Article pubs.acs.org/Biomac
DNA Stickers Promote Polymer Adsorption onto Cellulose Teruaki Sato,† Md Monsur Ali,‡ Robert Pelton,§ and Emily D. Cranston*,§ †
Paper Chemical Division, Arakawa Chemical Industries, Ltd., Osaka, Japan Departments of ‡Biochemistry and Biomedical Sciences and §Chemical Engineering, McMaster University, Hamilton, Canada L8S 4L7 S Supporting Information *
ABSTRACT: Adsorption of oligonucleotides onto model cellulose surfaces was investigated by comparing the Boese and Breaker’s cellulose binding oligonucleotide (CBO) with a nonspecific oligonucleotide control (NSO). Measurements using the quartz crystal microbalance with dissipation technique confirmed that CBO adsorbed onto cellulose more than NSO, particularly at high ionic strengths (100 mM CaCl2). CBO showed a higher maximum adsorption on nanofibrillated and nanocrystalline cellulose than on regenerated cellulose, indicating a preference for the native cellulose I crystal structure under conditions that favored specific adsorption over calciummediated electrostatically driven adsorption. In addition, an anionic polyacrylamide (A-PAM) with grafted CBO also adsorbed onto the surface of cellulose in CaCl2, whereas the unmodified A-PAM did not. This work shows that CBO performs as a “sticker”, facilitating the adsorption of polyacrylamide onto cellulose, even under high ionic strength conditions where the adsorption of conventional polyelectrolytes is inhibited.
■
INTRODUCTION Paint does not adhere to wet wood, and most types of paper disintegrate in water. These are everyday examples underscoring the difficulties in achieving strong adhesion to wet cellulose (i.e., the paint) and between wet cellulose (i.e., the paper). The reason is well understood; cellulose has a hydrophilic surface, owing to the high density of hydroxyl groups. Indeed, the surfaces of wet cellulose fibers behave as a hydrogel,1 and like in most hydrogels, self-adhesion is weak or nonexistent in water. Therefore, polymeric adhesion promoters are required for many applications of cellulose, including packaging, building materials, surgical implants, and modern composites based on nanocellulose. Wet cellulose adhesion is an old problem and industry has responded by providing synthetic chemicals to promote adhesion. Papermaking uses wet-strength resins,2 building products employ adhesives,3 and cellulose composites use interfacial compatibilizers.4 In most cases, these are dated technologies with chemistries often involving organo chlorines, formaldehydes, and other reactive species that can have negative environmental impacts. There is an obvious need for new wet cellulose adhesives. In the case of papermaking, a dilute aqueous suspension of wood pulp fibers is treated with very dilute solutions of polymeric adhesives (wet or dry strength resins). To function as adhesives, these polymers must adsorb onto the fiber surface. When the paper sheet is formed, the adsorbed polymers increase the interfiber adhesion. While the polymer must adsorb onto cellulose, this alone is not a sufficient criterion to promote wet cellulose fiber−fiber adhesion. For example, cationic poly(diallyldimethyl ammonium chloride) (PDADMAC) spontaneously adsorbs onto cellulose but does not promote wet fiber−fiber adhesion.5 It has also been shown that despite the electrostatic repulsion expected, anionic carboxymethyl cellulose (CMC) can be adsorbed onto negatively © 2012 American Chemical Society
charged cellulose surfaces irreversibly but that the adsorption maximum is significantly improved by having CMCs with a low degree of substitution, by increasing the adsorption temperature, or by increasing the ionic strength.6−10 The process is often described as a cocrystallization of CMC with the cellulose surface, implying that the purity of the cellulose and the minimization of electrostatic repulsion will enhance adsorption.8 Importantly, divalent calcium ions have also been demonstrated to increase adsorption, through both bridging and screening interactions, which is particularly advantageous for strongly anionic cellulose surfaces.8,10 Biological systems offer insight into achieving and controlling adsorption and adhesion to wet surfaces. Although most bioderived adhesive studies involve proteins,11−20 DNA-based adhesives may have advantages owing to the high stability of the DNA chain. Here we report the cellulose binding properties of short, synthetic, single-stranded DNA, or more correctly, oligonucleotides. Our work was inspired by a recent report describing a cellulose binding DNA aptamer.21 Our current investigation and other relevant published results are summarized herein. DNA aptamers are short oligonucleotides that fold into a unique configuration in the presence of a “binding buffer”.22 Furthermore, cavities in the folded oligonucleotide are capable of selectively capturing targets. A critical step in the evolution of DNA aptamers was the development of the SELEX procedure whereby large libraries of oligonucleotides are panned to yield the strongest binding candidate for a specific target.23 Yang et al. reported a DNA aptamer capable of binding cellobiose from a typical binding buffer consisting of 20 mM Tris, pH 7.5, Received: June 20, 2012 Revised: September 5, 2012 Published: September 6, 2012 3173
dx.doi.org/10.1021/bm300940e | Biomacromolecules 2012, 13, 3173−3180
Biomacromolecules
Article
Figure 1. Grafting of CBO onto anionic polyacrylamide, Mw = 520 kDa, to give A-PAM-g-CBO.
100 mM NaCl, and 5 mM MgCl2.24 However, we suspect that the behavior of the cellobiose disaccharide in solution is not representative of a solid cellulose surface. Three types of model cellulose surfaces were employed in this study: (1) nanofibrillated cellulose (NFC) films comprising bundled elementary fibrils of cellulose I with noncrystalline cellulose regions, (2) nanocrystalline cellulose (NCC) films composed solely of cellulose in its native cellulose I crystal form,25 and (3) cellulose regenerated from N-methylmorpholineN-oxide (NMMO) to give films containing both cellulose II and amorphous cellulose.26,27 These cellulose surfaces are representative of natural pulp fibers in terms of their chemistry and the average degree of polymerization, however, they give us the opportunity to elucidate the effect of crystallinity, topography, and surface charge on the binding of oligonucleotides. Most importantly, these films are homogeneous, flat, and relatively nonporous when compared to pulp fibers, making them ideal for nanoscale adsorption experiments. In 2007, we reported that a DNA aptamer, designed to bind adenosine triphosphate, did not adsorb onto regenerated cellulose films or cellulose wood pulp fibers.28 In the same year, Boese and Breaker reported a 70-base oligonucleotide that bound to cellulose powder in the presence of a binding buffer of 5 mM MgCl2, 20 mM Tris−HCl (pH 7.5 at 23 °C), 100 mM NaCl, and 0.01% (w/v) sodium dodecyl sulfate (SDS).21 This result was surprising because oligonucleotides are hydrophilic anionic polymers that are not expected to bind to cellulose. To elaborate on past work, here we employ the quartz crystal microbalance with dissipation technique (QCM-D) to confirm that, under some solution conditions, Boese and Breaker’s cellulose binding oligonucleotide (CBO) gives a greater adsorption density onto model cellulose surfaces, than a control nonspecific oligonucleotide (NSO). In addition, we describe the adsorption of an anionic polyacrylamide (A-PAM) with grafted cellulose binding oligonucleotide (A-PAM-g-CBO) onto cellulose. Using the described experimental setup, this work shows that the modification of PAM with DNA aptamers is a new and promising approach to promote polymer adsorption onto any kind of wet cellulose.
■
Holtsville, NY). No peaks were detected at 5 mM CaCl2 and irreproducible peaks indicative of large aggregated particles were measured at 100 mM. A-PAM-g-CBO. Anionic poly(acrylamide-co-acrylic acid) (A-PAM), Mw = 520 kDa, 80% acrylamide, was purchased from Sigma-Aldrich Canada Ltd. (Oakville, Canada). CBO-C6H12NH2 was coupled to N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC, Sigma-Aldrich Canada Ltd.) activated A-PAM, as shown in Figure 1. Specifically, 10 μL of CBO-C6H12NH2 (3 mg/L) and 146 μL of 10% EDC were added in 264 μL of 0.25% A-PAM at pH 4.5−5.0 for 3 h. The pH was adjusted to 9 with 1 M NaOH and the A-PAM-gCBO was purified by three cycles of dilution with purified water (resistivity 18 mΩ cm, Thermo Scientific, Asheville, NC) followed by centrifugation (8000 rpm, 23 °C) in a Nanosep Centrifuge tube fitted with a 100 kDa cutoff membrane (Pall Canada Ltd., Mississauga, Canada). The product was isolated by freeze-drying. The CBO content of the product was calculated by UV absorbance at 260 nm measured with a DU 800 UV/ visible spectrophotometer (Beckman Coulter Canada, Inc., Mississauga, Canada) based on a standard calibration curve prepared using a mixture of A-PAM and CBO. The UV absorbance curve and related calibration curve are included in the Supporting Information (Figures S1−S3). Preparation of Nanofibrillated Cellulose (NFC)-Coated QCM-D Sensors. NFC from sulfite softwood dissolving pulp (Domsjö Dissolving Plus, Domsjö Fabriker AB, Sweden) was prepared at Innventia AB (Stockholm, Sweden) according to the method described by Wågberg et al. using a carboxymethylation pretreatment12,30 followed by high pressure homogenization.31,32 To remove fibril aggregates, 1.5 g of 2% NFC (generation 2, DS-0.092) was diluted to 20 mL with purified water and stirred for 60 min. The NFC dispersion was then sonicated using a Branson Sonifier 450 at 10% output amplitude (0.7 s pulse on and 0.3 s pulse off) for 10 min and centrifuged at 4000 rpm for 60 min. The clear supernatant with a concentration of 1.2 g/L was used for spin coating model cellulose surfaces. The carboxymethylation pretreatment is known to produce NFC with a negative surface charge of 515 μeq/g cellulose and fibril dimensions of 5−15 nm in diameter and micrometers in length.32 Gold QCM-D sensors (Q-Sense AB, Gothenburg, Sweden) were cleaned by dipping in 10% NaOH for 20 s, rinsing with purified water, drying with N2, UV/ozone treating for 15 min, and finally rinsing with water and drying again. To promote cellulose adhesion, the sensors were immersed in 0.1 g/L polyethyleneimine (PEI), Mw = 750 kDa (Fluka Chemicals Ltd., Gillingham, U.K.), followed by rinsing and N2 drying. The PEI-treated sensors were then placed in the spin coater (Spin150, SPS-Europe B.V., Putten, Netherlands), wetted with water, and spun at 3000 rpm for 15 s. Next, the NFC dispersion was spincoated onto the substrates at 3000 rpm for 45 s. The spin-coated surfaces were rinsed with water, dried with nitrogen gas, and heattreated in an oven at 80 °C for 10 min. Cellulose-coated QCM-D sensors (QSX334) were also purchased from Q-Sense AB. The procedure for their preparation also uses carboxymethylated NFC from Innventia AB and is described elsewhere.33,34 Preparation of Nanocrystalline Cellulose (NCC)-Coated QCM-D Sensors. NCC was prepared, as described previously,35 by sulfuric acid hydrolysis of cotton from Whatman cellulose filter aid (ashless powder, catalog no. 1700025, GE Healthcare Canada, Mississauga, Canada). The nanocrystals were cleaned of residual acid by centrifugation and dialysis and sonicated to make stable aqueous suspensions. Negatively charged sulfate ester groups on the surface of the nanocrystals resulted from this preparation method and the surface charge was calculated to be 209 μeq/g cellulose, as measured by conductometric titration. Average nanocrystal dimensions determined
EXPERIMENTAL SECTION
Oligonucleotides. Cellulose binding oligonucleotide, CBO (5′TGGGCTCGCGTTGCAGAGGGGGTGGGATTGGGTCACCACTGGCGTCGGAGGCCAAGGGTGTGGTGTGCAG), CBOC6H12NH2 for poly(acrylamide-co-acrylic acid) modification and the control, nonspecific oligonucleotide, NSO (5′-GATGTGTGCGTTGTCGAGACCTGCGACCGGAACACTACACTGTGTGGGATGGATTTCTTTACAGTTGTGTG) were purchased from Integrated DNA Technologies Inc. (Coralville, IA). All oligonucleotides were purified by gel electrophoresis and ethanol precipitation, as described previously.29 Dynamic Light Scattering. A 2 μM aliquot of CBO solutions in 5 and 100 mM CaCl2 (99.0% CaCl2, Code 2520−1, Caledon Laboratories, Georgetown, Canada) were examined by dynamic light scattering. Particle sizing was performed using a Lexel 95 ion laser operating at a wavelength of 514 nm and a power of 100 mW with a detector angle of 90°. Correlation data were analyzed using a BI-9000AT digital autocorrelator, version 6.1 (Brookhaven Instruments Corp., 3174
dx.doi.org/10.1021/bm300940e | Biomacromolecules 2012, 13, 3173−3180
Biomacromolecules
Article
0.001 μM oligonucleotide or PDADMAC in CaCl2 solutions were injected at 150 μL/min until the baseline was again stable, typically after 50 min; (3) the samples were rinsed with CaCl2 solution at 150 μL/min for 5 min; (4) steps 2 and 3 were repeated with increasing concentrations of oligonucleotide and PDADMAC up to 0.05 μM. To probe the effect of ionic strength on adsorption, experiments were repeated with CaCl2 concentrations of 5, 20, and 100 mM. The adsorption isotherms are obtained by converting frequency to adsorbed mass, Γs, using eq 1 and plotting these values versus the concentration. 2. Adsorption Mass Maximum. The adsorption maximum, Γs max, for each polymer is calculated from a reciprocal Langmuir plot of the adsorption isotherm data. According to the Langmuir model, a plot of sample concentration divided by the adsorbed mass, versus concentration, gives a slope of 1/Γs max based on eq 3:38
by AFM were 103 ± 9 × 6.8 ± 0.7 nm, giving a surface charge density of 0.33 ± 0.02 e/nm2. Silica QCM-D sensors (Q-Sense AB) were cleaned by dipping in ethanol, rinsing with purified water, and drying with nitrogen gas followed by UV/ozone treatment for 15 min. The sensors were spin coated at 3000 rpm for 60 s, with an adhesive layer of 1.0 g/L polyvinylamine (PVAm), Mw = 45 kDa (BASF, Ludwigshafen, Germany). Next, the NCC dispersion (6% w/v) was spin coated onto the substrates at 3000 rpm for 60 s. To ensure that the spin-coated films did not redisperse when submerged in water, they were heat-treated in an oven at 80 °C for 25 min, rinsed with water, and dried with N2 gas. Preparation of Regenerated Cellulose (RC)-Coated QCM-D Sensors. Silica QCM-D sensors were cleaned following the same procedure as for the NCC-coated sensors. Model regenerated cellulose surfaces were prepared according to Gunnars et al.26 Briefly, the sensors were immersed in 0.1 g/L PVAm for 15 min followed by rinsing and N2 drying. A total of 0.25 g dissolving pulp (generously provided by D. G. Gray at McGill University) was placed in a beaker with 12.5 mL of NMMO in an oil bath at 125 °C. The solution was stirred with a magnetic stirring bar until the pulp was completely dissolved and then stirring was continued for another 1 min. A 37.5 mL aliquot of DMSO was then added slowly to the solution to adjust the viscosity. A droplet of the dissolved cellulose solution was placed on the PVAm-treated sensor on the spin coater and spun for 15 s at 1500 rpm and then again for 15 s at 3500 rpm. The spin-coated sensors were carefully slid into purified water for 4 h, followed by N2 drying. Regenerated cellulose films are expected to be very weakly anionic from carboxylic acid groups.36 AFM Imaging. The topography of cellulose-coated QCM-D sensors was characterized by AFM using a Nanoscope IIIa Multimode Scanning Probe Microscope, with an E scanner (Bruker AXS, Santa Barbara, CA). The images were collected in tapping mode in air using silicon cantilevers (AC 160TS) supplied by Olympus Canada Inc. (Richmond Hill, Canada). The rms roughness values were determined from AFM height images over an area of 4 × 4 μm, and nanofiber/ nanocrystal “width” was determined from the height of the particles imaged by AFM in order to avoid tip-convolution artifacts. QCM-D Measurements. Adsorption measurements were performed with an E4 QCM-D instrument from Q-Sense AB. The QCM-D simultaneously measures the change in frequency (Δf) and dissipation (D) of a quartz crystal sensor in contact with an adsorbing medium. The change in resonance frequency can be converted into a change in adsorbed mass (Γs) using the Sauerbrey equation (eq 1) that is valid for thin rigid films.37 Γs = −
C Δf n
[conc] [conc] 1 = + Γs Γs max Γs maxKb
where [conc] is sample concentration and Kb is the apparent binding constant. While the Langmuir model was derived for gas or small molecule adsorption onto flat surfaces, it often fits high-affinity polymer adsorption isotherms well, as is the case here. 3. Comparison of CBO, A-PAM, and A-PAM-g-CBO Adsorption on Q-Sense Cellulose Sensors. CaCl2 (5, 20, or 100 mM) was injected at a constant flow rate of 150 μL/min for 50 min followed by injection at 150 μL/min for 400 min of CBO (0.001 μM, which is equivalent to 0.02 mg/L), A-PAM (0.001 μM, which is equivalent to 0.52 mg/L), and A-PAM-g-CBO (0.001 μM of CBO, which is equivalent to 0.34 mg/L). After polymer adsorption, the sensors were rinsed with CaCl2 solution at 150 μL/min for 60 min. 4. Test for Exposed PEI on Q-Sense Cellulose Sensors. Purified water (no added salt) was injected at a constant flow rate of 150 μL/ min until a stable baseline was achieved. This was followed by an injection of poly(styrene sulfonate) (PSS), Mw = 70 kDa, (Polymer Science Inc., Monticello, IN) at increasing concentrations of 0.05 and 0.1 μM at 150 μL/min over 300 min. After polymer adsorption, the sensors were rinsed with purified water at 150 μL/min for 60 min. Error Calculations. All error intervals are confidence intervals calculated from the standard deviation (Sx) of repeat measurements (N), that is, Δx = Sx × t-value/(N)1/2, where the t-value is the Student’s t-distribution at a confidence level of 95% for N − 1 degrees of freedom for individual measurements.
■
RESULTS AND DISCUSSION The adsorption characteristics of three polymers on cellulose are compared in Figure 2: Boese and Breaker’s cellulose binding oligonucleotide, CBO; a nonspecific oligonucleotide, NSO; and PDADMAC, a linear cationic polyelectrolyte widely used in the papermaking industry. NSO was chosen as the control oligonucleotide because it has a 71 nucleotide sequence and CBO has 70. The ratio of A/T/C/G is similar for the two oligonucleotides giving them both a molecular mass of about 22 kDa. None of the experiments were conducted in binding buffer. Instead, three concentrations of calcium chloride were used because calcium carbonate buffered solution is a common media for papermaking. QCM-D was used to determine the frequency change of an oscillating crystal due to polymer adsorption, which has been converted to adsorbed mass, Γs (mg/m2), using the Sauerbrey equation.37 Raw QCM-D data, that is, frequency and dissipation values, for the adsorption experiments are shown in the Supporting Information (Figure S4). Both CBO and NSO displayed finite adsorption onto cellulose under all salt concentrations evaluated (Figure 2a,b). Overall, CBO had higher adsorption than the other polymers with the most adsorption occurring at the largest CaCl2 concentration (100 mM). Conversely, NSO adsorption was inhibited by calcium chloride addition.
(1)
Here n is the overtone number (1, 3, 5, 7, 9, 11, and 13) and C is a device-sensitive constant determined to be 0.177 mg m−2 Hz1−. The dissipation factor (eq 2) gives a measure of the viscoelasticity of the adsorbed layer, a large D implies a loosely bound and extended layer and a small D describes a more rigid layer.
D=
Edissipated 2πEstored
(3)
(2)
Here, Edissipated is the dissipated energy during one oscillation cycle and Estored is the total energy stored in the oscillation. In this study, the Sauerbrey model is assumed to be valid because the dissipation was found to be small compared to the adsorbed mass. All measurements were repeated at least two times, processed data from the third overtone are shown and Δf values have also been normalized by the third overtone. Before the adsorption experiments, all four types of cellulose-coated QCM-D sensors were soaked in purified water overnight. All experiments were performed at 23 °C, using solutions made with purified water at a pH of about 6 (unadjusted). Four types of QCM-D adsorption studies were carried out: 1. Adsorption Isotherms. For each adsorption isotherm the sequence of injections was identical: (1) an aqueous solution of CaCl2 was injected at a constant flow rate of 150 μL/min until the baseline frequency drift was less than 0.1 Hz over 20 min; (2) the 3175
dx.doi.org/10.1021/bm300940e | Biomacromolecules 2012, 13, 3173−3180
Biomacromolecules
Article
binding conformation. Note that Boese and Breaker added SDS to their binding buffer to minimize nonspecific adsorption.21 It is therefore likely that at low salt concentrations we have measured nonspecific binding of CBO to cellulose. However, at 100 mM CaCl2, the nonspecific adsorption of CBO is minimized and conceivably the oligonucleotide takes on a preferred conformation, explaining the significantly larger amounts of adsorbed CBO. If all of the adsorbed mass measured by QCM-D is due to bound polymer, that is, ignoring the water molecules associated with the bound layer, which are also detected using this technique, then we can calculate the area that each CBO chain, with a molecular weight of 22 kDa, occupies. For CBO at 100 mM CaCl2, the maximum adsorbed mass is 6.2 mg/m2, which corresponds to each CBO chain occupying about 6 nm2. Similarly, for 5 and 20 mM, each CBO chain would occupy 22 and 14 nm2, respectively. As DNA can be treated as a semiflexible polymer chain, we now use polymer theory and basic geometry to estimate the area that various oligonucleotide conformations would occupy: The length of a DNA base pair is 5−7 Å,42 we use 6.3 Å (which is the distance between phosphorus groups determined by crystallography43). The “footprint” diameter of the DNA helix is approximately 2 nm.44 Thus, an oligonucleotide “brush” would occupy ∼3 nm2/oligonucleotide and a “coiled polymer chain” would occupy ∼22 nm2/oligonucleotide (assuming rootmean-square end-to-end distance calculated from “random walk” statistics). As ionic strength is increased, the “coiled polymer chain” area would decrease due to screened interchain repulsion, which agrees well with the observed behavior of both CBO and NSO at 5 and 20 mM. The QCM-D thus offers indirect evidence that the structure of CBO at 100 mM CaCl2 is closer to a “brush”, or more likely a more compact threedimensional structure, than a “randomly coiled polymer chain”. Unfortunately, using DLS, UV−vis absorbance, and QCM-D of surface-tethered CBO and NSO, we have not measured any direct indication of conformational changes. We have also ensured that the higher adsorbed mass of CBO on cellulose at high ionic strength is not a result of CBO aggregation, given the conditions employed in this study (0.001−0.05 μM CBO and 5−100 mM CaCl2). Both DLS and UV−vis absorbance indicate that aggregation only occurs above CBO concentrations of 1 μM in 100 mM calcium chloride solution (Supporting Information, Table S1). Conformational changes aside, under the conditions studied, both CBO and NSO are negatively charged and, thus, nonspecific adsorption to cellulose is attributed to hydrogen bonding and calcium-mediated electrostatic adsorption. Many studies have shown that negatively charged CMC adsorbs more to cellulose in CaCl2 than in NaCl where divalent calcium ions may act as a bridge between the anionic polymer and cellulose surface.6−10 We also observed higher adsorption of the oligonucleotides in CaCl2 than in NaCl or MgCl2 (Supporting Information, Figure S5). At 5 and 20 mM CaCl2, the adsorption trend for CBO and NSO is the same, indicating a nonspecific adsorption mechanism that is reduced as CaCl2 concentration increases. Perhaps this implies a critical salt concentration exists between 5 and 20 mM CaCl2, where Ca2+ switches from having a “bridging role” to a “counterion role”, screening the surfaces more effectively from each other. This downward trend continues for NSO at 100 mM CaCl2, whereas the adsorption of CBO is greatly increased, conceivably due to specific binding. Figure 2 shows the best-fit linear regression lines from the reciprocal Langmuir plots, indicating that the adsorption onto
Figure 2. Adsorption isotherms for (a) CBO, (b) NSO, and (c) PDADMAC on Q-Sense cellulose sensors at CaCl2 concentrations of 5 (blue), 20 (black), and 100 mM (red) at pH 6. Γs is the adsorbed mass calculated from the Sauerbrey equation (eq 1). Lines are linear regression best-fits to the Langmuir model.
In comparison, there have been many studies involving PDADMAC adsorption and the results in Figure 2c are typical PDADMAC behavior. This is an example of electro-sorption, driven by the release of counterions when the cationic quaternary ammonium groups approach the anionic carboxymethyl charged groups on the cellulose sensor (in this case, a NFC film).39−41 PDADMAC adsorption decreases with increased electrostatic screening and we include these results to emphasize the contrast between the electrolyte dependence of conventional electrostatically driven adsorption and CBO behavior. The specific adsorption of oligonucleotides in binding buffer is generally attributed in part to the secondary structure of the DNA chain. Our results imply that at high CaCl2 concentrations (over 20 mM) the CBO may adopt the required 3176
dx.doi.org/10.1021/bm300940e | Biomacromolecules 2012, 13, 3173−3180
Biomacromolecules
Article
Figure 3. AFM height (top) and corresponding phase (bottom) images, collected in tapping mode in air for (a) commercial Q-Sense cellulose sensors and QCM-D sensors spin-coated with (b) NFC, (c) NCC, and (d) regenerated cellulose from NMMO.
cellulose is well described using the Langmuir model. Unfortunately, the concept of the binding constant (Kb) is less relevant when assumptions in the Langmuir derivation are not met and when the molecules are binding nonspecifically and with a diversity of affinities, as is likely the case here. Clearly the result of the Langmuir isotherm analysis is that the total adsorbed amounts are highest for CBO at high ionic strength. QCM-D Adsorption onto Four Model Cellulose Surfaces. We further investigated the adsorption of CBO onto four different model cellulose surfaces: a commercial QSense cellulose sensor, NFC, NCC, and regenerated cellulose (from NMMO). The sensors were prepared in-house by spin coating the various celluloses onto QCM-D sensors. Resultant films were smooth with full surface coverage, as shown by AFM in Figure 3. The surface properties of the cellulose sensors are presented in the Supporting Information (Table S2). We highlight the comparison between commercially available Q-Sense cellulose sensors made from NFC and in-house spin-coated NFC sensors. While similar in most senses, the larger fibril diameter of NFC on the commercial sensors is due to fibrils that have not been fully separated or have aggregated post preparation of NFC. In our case, we have removed all fibril aggregates through a sonication and centrifugation treatment prior to spin coating. The larger average fibril diameter leads to commercial NFC sensors, which are slightly rougher. However, the variation in average fibril size does not affect the adsorption of CBO. Figure 4 shows that the maximum adsorbed amount of CBO on Q-Sense and homemade NFC sensors is the same. NFC and NCC sensors display the same trend in adsorption with added salt. Moreover, while the surface topography does not appear to play a role in CBO adsorption, surface charge does, specifically at CaCl2 concentrations below 100 mM. Adsorption decreases with increasing ionic strength at low salt, but then jumps at 100 mM where specific adsorption is likely to dominate. Interestingly, the adsorption of CBO to NFC and NCC is indistinguishable at 100 mM CaCl2. We conclude that, at high CaCl2 concentrations, the surface charge of the cellulose sensors does not significantly influence CBO adsorption. The surface charge of our cellulose sensors increases in the order regenerated cellulose < NCC < NFC (Supporting Information, Table S2). At low ionic strengths, the drop in the
Figure 4. Comparison of CBO adsorption maximum, Γs max, on four model cellulose surfaces: (a) commercial Q-Sense cellulose sensors (solid black), (b) NFC (blue checkered), (c) NCC (gray hashed), and (d) regenerated cellulose from NMMO (red grid) at CaCl 2 concentrations of 5, 20, and 100 mM.
adsorbed CBO amount upon changing CaCl2 from 5 to 20 mM is larger for NFC sensors than for NCC. Correspondingly, the binding of CBO to the minimally charged regenerated cellulose film is virtually insensitive to CaCl2 concentration. As such, we summarize that nonspecific adsorption of CBO (at low ionic strengths) is less sensitive to changes in CaCl2 concentration when the surface charge on cellulose is small. Most noteworthy in the model cellulose surface adsorption experiments is the effect of crystal structure on the adsorption behavior; CBO preferentially binds to NFC and NCC at high ionic strength when compared to regenerated cellulose (Figure 4). The cellulose allomorph and degree of crystallinity for each model surface is given in the Supporting Information (Table S2) and implies that CBO appears to recognize the native cellulose I crystal structure for specific binding. The degree of crystallinity may also play a role; however, the difference in crystallinity between NFC and NCC films is similar to the difference in crystallinity between regenerated cellulose and NFC, yet it does not show an obvious effect on the adsorption behavior. While changes in specific surface area would undoubtedly affect the adsorption, we cannot differentiate between having a more diffuse (less crystalline) film45 or a more porous film and thus cannot clearly ascertain the effect of the degree of crystallinity. The trend for regenerated 3177
dx.doi.org/10.1021/bm300940e | Biomacromolecules 2012, 13, 3173−3180
Biomacromolecules
Article
CBO and A-PAM-g-CBO, however, adsorption saturation was not attained during the 400 min experiment shown in Figure 5.
cellulose sensors at all salt concentrations suggests a different CBO adsorption behavior on the cellulose II surface, which is likely nonspecific and nonelectrostatic. Overall, CBO binds to all of the model cellulose surfaces tested here, with a preference for cellulose I at high ionic strength, and we believe that CBO adsorption on most types of cellulose fibers and films would follow the tendencies observed here. While descriptions of DNA aptamer mechanisms often involve a target entering a cavity formed by the folded oligonucleotide, it seems obvious that this cannot be the case with our cellulose surfaces. The 2−10 nm diameter immobilized cellulose nanofibrils and nanocrystals are far too large compared to the oligonucleotide for such a mechanism to occur. It is more likely that the oligonucleotide is simply adsorbing onto the cellulose surfaces, much like any other linear polymer, but perhaps with small conformational changes in high ionic strength solution playing a role46 and explaining the large adsorbed masses measured. Possibly, molecular modeling would reveal the function of the specific base sequences in the CBO and elucidate the binding/recognition mechanism. While the surface rms roughness, nanofibril diameter, and film thickness are comparable for NFC substrates, it appears that cationic PEI (used as the anchoring layer) is not exposed in significant amounts to influence our adsorption results. This is supported by the fact that cationic PDADMAC adsorption was highest at low ionic strength where electrostatic repulsion with PEI would be expected. Furthermore, we tested polyelectrolyte adsorption of a relatively small, 70 kDa, anionic poly(styrene sulfonate) (PSS) with no added salt and found no adsorption onto Q-Sense cellulose sensors (Supporting Information, Figure S6). Recently, NCC films have been described as being more porous than generally expected; it was shown that cellulase enzyme adsorption increases with increasing film thickness owing to the large accessible surface area in a highly porous material.47 Likely, all of the cellulose films used here are somewhat porous, however, we do not believe that this obscures the adsorption results, which show a preference for the cellulose I crystal structure. Due to osmotic pressure, increasing the ionic strength around a cellulose film would deswell it,48 which would lead to less accessibility and lower polymer adsorption, which is the opposite of what was observed here. Moreover, the order of magnitude, trend and relative differences in adsorption with increasing calcium chloride for the NFC films (very thin) and NCC film (relatively thick) are analogous, implying that adsorption is predominantly occurring at the outer surface and is insensitive to the internal structure of the film. Promoting Polyelectrolyte Adsorption by Grafting CBO. The evidence that CBO binds to cellulose even under high ionic strength conditions, led us to examine CBO’s ability to act as a “sticker” of other macromolecules onto cellulose. CBO was grafted onto a copolymer of acrylamide and acrylic acid to give the anionic polymer A-PAM-g-CBO. (The structure and composition of the copolymer is shown in the Experimental Section, Figure 1.) The degree of CBO substitution was approximately 1.3 per every 7000 A-PAM units. Typical QCM-D results for A-PAM, CBO, and A-PAM-gCBO adsorbing onto cellulose at pH 6 and 100 mM CaCl2 are compared in Figure 5. The decrease in frequency with time corresponds to adsorption onto the cellulose sensor. To clearly see the differences in adsorption, concentration values were chosen so that equal amounts of CBO were introduced for neat
Figure 5. Comparison of (a) frequency vs time and (b) dissipation vs frequency for the adsorption of CBO (0.001 μM = 0.02 mg/L), A-PAM (0.001 μM = 0.52 mg/L), and A-PAM-g-CBO (0.001 μM of CBO only = 0.34 mg/L) onto Q-Sense cellulose sensors.
The unmodified A-PAM adsorbed to cellulose only very slightly. This is well-known and explained by the hydrophilic nature of polyacrylamide and the electrostatic repulsion between the negative carboxylic acid groups on poly(acrylic acid) and the negatively charged cellulose surface. However, introduction of the pendant CBO segments on the A-PAM chains resulted in substantial adsorption. The dissipation change versus frequency shift for A-PAM-g-CBO is big, implying that the adsorbed mass is large and a dissipative viscoelastic film is formed that extends relatively far from the cellulose surface into the bulk solution. Adsorbed amounts of A-PAM and CBO indicate a much thinner layer is formed on cellulose than for A-PAM bound through the CBO “sticker”. Figure 5b suggests that CBO binds to give a more rigid film than A-PAM which has a much larger molecular weight and likely has some anchored chains extending away from the cellulose surface. For our final comparison, Figure 6 presents the adsorption maxima from fitted reciprocal Langmuir plots for the various oligonucleotides, A-PAM-g-CBO and the cationic PDADMAC polymer control. The A-PAM-g-CBO gave the highest maximum adsorption based on the Sauerbrey analysis. Furthermore, adsorption of A-PAM-g-CBO had the same trend as CBO with respect to CaCl2 concentration, indicating that the adsorption mechanism is the same. The larger adsorbed mass of A-PAM-gCBO, compared to CBO alone, is due to the increased molecular weight of the attached polymer, and furthermore, from its ability to bind water, which is also sensed by the QCM-D technique. 3178
dx.doi.org/10.1021/bm300940e | Biomacromolecules 2012, 13, 3173−3180
Biomacromolecules
Article
A-PAM-g-CBO adsorption is improved at high CaCl2 concentrations (100 mM). Thus, CBO grafting is a new route to facilitating adsorption onto cellulose under conditions of high ionic strength where electrostatically driven adsorption breaks down.
■
ASSOCIATED CONTENT
S Supporting Information *
UV absorbance curves and related calibration curves analyzing the degree of substitution for CBO-grafted A-PAM, raw QCMD adsorption data, absorbance values at 500 nm for CBO in CaCl2, average surface properties of cellulose sensors used to measure CBO adsorption, and QCM-D data from PSS adsorption experiments. This material is available free of charge via the Internet at http://pubs.acs.org.
Figure 6. Comparison of the adsorption maximum, Γs max, on Q-Sense cellulose sensors for (a) CBO (solid black), (b) NSO (blue hashed), (c) PDADMAC (gray vertical stripes), and (d) A-PAM-g-CBO (red dotted) at CaCl2 concentrations of 5, 20, and 100 mM.
■
AUTHOR INFORMATION
Corresponding Author
*E-mail:
[email protected].
NSO and PDADMAC had the opposite trend; adsorption decreased with increasing ionic strength. In many applications such as papermaking and water treatment, cationic polymers are employed to induce polymer adsorption onto hydrophilic anionic surfaces, including cellulose. However, calcium chloride concentrations of 10 mM or higher inhibit even a cationic polyacrylamide adsorption onto cellulose.49 We have shown that both CBO and A-PAM-g-CBO adsorption onto cellulose was enhanced in 100 mM CaCl2 compared to lower ionic strengths. This method to improve the adsorption of polymers and other chemicals onto cellulose is likely comparable in cost and complexity to other sophisticated “stickers” presented in the literature, including chemo-enzymatically modified hetero polysaccharides50 and hemicelluloses51 or akyne/azide functionalized CMC, which adsorbs to cellulose and can then undergo “click” chemistry for further surface modification.52 The advantages of CBO-modified materials are that the adsorption is specific to cellulose, fast (minutes vs hours for xyloglucan adsorption51) and only a low degree of substitution is required, that is, very few CBO moieties are needed to attach a large molecule onto a cellulose surface. But probably most beneficial, as mentioned previously, is the ability of our oligonucleotide derivatives to function in high electrolyte environments, thus offering a new approach to promote polymer adsorption onto cellulose.
Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS The authors thank Andy Duft (Canadian Centre for Electron Microscopy, McMaster) for AFM support, Kevin Kan for NCC preparation, and Emil Gustafsson for assistance with regenerated cellulose sensor preparation. Yingfu Li and Sergio Aguirre are acknowledged for instrument use and oligonucleotide purification. Tom Lindstrom (Innventia AB, Stockholm, Sweden) is recognized for generously providing the NFC suspensions and Derek G. Gray (McGill, Montreal, Canada) for donating dissolving pulp. This work was supported by Arakawa Chemical Industries Ltd.
■
REFERENCES
(1) Pelton, R. Nord. Pulp Pap. Res. J. 1993, 11, 113−119. (2) Espy, H. H. Tappi J. 1995, 78, 90−99. (3) Pocius, A. V. Adhesion and Adhesives Technology: An Introduction; Hanser Gardner Publications: Cincinnati, OH, 2002. (4) Dufresne, A. Can. J. Chem. 2008, 86, 484−494. (5) Espy, H. H. Tappi J. 1987, 70, 129−133. (6) Zemljic, L. F.; Stenius, P.; Laine, J.; Stana-Kleinschek, K. Cellulose 2008, 15, 315−321. (7) Zemljic, L. F.; Stenius, P.; Laine, J.; Stana-Kleinschek, K. Cellulose 2006, 13, 655−663. (8) Laine, J.; Lindström, T.; Nordmark, G. G.; Risinger, G. Nordic Pulp Pap. Res. J. 2000, 15, 520−526. (9) Blomstedt, M.; Kontturi, E.; Vuorinen, T. Nordic Pulp Pap. Res. J. 2007, 22, 336−342. (10) Liu, Z.; Choi, H.; Gatenholm, P.; Esker, A. R. Langmuir 2011, 27, 8718−8728. (11) Yu, M. E.; Hwang, J. Y.; Deming, T. J. J. Am. Chem. Soc. 1999, 121, 5825−5826. (12) Kitaoka, T.; Tanaka, H. J. Wood Sci. 2001, 47, 322−324. (13) Levy, I.; Nussinovitch, A.; Shpigel, E.; Shoseyov, O. Cellulose 2002, 9, 91−98. (14) Levy, I.; Paldi, T.; Siegel, D.; Shoseyov, I.; Shoseyov, O. Nord. Pulp Pap. Res. J. 2003, 18, 421−428. (15) Hernandez-Munoz, P.; Villalobos, R.; Chiralt, A. Food Hydrocolloids 2004, 18, 403−411. (16) Kurosu, K.; Pelton, R. J. Pulp Pap. Sci. 2004, 30, 228−232. (17) Li, X.; Pelton, R. Ind. Eng. Chem. Res. 2005, 44, 7398−7404. (18) Ren, D. K.; Li, K. C. Holzforschung 2005, 59, 598−603. (19) Su, S. X.; Pelton, R. Cellulose 2006, 13, 537−545.
■
CONCLUSIONS Our results are consistent with Boese and Breaker’s claim of a specific oligonucleotide sequence with an enhanced tendency to adsorb onto cellulose compared to other oligonucleotide sequences.21 Additionally, we have shown that binding occurs in the absence of a binding buffer, although calcium chloride promotes adsorption. Overall, we find that CBO adsorbs onto cellulose giving a higher maximum adsorption than the nonspecific oligonucleotide control and similarly charged polyelectrolytes. Cellulose surface charge and degree of crystallinity have a minor effect on CBO adsorption, which appears to be independent of topography (for relatively smooth surfaces). Interestingly, there are indications that CBO prefers to adsorb to the native cellulose I crystal structure at high CaCl2 concentrations although the binding/recognition mechanism is unclear. Based on the CBO adsorption findings, we enhanced the adsorption of anionic polyacrylamide onto cellulose by over an order of magnitude by grafting CBO onto A-PAM. Both CBO and 3179
dx.doi.org/10.1021/bm300940e | Biomacromolecules 2012, 13, 3173−3180
Biomacromolecules
Article
(20) Yokota, S.; Matsuo, K.; Kitaoka, T.; Wariishi, H. BioResources 2008, 3, 1030−1041. (21) Boese, B. J.; Breaker, R. R. Nucleic Acids Res. 2007, 35, 6378− 6388. (22) Fowler, C. C.; Navani, N. K.; Brown, E. D.; Li, Y., Aptamers and their Potential as Recognition Elements for the Detection of Bacteria. In Principles of Bacterial Detection: Biosensors, Recognition Receptors and Microsystems; Zourob, M., Elwary, S., Turner, A. P. F., Eds.; Springer: New York, 2008; pp 689−714. (23) Tuerk, C.; Gold, L. Science 1990, 249, 505−510. (24) Yang, Q.; Goldstein, I. J.; Mei, H. Y.; Engelke, D. R. Proc. Natl. Acad. Sci. U.S.A. 1998, 95, 5462−5467. (25) Edgar, C. D.; Gray, D. G. Cellulose 2003, 10, 299−306. (26) Gunnars, S.; Wågberg, L.; Cohen Stuart, M. A. Cellulose 2002, 9, 239−249. (27) Aulin, C.; Ahola, S.; Josefsson, P.; Nishino, T.; Hirose, Y.; Österberg, M.; Wågberg, L. Langmuir 2009, 25, 7675−7685. (28) Su, S.; Nutiu, R.; Filipe, C. D. M.; Li, Y.; Pelton, R. Langmuir 2007, 23, 1300−1302. (29) Nutiu, R.; Li, Y. Methods 2005, 37, 16−25. (30) Walecka, J., A. Tappi J. 1956, 39, 458−463. (31) Wågberg, L.; Winter, L.; Ö dberg, L.; Lindström, T. Colloids Surf. 1987, 27, 163−173. (32) Wågberg, L.; Decher, G.; Norgren, M.; Lindström, T.; Ankerfors, M.; Axnäs, K. Langmuir 2008, 24, 784−795. (33) Päak̈ kö, M.; Ankerfors, M.; Kosonen, H.; Nykänen, A.; Ahola, S.; Ö sterberg, M.; Ruokolainen, J.; Laine, J.; Larsson, P. T.; Ikkala, O.; Lindström, T. Biomacromolecules 2007, 8, 1934−1941. (34) Ahola, S.; Salmi, J.; Johansson, L. S.; Laine, J.; Österberg, M. Biomacromolecules 2008, 9, 1273−1282. (35) Cranston, E. D.; Gray, D. G. Biomacromolecules 2006, 7, 2522− 2530. (36) Ö sterberg, M. J. Colloid Interface Sci. 2000, 229, 620−627. (37) Sauerbrey. Z. Phys. 1959, 155, 206−222. (38) Kinniburgh, D. G. Environ. Sci. Technol. 1986, 20, 895−904. (39) Notley, S. M. Phys. Chem. Chem. Phys. 2008, 10, 1819−1825. (40) Horvath, A. T.; Horvath, A. E.; Lindström, T.; Wägberg, L. Langmuir 2008, 24, 7857−7866. (41) Van de Steeg, H. G. M.; Cohen Stuart, M. A.; De Keizer, A.; Bijsterbosch, B. H. Langmuir 1992, 8, 2538−2546. (42) Mills, J. B.; Vacano, E.; Hagerman, P. J. J. Mol. Biol. 1999, 825, 245−257. (43) Murphy, M. C.; Rasnik, I.; Cheng, W.; Lohman, T. M.; Ha, T. Biophys. J. 2004, 86, 2530−2537. (44) Chatenay, D.; Cocco, S.; Monasson, R.; Thieffry, D.; Dalibard, J. Multiple Aspects of DNA and RNA from Biophysics to Bioinformatics; Elsevier: Amsterdam, 2005. (45) Kontturi, E.; Suchy, M.; Penttilä, P.; Jean, B.; Pirkkalainen, K.; Torkkeli, M.; Serimaa, R. Biomacromolecules 2011, 12, 770−777. (46) Gregory, J. Polym. Int. 1995, 36, 102−102. (47) Kittle, J. D.; Du, X.; Jiang, F.; Qian, C.; Heinze, T.; Roman, M.; Esker, A. R. Biomacromolecules 2011, 12, 2881−2887. (48) Falt, S.; Wägberg, L.; Vesterlind, E.-L. Langmuir 2003, 19, 7895−7903. (49) Pelton, R. H. J. Colloid Interface Sci. 1986, 111, 475−485. (50) Xu, C.; Spadiut, O.; Araújo, A. C.; Nakhai, A.; Brumer, H. ChemSusChem 2012, 5, 661−665. (51) Brumer, H.; Zhou, Q.; Baumann, M. J.; Carlsson, K.; Teeri, T. T. J. Am. Chem. Soc. 2004, 126, 5715−5721. (52) Filpponen, I.; Kontturi, E.; Nummelin, S.; Rosilo, H.; Kolehmainen, E.; Ikkala, O.; Laine, J. Biomacromolecules 2012, 13, 736−742.
3180
dx.doi.org/10.1021/bm300940e | Biomacromolecules 2012, 13, 3173−3180
