DNAzyme-Functionalized Au Nanoparticles for the Amplified

Wen-Jing Wang , Jing-Jing Li , Kai Rui , Pan-Pan Gai , Jian-Rong Zhang , and ..... Yueming Zhai , Junfeng Zhai , Yuling Wang , Shaojun Guo , Wen Ren a...
0 downloads 0 Views 206KB Size
Download PDF
NANO LETTERS

DNAzyme-Functionalized Au Nanoparticles for the Amplified Detection of DNA or Telomerase Activity

2004 Vol. 4, No. 9 1683-1687

Tamara Niazov, Valeri Pavlov, Yi Xiao, Ron Gill, and Itamar Willner* Institute of Chemistry, Farkas Center for Light-Induced Processes, The Hebrew UniVersity of Jerusalem, Jerusalem 91904, Israel Received June 5, 2004; Revised Manuscript Received July 10, 2004

ABSTRACT DNAzyme-functionalized Au−NPs act as catalytic labels for the amplified detection of DNA and telomerase activity on nucleic acid-functionalized gold surface. The DNAzyme stimulates, in the presence of hemin, H2O2, and luminol, the generation of chemiluminescence. For DNA analysis, a nucleic acid unit complementary to the analyzed DNA is tethered to the DNAzyme structure associated with the Au−NPs. For telomerase activity, a nucleic acid complementary to the telomer repeat units generated on the surface is tethered to the DNAzyme structure associated with the Au−NPs. The detection limit for the detection of DNA is 1 × 10-10 M. The method enables the detection of telomerase activity originating from 1000 HeLa cells.

Catalytic deoxyribozymes (DNAzymes) for numerous chemical transformations were prepared in recent years.1,2 An interesting example of a catalytic DNA that reveals peroxidase-like activity includes a guanine-rich nucleic acid (aptamer) that binds hemin in a supramolecular G-quadruplex configuration.3,4 We have found that the hemin G-quadruplex structure also acts as a biocatalyst for the generation of biochemiluminescence in the presence of H2O2 and luminol.5 Au nanoparticles (Au-NPs) functionalized with nucleic acids were employed as versatile labels for the optical6,7 or microgravimetric quartz crystal microbalance8 detection of DNA. Here we report on the use of Au-NPs as carriers for DNAzyme units for the amplified detection of DNA or telomerase activity using biochemiluminescence as a readout signal. Scheme 1 depicts the method for analyzing the target DNA (2) by the DNAzyme-modified Au-NPs. A gold surface was modified with the thiolated nucleic acid (1), 2.5 × 10-11 mol‚cm-2, that is complementary to a part of the analyzed DNA (2). The resulting interface was then hybridized with 2, present in the analyzed samples, at different concentrations. Au-NPs (13 ( 1 nm) were modified with the nucleic acid (3) (96 nucleic acids per particle). This nucleic acid includes the biocatalytic sequence for generating the biochemiluminescence catalyst in the presence of hemin, and an additional tethered nucleic acid that is complementary to the singlestranded part of the analyzed DNA. Interaction of the surface with the 3-functionalized Au-NPs results in their hybridization with the analyte, 2, and after the appropriate rinsing of * Corresponding author. Tel. 972-2-6585272; Fax 972-2-6527715; Email: [email protected]. 10.1021/nl0491428 CCC: $27.50 Published on Web 07/30/2004

© 2004 American Chemical Society

the solid support from any free or nonspecifically bound AuNPs, the surface was treated with hemin to form the catalytic label for the generation of light. Note that light will be emitted only if the DNAzyme-functionalized Au-NPs are associated with the surface, and this will occur only provided the target DNA 2 is hybridized with the surface. Figure 1A, curve a, shows the integrated light intensity emitted by the system upon analyzing 2, 10 nM. Control experiments revealed that very weak light is emitted from the system upon following this protocol in the absence of 2 or upon the exclusion of hemin from the system, or upon the interaction of the 1/2 complex on the surface with hemin in the absence of the DNAzyme-functionalized Au-NPs. These results clearly imply that the association of the DNAzyme-functionalized Au-NPs to the surface is essential to generate the light and that no nonspecific adsorption is observed in the system. Figure 1A, curves b-f, shows the integrated light intensities generated by the system upon the analysis of different concentrations of 2. As the concentration of 2 in the sample is higher, the emitted light intensity is enhanced and the detection limit for analyzing 2 is ca. 0.1 nM. Figure 1B shows the calibration curve. Figure 1A, curve g, shows the integrated light intensity upon analyzing 2, 1 nM, using the nucleic acid 3a, complexed with hemin as catalytic label for the generation of the light. In this latter system, 2 is detected by a single DNAzyme label, in contrast to the previous results that employed multifunctional DNAzymemodified Au-NPs. Clearly, by comparing the results shown in curves g and c, the use of the Au-NP as DNAzyme carrier provides a means to increase the sensitivity by at least 10fold.

Scheme 1 Amplified Chemiluminescence Detection of DNA Using DNAzyme-Functionalized Au-NPs

The assembly of the system was further characterized by microgravimetric quartz-crystal microbalance measurements in air. The immobilization of 1 on an Au-quartz crystal results in a frequency change of ∆f ) -44 Hz that translates to a surface coverage of ca. 2.5 × 10-11 mol‚cm-2. No measurable frequency changes were observed upon the hybridization of 2, 5 nM, or 0.5 nM with the interface. The interaction of the 1/2-hybridized interfaces with the DNAzymefunctionalized Au-NPs resulted in, however, a frequency change of -45 Hz and -8 Hz, respectively. The modified Au-NP provides a “heavy weight” label, and this yields the pronounced frequency decrease of the quartz crystal. Telomers are nucleic acids of constant repeat sequences tethered to the ends of the chromosomes. During cell proliferation telomers are eroded, and this provides a cellular signal for the termination of the cell cycle. In certain cells, the ribonucleoprotein telomerase is accumulated, and this results in the continuous elongation of the telomers9,10 and the generation of immortal cells. Indeed, in most malignant or cancer cells, elevated amounts of telomerase were detected,11 and it is used as a versatile marker for cancer cells.12 Different methods to detect telomerase activity were developed, including telomeric repeat amplification protocol (TRAP),13 surface plasmon resonance,14 optical methods that include semiconductor quantum dots,15 and the application of catalytic beacon structures.16 We applied the DNAzymefunctionalized Au-NPs as labels for the amplified detection 1684

of telomerase activity in HeLa cancer cells. The method is depicted in Scheme 2. The nucleic acid 4 was immobilized on a gold surface. Upon interaction with samples containing variable concentrations of HeLa cell extracts in the presence of the nucleotide mixture dNTPs, telomerization of 4 proceeds. The Au-NPs (13 ( 1 nm) were functionalized with the thiolated nucleic acid 6. This includes the G-rich sequence that forms, in the presence of hemin, the DNAzyme, and a segment tethered to the DNAzyme that is complementary to the telomer repeat units. Interaction of the telomer-modified surface with the 6-functionalized Au-NPs results in the hybridization of the DNAzyme-labeled AuNPs with the telomers, and the evolution of light in the presence of H2O2/luminol. As the extent of telomers formed on the surface is controlled by the concentration of telomerase in the analyzed samples, the amount of DNAzymelabeled Au-NPs hybridized with the surface, and thus the intensity of emitted light, will relate directly to the content of telomerase (or the number of cancer cells). Figure 2A shows the integrated light intensity generated upon analyzing the telomerase activity originating from a different number of cell extracts. As the number of cells is higher the emitted light intensity increases, as expected. The sensitivity limit corresponds to ca. 1000 HeLa cells in the analyzed sample. Figure 2A, curve e, shows the light emitted from a heattreated (95 °C for 10 min) telomerase originating from 10 000 HeLa cells. In this system telomerase is thermally degraded, Nano Lett., Vol. 4, No. 9, 2004

Figure 1. (A) Integrated light intensities observed upon the analysis of different concentrations of DNA (2) by the DNAzyme (3)modified Au-NPs: (a) 10 nM; (b) 5 nM; (c) 1 nM; (d) 0.5 nM; (e) 0.1 nM; (g) 1 nM, by using the DNAzyme (3a), 2.5 µM, as a label. (f) The analysis of 2 without added DNAzyme-functionalized Au-NPs but upon treatment with hemin 2.5 µM. In all experiments the analyzing solution consisted of a buffer solution, pH ) 9.0, composed of 25 mM HEPES, 20 mM KCl, 200 mM NaCl, 0.05% Triton X-100 and 1% DMSO, that included 0.5 mM luminol and 30 mM H2O2. (B) Calibration curve corresponding to the analysis of DNA (2) by the DNAzyme (3)-functionalized Au-NPs.

telomerization is eliminated, and thus the hybridization of the DNAzyme-labeled Au-NPs and the subsequent light emission are inhibited. The residual emitted light may be attributed to incomplete degradation of the telomerase or to some nonspecific adsorbates of the DNAzyme-labeled NPs on the interface. An additional control experiment, which did not lead to any light emission, included the exclusion of the 6-functionalized Au-NPs from the system but the interaction of the telomerized interface with hemin. These results indicate that the light emission originates from the specific telomerization of the primer 4 on the surface. In a Nano Lett., Vol. 4, No. 9, 2004

further experiment, the telomerized interface (generated by a 10 000 HeLa cell extract) was interacted with the singlestranded DNAzyme nucleic acid, 6a. Figure 2A, curve f, shows the resulting integrated light emitted by this system. The latter light intensity should be compared to the light generated by the multifunctional DNAzyme-Au-NPs, curve c. The sensitivity is enhanced by ca. 4-fold using the multifunctional biocatalytic Au-NPs conjugate. The calibration curve corresponding to the analysis of different number of HeLa cells according to Scheme 2 is shown in Figure 2B. The system was further characterized by microgravimetric quartz-crystal-microbalance measurements on an Auquartz crystal. The assembly of 4 on the surface resulted in a frequency change of ca. -41 Hz, which corresponds to a surface coverage of ca. 8.0 × 10-12 mol‚cm-2. The telomerization of the functionalized surface with telomerase, originating from 1000 HeLa cells and 10 000 HeLa cells, resulted in frequency changes of -8 Hz and -60 Hz, respectively. These results correspond to the introduction of 1.0 × 10-11 and 8.0 × 10-11 telomer repeat units‚cm-2, respectively, upon the elongation of 4. The hybridization of the DNAzyme-modified Au-NPs to the elongated telomers resulted in frequency changes of -20 Hz and -110 Hz in the two systems, respectively. In conclusion, the present study had introduced DNAzymefunctionalized Au-NPs as biocatalytic conjugates for the generation of biochemiluminescence. The system has been applied to sense DNA or telomerase activity. The DNAzymelabeled Au-nanoparticles and the nucleic acid-modified surfaces exhibit high stability for at least two months, turning the system into an attractive biosensing configuration. The sensitivity of the present method is ca. 102-104-fold lower than chemiluminescent assays for DNA analysis17 or telomerase assay.18 Realizing, however, that these latter processes include PCR amplification followed by complex physical amplification that involves the rotation of magnetic particles, we believe that the present method has obvious practical advantages. This concept of using DNAzyme-Au-NP conjugates may be extended to other biosensing systems. For example, by the co-association of antibodies to the DNAzyme-Au-NP labels, the amplified detection of antigen-antibody interactions may be envisaged. Experimental Section. Materials. Hemin was purchased from Porphyrin Products (Logan, Utah) and used without further purification. The concentration of diluted hemin solutions was determined using the standard spectroscopic method.19 A hemin stock solution was prepared in DMSO and stored in the dark at -20 °C. Other chemicals were obtained from Sigma and used as supplied. Au-NPs (13 ( 1 nm) stabilized with citrate were prepared according to literature.20 The concentration of the Au-NPs (13 ( 1 nm) was determined by following the absorbance spectra, λ ) 519 nm, and by using the appropriate extinction coefficient. DNA oligonucleotides were synthesized by Sigma Genosys. They were purified using the PAGE method. The sequences of the oligomers are as follows: (1): 5′-HS(CH2)6CGATTCGGTACTGG-3′; (2): 5′-TTGAGCATGCG1685

Scheme 2 Amplified Chemiluminescence Detection of Telomerase Activity Using DNAzyme-functionalized Au-NPs

CATTATCTGAGCCAGTACCGAATCG-3′;(3): 5′-ATGCGCATGCTCAAT10GGGTAGGGCGGGTTGGGT17(CH2)6SH-3′; (3a) 5′-ATGCGCATGCTCAATTTGGGTAGGGCGGGTTGGG-3′;(4): 5′-HS(CH2)6TTTTTTAATCCGTCGAGCAGAGTT3′;(6): 5′-(CTAACC)3T10GGGTAGGGCGGGTTGGGT17(CH2)6SH-3′;(6a): 5′-CTAACCCTAACCTTTGGGTAGGGCGGGTTGGG-3′ Immobilization of the Thiolated DNA Primer and Hybridization of the DNAzyme Label. The Au-coated (50 nm gold layer) glass plate (22 mm × 11 mm) was purified by treatment with a piranha solution (consisting of 70% concentrated sulfuric acid and 30% hydrogen peroxideCaution: piranha solution reacts Violently with organic materials) for 20 min, and then thoroughly rinsed with pure water. The plate was then soaked in concentrated nitric acid for 5 min and rinsed again with water. The plate was interacted with a solution of (1), 5 µM in 0.4 M sodium phosphate buffer, pH 7.4, for 12 h. The resulting plate was washed with the phosphate buffer and then treated with 1-mercaptohexanol, 1 mM in 0.1 M sodium phosphate buffer, pH 7.4, for 1 h. The resulting monolayer-functionalized surface was treated with different concentrations of the complementary analyte DNA (2) in a solution composed of 0.1 M phosphate buffer and the PerfectHyb Plus Hybrization Buffer (Sigma, 1:1) for 5 h to yield the ds-DNA assembly on the surface. The oligonucleotide-modified Au nanoparticles were prepared as reported previously.21 The surface was then allowed 1686

to hybridize with a solution of the DNAzyme (3)-functionalized Au-NPs in a solution composed of 0.1 M phosphate buffer and the Perfect HybPlus Hybrization Buffer (Sigma, 1:1), 40 °C, for 5 h. Then the surfaces were incubated in a buffer solution, pH ) 7.4, composed of 25 mM HEPES, 20 mM KCl, 200 mM NaCl, 0.05% Triton X-100 and 1% DMSO, that included 2.5 µM Hemin for 1 h. Preparation of Telomerase Extracts. HeLa cells were removed from the substrate by trypsinization, washed twice with 0.1 M PBS, and pelleted at 2000 rpm for 10 min at 4 °C. The cells were resuspended in a cold CHAPS lysis buffer (10 mM Tris-HCl, pH 7.4, 1 mM MgCl2, 1 mM EGTA, 0.1 mM PMSF, 0.5% CHAPS (Sigma) and 10% Glycerol) at a concentration of 5 × 106 cells/mL, incubated for 30 min in ice, and then centrifuged for 20 min (12 000 rpm, 4 °C). The supernatant was flash frozen and stored at -70 °C. Immobilization of 4 and Telomerization on a Au-Coated Glass Plate. The telomerase extract from the respective number of cells was introduced into 50 µL of 20 mM TrisHCl, pH 8.3, 4 mM MgCl2, 1 mM EGTA, 63 mM KCl, 0.05% Tween 20, 2 mM dATP, 2 mM dGTP, and 2 mM dTTP. The reaction mixture, 50 µL, was placed on the 4-modified glass plate. Modification of the plate with 4 was performed as described for 1. The plate was covered and the telomerization was allowed to proceed for 12 h at 37 °C. The resulting plate was rinsed with a phosphate buffer solution and allowed to hybridize with the DNAzyme Nano Lett., Vol. 4, No. 9, 2004

spectral results were corrected with respect to the background and integrated. Measurements were made after the plates were placed in a cuvette that included 3.3 mL of a buffer solution consisting of 25 mM HEPES, 20 mM KCl and 200 mM NaCl, pH ) 9.0, that included 0.5 mM luminol and 30 mM H2O2. The light emission intensity was measured at 1 nm intervals in the region of 350 nm to 550 nm, while reading at each wavelength the photons for a time interval of 0.2 s. The integrated light signal was accumulated within 1 min for each experiment. Acknowledgment. This research is supported, in part, by the Prostate Cancer Charity Trust (PCCT), U.K. References

Figure 2. (A) Integrated light intensities observed upon the analysis of telomerase activity originating from variable amounts of HeLa cancer cells and using the DNAzyme (6)-functionalized Au-NPs: (a) 10 000 cells; (b) 5000 cells; (c) 2500 cells; (d) 1000 cells; (e) Heat-treated 10 000 cells. (f) The analysis of telomerase activity originating from 2500 HeLa cells by using the free DNAzyme (6a), 2.5 µM, as label. Data recorded under the experimental conditions similar to those described in Figure 1A. (B) Calibration curve corresponding to the analysis of HeLa cancer cells by the 6-functionalized Au-NPs.

6-functionalized Au-NPs that were prepared as described for the analysis of 2, in a solution composed of 0.1 M phosphate buffer and the PerfectHyb Plus Hybrization Buffer (Sigma, 1:1), 40 °C, for 5 h. For the control experiments utilizing heat-treated HeLa cells, the cell extract was heated for 10 min at 95 °C. Light Emission Measurements. Light emission experiments were performed using a photon counting spectrometer (Edinburgh Instruments, FLS 920) equipped with a cooled photomultiplier detection system, connected to a computer (F900 v. 6.3 software). Before the sample analysis, a background run without sample was performed, and all Nano Lett., Vol. 4, No. 9, 2004

(1) (a) Breaker, R. R. Nat. Biotechnol. 1997, 15, 427-431. (b) Breaker, R. R. Nat. Biotechnol. 1999, 17, 422-423. (2) Emilsson, G. M.; Breaker, R. R. Cell Mol. Life Sci. 2002, 59, 596607. (3) (a) Travascio, P.; Li, Y.; Sen, D. Chem. Biol. 1998, 5, 505-517. (b) Travascio, L P.; Bennet, A. J.; Wang, D. Y.; Sen, D. Chem. Biol. 1999, 6, 779-787. (4) (a) Travascio, P.; Witting, P. K.; Mauk, A. G.; Sen, D. J. Am. Chem. Soc. 2001, 123, 1337-1348. (b) Witting, P. K.; Travascio, P.; Sen, D.; Mauk, A. G. Inorg. Chem. 2001, 40, 5017-5023. (5) (a) Xiao, Y.; Pavlov, V.; Gill, R.; Bourenko, T.; Willner I. ChemBioChem. 2004, 5, 374-379. (b) Pavlov, V.; Xiao, Y.; Gill, R.; Dishon, A.; Kotler, M.; Willner, I. Anal. Chem. 2004, 767, 21522156. (6) Mirkin, C. A.; Letsinger, R. L.; Mucic, R. C.; Storhoff, J. J. Nature 1996, 382, 607-609. (7) Storhoff, J. J.; Mirkin, C. A. Chem. ReV. 1999, 99, 1849-1862. (8) (a) Zhou, X. C.; O’Shea, S. J.; Li, S. F. Y. Chem. Commun. 2000, 953-954. (b) Patolsky, F.; Ranjit, K. T.; Lichtenstein, A.; Willner, I. Chem. Commun. 2000, 1025-1026. (c) Weizmann, Y.; Patolsky, F.; Willner, I. Analyst 2001, 126, 1502-1504. (9) Harley, C. B.; Villeponteau, B. Curr. Opin. Genet. 1995, 5, 249255. (10) (a) Harley, C. B.; Futcher, A. B.; Greider, C. W. Nature 1990, 345, 458-460. (b) Hastie, N. D.; Dempster, M.; Dunlop, M. G.; Thompson, A. M.; Green, D. K.; Allshire, R. C. Nature 1990, 346, 866-867. (11) Wright, W. E.; Piatyszek, M. A.; Rainey, W. E.; Byrd, W.; Shay, J. W. ReV. Genet. 1996, 18, 173-179. (12) (a) Shay, J. W.; Wright, W. E. Curr. Opin. Oncol. 1996, 8, 66-71. (b) Shay, J. W.; Bacchetti, S. Eur. J. Cancer 1997, 33, 787-791. (13) (a) Kim, N. W.; Piatyszek, M. A.; Prowse, K. R.; Harley, C. B.; West, M. D.; Ho, P. C. H.; Coviello, G. M.; Wright, W. E.; Weinricht, S. L.; Shay, J. W. Science 1994, 266, 2011-2015. (14) Maesawa, C.; Inaba, T.; Sato, H.; Iijima, S.; Ishida, K.; Terashima, M.; Sato, R.; Suzuki, M.; Yashima, A.; Ogasawara, S.; Oikawa, H.; Sato, N.; Saito, K.; Masuda, T. Nucl. Acids. Res. 2003, 31, e4. (15) Patolsky, F.; Gill, R.; Weizmann, Y.; Mokari, T.; Banin, U.; Willner, I. J. Am. Chem. Soc. 2003, 125, 13918-13919. (16) Xiao, Y.; Pavlov, V.; Niazov, T.; Dishon, A.; Kotler, M.; Willner, I. J. Am. Chem. Soc. 2004, 126, 7430-7431. (17) Patolsky, F.; Weizmann, Y.; Katz, E.; Willner, I. Angew. Chem., Int. Ed. 2003, 42, 2372-2376. (18) Weizmann, Y.; Patolsky, F.; Katz, E.; Willner, I. ChemBioChem. 2004, 5, 943-948. (19) Lavallee, D. K. The Chemistry and Biochemistry of N-substituted Porphyrins; VCH Publications: New York, 1987. (20) Grabar, K. C.; Freeman, R. G.; Hommer, M. B.; Natan, M. J. Anal. Chem. 1995, 67, 735-743. (21) Storhoff, J. J.; Elghanian, R.; Mucic, R. C.; Mirkin, C. A.; Letsinger, R. L. J. Am. Chem. Soc. 1998, 120, 1959-1964.

NL0491428 1687