi, H.; Xu, J.; Um, S. H.; Luo, D. Nat. Protoc. 2009, 4 (12), 1759–1770.

(30)

Ruiz, R.; Kiathwuthinon, P.; Kahn, J. S.; Roh, Y. H.; Luo, D. Ind. Biotechnol. 2012, 8 (6), 372–377.

(31)

Yang, D.; Peng, S.; Hartman, M. R.; Gupton-Campolongo, T.; Rice, E. J.; Chang, A. K.; Gu, Z.; Lu, G. Q. (Max); Luo, D. Sci. Rep. 2013, 3.

(32)

Zhang, Z.; Li, S.; Chen, N.; Yang, C.; Wang, Y. Biomacromolecules 2013, 14 (4), 1174– 1180.


28

Page 29 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

(33)

Wan, L.; Chen, Q.; Liu, J.; Yang, X.; Huang, J.; Li, L.; Guo, X.; Zhang, J.; Wang, K. Biomacromolecules 2016, 17 (4), 1543–1550.

(34)

Fischlechner, M.; Schaerli, Y.; Mohamed, M. F.; Patil, S.; Abell, C.; Hollfelder, F. Nat. Chem. 2014, 6 (9), 791–796.

(35)

Li, Y.; Tseng, Y. D.; Kwon, S. Y.; D’Espaux, L.; Bunch, J. S.; McEuen, P. L.; Luo, D. Nat. Mater. 2004, 3 (1), 38–42.

(36)

Kim, T.-W.; Keum, J.-W.; Oh, I.-S.; Choi, C.-Y.; Park, C.-G.; Kim, D.-M. J. Biotechnol. 2006, 126 (4), 554–561.

(37)

Calhoun, K. A.; Swartz, J. R. J. Biotechnol. 2006, 123 (2), 193–203.

(38)

Schwarz, D.; Junge, F.; Durst, F.; Frolich, N.; Schneider, B.; Reckel, S.; Sobhanifar, S.; Dotsch, V.; Bernhard, F. Nat. Protoc. 2007, 2 (11), 2945–2957.

(39)

Hartman, M. R.; Yang, D.; Tran, T. N. N.; Lee, K.; Kahn, J. S.; Kiatwuthinon, P.; Yancey, K. G.; Trotsenko, O.; Minko, S.; Luo, D. Angew. Chem. Int. Ed. Engl. 2013, 52 (33), 8699–8702.

(40)

Lee, J. B.; Peng, S.; Yang, D.; Roh, Y. H.; Funabashi, H.; Park, N.; Rice, E. J.; Chen, L.; Long, R.; Wu, M.; Luo, D. Nat. Nanotech 2012, 7 (12), 816–820.

(41)

Sacca, B.; Niemeyer, C. M. Chem. Soc. Rev. 2011, 40 (12), 5910–5921.

(42)

Shen, W.; Zhong, H.; Neff, D.; Norton, M. L. J. Am. Chem. Soc. 2009, 131 (19), 6660– 6661.

(43)

Shimada, J.; Maruyama, T.; Hosogi, T.; Tominaga, J.; Kamiya, N.; Goto, M. Biotechnol. Lett. 2008, 30 (11), 2001–2006.

(44)

Um, S. H.; Lee, J. B.; Park, N.; Kwon, S. Y.; Umbach, C. C.; Luo, D. Nat. Mater. 2006, 5 (10), 797–801.

(45)

Xu, X.; Jagota, A.; Peng, S.; Luo, D.; Wu, M.; Hui, C.-Y. Langmuir 2013, 29 (27), 8665– 8674.

(46)

Lee, J. B.; Hong, J.; Bonner, D. K.; Poon, Z.; Hammond, P. T. Nat. Mater. 2012, 11 (4), 316–322.

(47)

Shopsowitz, K. E.; Roh, Y. H.; Deng, Z. J.; Morton, S. W.; Hammond, P. T. Small 2014, 10 (8), 1623–1633.

(48)

Hindson, B. J.; Ness, K. D.; Masquelier, D. A.; Belgrader, P.; Heredia, N. J.; Makarewicz, A. J.; Bright, I. J.; Lucero, M. Y.; Hiddessen, A. L.; Legler, T. C.; Kitano, T. K.; Hodel,


29

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 31

M. R.; Petersen, J. F.; Wyatt, P. W.; Steenblock, E. R.; Shah, P. H.; Bousse, L. J.; Troup, C. B.; Mellen, J. C.; Wittmann, D. K.; Erndt, N. G.; Cauley, T. H.; Koehler, R. T.; So, A. P.; Dube, S.; Rose, K. A.; Montesclaros, L.; Wang, S.; Stumbo, D. P.; Hodges, S. P.; Romine, S.; Milanovich, F. P.; White, H. E.; Regan, J. F.; Karlin-Neumann, G. A.; Hindson, C. M.; Saxonov, S.; Colston, B. W. Anal. Chem. 2011, 83 (22), 8604–8610.


30

Page 31 of 31

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

For Table of Contents Use Only

DNA Microgels as a Platform for Cell-free Protein Expression and Display Jason S. Kahn,† Roanna C.H. Ruiz,‡ Swati Sureka,† Songming Peng,† Thomas L. Derrien,† Duo An,† and Dan Luo*,†,§


31

DNA Microgels as a Platform for Cell-Free Protein ... - ACS Publications

Recommend Documents