Doping of Carbon Quantum Dots (CDs) in Calcium ... - ACS Publications

This is an open access article published under an ACS AuthorChoice License, which permits copying and redistribution of the article or any adaptations for non-commercial purposes.

Article Cite This: ACS Omega 2019, 4, 374−386

http://pubs.acs.org/journal/acsodf

Doping of Carbon Quantum Dots (CDs) in Calcium Phosphate Nanorods for Inducing Ectopic Chondrogenesis via Activation of the HIF-α/SOX‑9 Pathway Bodhisatwa Das,† Prabhash Dadhich,† Pallabi Pal,† Joy Dutta,† Abir Dutta,‡ Pavan Kumar Srivas,† and Santanu Dhara*,† School of Medical Science and Technology and ‡Advanced Technology Development Centre, Indian Institute of Technology, Kharagpur 721302, India

Downloaded via 5.101.217.12 on January 18, 2019 at 09:51:55 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

†

S Supporting Information *

ABSTRACT: Calcium phosphate (CaPs)-based nanostructures are mostly known to induce osteogenic differentiation of mesenchymal stem cells (MSCs). However, in the current study, doping of carbon quantum dots into calcium phosphate nanorods (C-CaPs) has been observed to affect the differentiation pathway and enhanced the expression of chondrogenic genes instead of osteogenic ones. Here, we report a microwave-assisted single-step synthesis and doping of carbon dot into calcium phosphate nanorods and their ectopic chondrogenicity in a rodent subcutaneous model. High-resolution transmission electron microscopy, X-ray powder diffraction, and X-ray photoelectron spectroscopy studies show that the doping of carbon dots results in p-type semiconductor-like structure formation at the phosphate site of the bioceramic nanostructure, whereas UV−vis absorption shows a drastic drop in band-gap energy, which enhances the molecular oxygen reduction reaction. The cytocompatibility, free radical scavenging property, and fluorescence microscopy studies proved the applicability of the nanostructure as a cell imaging nanoprobe. Further, fluorescent three-dimensional printed composite scaffolds were prepared and implanted (with MSCs cultured on them) in the rodent model where evidence of ectopic chondrogenesis was observed on the 15th day and 30th day of study via histology and immunohistochemistry. Further, in vitro polymerase chain reaction results and immunohistochemistry results correlated with the physicochemical characterization results. The analysis suggested that doping of carbon quantum dots into CaP nanostructures could activate the HIF-α/SOX-9 pathway for ectopic chondrogenesis.

1. INTRODUCTION Osteochondral injury, sports injury, and osteoarthritis are major issues related to cartilage degradation and defects, which are a major focus of current orthopedic research. Owing to the poor vasculature and viscoelastic properties, cartilage injury is difficult to heal. According to World Health Organization, India is going to become the global capital for osteoarthritis, with more than 60 million patients having severely damaged cartilage by the year 2025. The age group affected by this disease also tends to shift from above 60 years to 35−45 years. This is specifically disabling a huge population from contributing to their full potential during their major active years.1 Therefore, development of robust affordable technology for management of this disease is significantly required. Taking into consideration all of the current treatments, inclusive of joint replacement surgery and chronic antiinflammatory medication, tissue engineering in combination with mesenchymal stem cells (MSCs) is becoming a new alternative treatment.2 In the case of early detection of arthritis and other cartilage degenerative diseases, mostly medication of © 2019 American Chemical Society

anti-inflammatory drugs, local injection of cytokines, etc. are possible. Although auto- and allograft of chondrocytes for cartilage regeneration have been conducted, due to poor vascularization of this tissue, the success rate for replacement surgery is very low.3 Different sources of MSCs have been explored for the cartilage tissue repair models with significant success. Adipose, cord blood, and bone-marrow-derived stem cells have been explored for small and large animal models. However, in most of the cases, the MSCs were directly transplanted to the injury site for allowing cellular differentiation and healing. The injury site at the osteochondral surface is poor in vasculature and takes a very long time to heal (16−20 weeks). So, a cell-material construct that can induce differentiation to MSCs for repairing cartilage is a significant requirement. Received: July 24, 2018 Accepted: December 25, 2018 Published: January 7, 2019 374

DOI: 10.1021/acsomega.8b01763 ACS Omega 2019, 4, 374−386

ACS Omega

Article

For understanding the differentiation potential of any material to convert stem cells into a specific lineage, ectopic tissue formation is an excellent model.4 Chondroblastic differentiation is complex, and it requires multiple factors. The biological niches for chondrocytes are mostly rich in carbohydrate and sulfated proteoglycan moieties. Although reports on artificial or induced cartilage growth at the ectopic sites are very low, multiple approaches are observed to work out in those experiments. In most of the cases, chondrogenesis is followed by osteogenesis, which restricts its application in the repair of ectopic tissues such as nasal or auricular tissue. In most of the studies, it has been observed that it requires the controlled release of growth factors such as transforming growth factor β (TGF-β) and platelet-rich plasma factors.5 A biological niche (scaffolds made out of chondroitin sulfate) for the MSCs to differentiate into chondrocytes is also observed to be necessary in many cases.6 Decellularized matrix obtained from cartilage tissue is also another approach where cartilage growth is observed.7 The small molecules and cartilage-specific matrix isolated from ECM were also found to allow chondrogenic differentiation in vitro and in vivo.8 Genetic engineering and gene knockout studies also helped in understanding significantly the chondrogenesis pathway and ectopic cartilage growth.9 One of the major pathways toward chondrogenic differentiation is via the activation of hypoxiainducing factor (HIF-α). Chondrocytes mostly grow in an avascular region where oxygen tension is significantly low. Bone morphogenic protein, which belongs to the TGF-β subfamily, is the major gene that starts the differentiation process. Bone morphogenetic protein 2 (BMP-2) starts activating MSCs to move into either osteogenic or chondrogenic lineages.10 Calcium phosphate is known to be one of the major chemical activators in the expression of BMP2.11 However, the fate of the MSCs depends upon activation of other genes. HIF-α activates the major subfamily of Sox-9 and downregulates the RunX-2 gene family to continue chondrogenesis without invasion of the vasculature and bone formation.12 In vitro low oxygen tension application has been found to allow MSCs to take the chondrogenic differentiation route.13 However, creating a controlled lower oxygen gradient in an in vivo model is difficult as it makes the entire organism suffer from hypoxia. In recent years, carbon quantum dots (CDs) have been observed to be a suitable nanoprobe with in situ free radical scavenging.14 Therefore, in the current study, a novel approach for ectopic chondrogenesis is explored via developing a CD-doped calcium phosphatebased customized three-dimensional (3D) printed scaffold.

Figure 1. Visual inspection of C-CaP suspension (under visible light and UV).

The UV−vis spectrum has two important features to prove substitution of CDs in the structures. Owing to p−p* and n− p* transition peak and notches around 300 and 260 nm are observed. The cutoff wavelength was observed to be around 370 nm, and the measured band gap was 3.3 eV, which was significantly low compared to the precursor materials like CaP (4.51 eV) and sucrose-derived CD (4.3 eV). The major reports of band gaps in CDs were also observed to be around the range of 4−5 eV.15 The C-CaP band gap thus reduces to the range of standard semiconductor composites like SiC, GaN, and ZnS/ ZnO quantum dots. The fluorescence spectra are observed not to be a typical leptokurtic or regular spectrum (Figure 2b). In the spectra, the excitation and emission spectra are observed to be very sharp with a narrow width. It has been observed that with an excitation around 410 nm, an emission can be observed at 460 nm. The FTIR spectrum provided us information about the surface functionality of the material (Figure 2c). The major peaks for the PO4 mineral were observed for v1 (960 cm−1), v4 (560−600 cm−1), v3 (1100 cm−1), etc. The PO4-substituted CO3 peak was introduced around 1650 cm−1 in the C-CaP spectrum. The surface-bound CC peak becomes much more prominent in the C-CaP spectrum around 1450 cm−1. The peak around 2200 cm−1 also becomes stronger in C-CaP due to unsaturated alkyne-like C linkages. Also due to the formation of apatite-like phases, the peak for the surface-bound hydroxyl group is also broadened in the C-CaP spectrum around 3400 cm−1. The Raman spectrum (Figure 2d) also showed certain important features like 550−600 cm−1 peaks, which could be attributed to v4 out-of-plane bending, whereas the 450−500 cm−1 peaks could be attributed to H2PO4-like bending. Around 845 cm−1, peaks for O−O linkages could be observed. Around 1300 cm−1, the graphitic D band is observed, which could be attributed to CD substitution. The major nanostructure of C-CaP particles and its phase analysis were conducted using transmission electron microscopy (TEM) studies (Figure 3a−c). Significantly high aspect ratio nanorods were observed in C-CaP bright-field TEM images. The lengths of the samples were observed to be in the order of 60−70 nm, whereas in width they were lower than 10 nm. In the atomic resolution imaging, the lattice pattern was observed to be for both CaP [121] plane (JCPDS file no. 251569, calcium phosphate hydrate) and C [220] plane (JCPDS file no. 18-0311, carbon). In the selected area electron diffraction (SAED) pattern, also the crystal planes for C [111] and CaP [221] are observed. In XRD analysis, a similar trend is observed (Figure 3d) wherein both the spectra angles for CaP are observed in the positions 13.65, 23.96, 25.135,

2. RESULTS AND DISCUSSION 2.1. Synthesis of Powder. The C-CaP powder was prepared by a microwave-assisted protocol where all of the precursors were mixed in the required proportions and irradiated for 3 min. It was followed by overnight stirring. The powder was collected via centrifugation followed by washing and drying in an oven. Finally, a chocolate-brown powder was obtained, which creates a yellowish-brown aqueous suspension. The aqueous suspension (1 mg/mL) of the powder under UV light emitted bright green fluorescence (Figure 1). 2.2. Physicochemical Characterization of the Powder. Physicochemical characterization of the powders was conducted for checking their properties. UV−vis spectroscopy was performed to check their absorbance wavelengths (Figure 2a). 375


ACS Omega

Article

Figure 2. (a) UV−vis spectrum, (b) fluorescence spectra, (c) Fourier transform infrared (FTIR) spectra, and (d) Raman spectrum of C-CaP.

2.3. In Vitro Characterization of the Powder. The in vitro cytotoxicity evaluation was conducted by 3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay in both short- and long-term assays (Figure 5a). In long- and short-term cytotoxicities, cell viability was observed to have a direct relationship with the concentration of the samples in both the cases. Importantly, in the initial phase, there is a decline in viability with respect to the control, which increases drastically in the long term (not statistically significant). This could be attributed to initial shock because of the addition of powder in the cellular microenvironment due to change in osmolarity, etc. However, in the long term, significant cytocompatibility is observed (as much as almost 200% with respect to the control). The superoxide inhibition activity was analyzed using an NBT assay by developing artificially ROS into the system (UV exposure). It was observed that inhibition of superoxides took place in a concentration-dependent manner, with the lowest inhibition in the control (Figure 5b). ALP assay is a cellular metabolic process indicator, which is the most useful in examining phosphate metabolism, especially in osteochondral systems. In this assay, C-CaP powders were compared with CaP powders (Figure 5c). It has been observed that with respect to the control, both sets of powder showed higher ALP activities. However, with respect to CaP powders, the ALP activity of C-CaP powders was significantly high (almost 400%). ALP and MTT results both prove C-CaP to be a significantly metabolically active material for the MSC microenvironment.

28.217, 29.454, 30.35, 31.6, 32.39, 34.55, 38.57, 40.99°, etc. In the spectrum of C-CaP, additional peaks for carbon also appeared, which included angles at 27.78, 32.29, 36.38, 46.25, 49.38, 54.27, 57.55, 58.03°, etc. The chemical analysis of the samples was conducted by XPS analysis, where survey scan and elemental narrow scan both were performed (Figure 4). In the survey scan, all of the peaks attributed to C, P, O, and Ca were observed, whereas some other peaks were denoted by some impurities. The Ca 2p spectrum contains peaks for Ca10 (PO4)6(OH)2 (247 eV), Ca 2p3/2 peaks for CaCO3 (246.60 eV), Ca 2p3/2 peaks for CaO (246.10 eV), and Ca 2p1/2 peaks for CaO (249.8 eV). In the spectrum of C 1s however, mostly CD-specific peaks were observed. A sharp peak at 284 eV is observed specifically for graphite-like C−C linkages. The other peaks observed are for C−O linkages at 286.2 eV, and a broad hump was observed (285−289 eV), which could be attributed to C−O−C and CO linkages. In the spectrum of P 2p, two major peaks for C−P and P−O linkages (PO4)3− were observed around 131 and 133 eV. One more peak for P−P linkage was observed around 131.4 eV. In the O 1s spectrum, the major peak observed was around 531.4 eV for the formation of calcium phosphates/apatites. From this study, we can conclude that no peak for calcium carbide-like molecule was observed. Therefore, looking at the XPS results, we can conclude that carbon atoms are substituted mostly in the place of phosphorus atoms, which possibly create holes (electron vacancies) in the lattice. 376


ACS Omega

Article

Figure 3. Physicochemical analysis of C-CaP nanopowder using (a) TEM bright-field image, (b) lattice fringe image, (c) SAED pattern, and (d) XRD.

Figure 4. XPS analysis survey scans of (a) C-CaP, (b) Ca 2p, (c) C 1s, (d) P 2p, and (e) O 1s.

fluorescent images were observed to be clear and bright. The material was observed to stain the cytoplasm selectively. A dark

The bioimaging capability of the samples was determined by staining MSCs with C-CaP suspension (Figure 6). The 377


ACS Omega

Article

Figure 5. In vitro characterization of C-CaP nanopowder using (a) MTT assay, (b) NBT assay, and (c) ALP assay.

Figure 6. Fluorescence micrographs of MSCs (a) stained with C-CaP and (b) DAPI. (c) Bright-field image and (d) merged image.

378


ACS Omega

Article

Figure 7. Gelatin-C-CaP 3D printed composite in (a) bright field, (b) green filter, (c) blue filter, and (d) red filter. (e) Subcutaneous implantation of MSC-gelatin-C-CaP composite.

Figure 8. Histological analysis via H&E staining: (a) 15 days in low magnification, (b) 15 days in high magnification, (c) 30 days in low magnification, and (d) 30 days in high magnification.

2.4. Construction of 3D Printed Gelatin-C-CaP Composite, Implantation, and Histological Study. The scaffolds were imaged under a fluorescent stereo zoom microscope to observe their fluorescence properties (Figure 7). The scaffolds were observed to be the brightest in green filter, followed by red. This result is consistent with the

spot leaving the nucleus was observed. No overlapping between the nucleus stain and cytoplasm stain was observed. Therefore, interaction between the C-CaP particles and cellular DNA could be negligible. Hence, the powder not only is fluorescent but also can work as a bioimaging nanoprobe. 379


ACS Omega

Article

Figure 9. Chondrogenic differentiation-specific histological staining: (a) Alcian blue-nuclear fast red for 15 days, (b) Alcian blue-nuclear fast red for 30 days, (c) Toluidine blue for 15 days, (d) Toluidine blue for 30 days, (e) fast green FCF-safranin for 15 days, and (f) fast green FCF-safranin for 30 days.

fluorescence microscopy result of the C-CaP powder suspension incubated MSC images. The blue filter showed very feeble emission. As biological materials mostly emit in the bluish region, we can conclude that major fluorescence was observed due to doping of CDs into CaP particles. 2.5. Histological Analysis of Tissue Sections. The composite scaffolds cultured with MSCs were implanted in female white Wistar rats subcutaneously and kept for 15 and 30 days (Figure 7e). After 15 and 30 days, the rats were euthanized for sacrifice. In both cases, a new yellowish-white avascular tissue was observed, which was kept for fixation. However, no traces of scaffolds were observed. The collected tissue was fixed in formaldehyde and embedded in paraffin wax blocks for histology. The 15 day study in H&E does not show any specific feature for cartilage development. However, certain small isletlike cells in a nestedlike structure were observed (Figure 8a,b). In higher magnification, it was observed that those nests contain very tiny cells. The cells were observed to become mature and large islets in 30 days (Figure 8c,d). This typical structure is specifically observed in the case of chondrocytes. Moreover, the numbers of isletlike cells were observed to be more in the case of the 30 day study. Further confirmation was carried out with three cartilagespecific stains. Alcian blue-nuclear fast red is used for polysaccharide staining of glycosaminoglycans (GAGs), where the blue color specifically binds to the places where carbohydrate moieties like chondroitin sulfate are present. Just like H&E staining, in the case of this staining also in the 15 day study, very few nests were observed where blue stains (GAGs) were present (Figure 9a). However, in the 30 day study, not only isletlike cells in the nest were increased but also blue staining was seen selectively near the nests in the matrix (Figure 9b). Therefore, this could be attributed to cartilage-like structure formation. To confirm further, Toluidine blue (TB) staining was performed, which is specific to chondrocyte

matrix. In TB staining, it was clearly observed that the blue stain was selectively bound to the nestlike structure’s matrix. Therefore, these islets can be clearly considered as chondrocytes. In the ectopic region, the traditional structure of the cartilage might not have been seen. Moreover, in 15 day samples, the resemblance of structures with a chondrocyte-like morphology is not significant (Figure 9c). However, in the 30 day samples (Figure 9d), the structures are more like chondrocytes. In the higher magnification micrograph, at least two nests are clearly visible where the isletlike cells have significant similarity with chondrocytes. Besides, the thick collar of blue stain surrounding the matrix of the nest also proves the presence of GAGs over there, which is not native to the subcutaneous region. To confirm further, one more cartilage-specific histological staining was performed (fast green FCF-safranin staining). Safranin stains the carbohydrate-like ECM matrix to orange/red. This staining also has been carried out to ensure the presence of ectopic cartilage in the subcutaneous region. Just like TB staining, in this staining also, clearly an orange-red color was observed in the ECM of the chondrocyte-like islet nests (Figure 9e,f). In this staining, it was observed more clearly that the ECM island is rich in GAGs. In both 15 and 30 day samples, it was observed to have a clear nestlike structure. The green staining in the nearby fibers and red staining in the ECM prove them to be rich in collagen also. All of these results match with previously published results related to ectopic chondrogenesis.16 The final and most confirmatory studies were performed by anti-Col-II antibody staining. Instead of Col-I, the collagen fibers expressed in cartilages are Col-II. The presence of Col-II in the subcutaneous region is significantly impossible. Therefore, this could be considered as an almost confirmatory test for ectopic chondrogenesis. The IHC staining of Col-II has been observed in both 15 and 30 day samples. In both the cases, the ECM of the nestlike 380


ACS Omega

Article

Figure 10. IHC staining using anti-Col-II antibody: (a) 15 days and (b) 30 days.

Figure 11. In vitro PCR study: (a) images of the gel and (b) the corresponding band intensities [abbreviations: GAP, GAPDH; Agg, aggrecan; CCaP, CD-doped calcium phosphate 10, 20, 30, and 40 μg/mL as CCaP1, CCaP2, CCaP3, and CCaP4, respectively; CCaP scaffold as the nanocomposite and tissue culture plate (TCP) as the control].

mechanism are BMP-2, RunX-2, HIF-α, Sox-9, aggrecan, and Col-II (Figure 11). The expression of BMP-2 was less in C-CaP samples with respect to the control. The opposite pattern was observed in the case of HIF-α. However, the expression of RunX-2 was observed to be opposite where the CaP samples showed overexpression. This is mostly because traditionally calcium phosphates enhance intramembranous osteogenesis and RunX2 is basically the major gene that enhances that cascade. However, the chondrogenesis-specific two major gene expressions were observed to be in favor of C-CaP samples. The genes majorly involved in chondrogenesis or expressed in the ECM of cartilages are mostly overexpressed in C-CaP samples. Sox-9 is the activator of the chondrogenesis pathway, whereas aggrecan and Col-II are two major extracellular matrix genes expressed in chondrogenesis. Therefore, the immunohistochemistry results are observed to be in agreement with in vitro gene expression studies. Importantly, CD-31/PECAM expressions are also significantly low, which cause lack of vascularization, leading to chondrogenesis. Considering the above gene expression study, a probable mechanism could be explained. As it is already observed that CDs can scavenge ROS, this could be a possible reason behind this activity.14 The doping of CDs into CaP nanorods mostly allows substitution of P atoms into C−C lattice of CDs. There are

structures was observed to take the brownish IHC staining (Figure 10). The presence of Col-II in this region could be a confirmatory result for ectopic chondrogenesis due to MSC and C-CaP interactions as the possibility of Col-II occurring in the subcutaneous region is significantly low. Further, the distribution of GAGs, Col-II, and nestlike structures of chondrocyte is significantly specific to the articular cartilagelike structure and is supported by previous literature reporting MSCs to differentiate into ectopic site16b and repair articular cartilage.17 The results have striking difference from the histological results with the control scaffolds (only gelatin without C-CaP) reported in the Supporting Information. 2.6. Polymerase Chain Reaction (PCR) Analysis. Even though histological and IHC staining supports the formation of ectopic cartilage subcutaneously post in vivo implantation of the scaffolds, the mechanism of this differentiation remains to be explored. CaP-like materials have been observed to form bone via intramembranous ossification at the site of ectopic implantation in multiple previous reports.18 Therefore, the above outcome is definitely a modification of the differentiation pathway of MSCs. So, to understand the mechanism of this alteration in differentiation, in vitro PCR study was conducted for an array of genes (Figure 11). Although GAPDH was used for housekeeping, the other genes utilized in this study to understand the underlying 381


ACS Omega

Article

Figure 12. Probable lattice structure of C-CaP and its ROS scavenging-mediated localized hypoxia development.

Figure 13. Proposed gene expression mechanism for ectopic chondrogenesis.

blocked. Instead, Sox-9 is activated to differentiate MSCs into chondrocytes.22 In this way, the MSCs start chondrogenesis instead of osteogenesis and further express aggrecan and ColII. The process could further proceed to osteogenesis (endochondral ossification), but due to downregulation of major endothelial marker CD-31 (Figure 11), further differentiation leading to osteogenesis might have been blocked, leading to ectopic chondrogenesis. Similar differentiationrelated results have also been reported in different molecular biological studies where temporal hypoxia downregulated angiogenesis and activated chondrogenesis.23

already several studies reporting that doping of P atoms into the carbon lattice enhances oxygen reduction.19 As carbon has four electrons and phosphorus has five, this substitution mostly generate a p-type semiconductor-like structure where excess electrons are the major carriers (Figure 12). We also observed that there is a drastic drop in band-gap energy (3.3 eV), which supports the same theory. Initially when scaffolds are implanted, because of inflammatory response, a significant amount of ROS is generated, which is scavenged by CDs present in the samples.20 During this process, the excess electron is transferred to the reactive oxygen species to make the octet of the valence shell complete. This, in turn, generates highly reactive atomic oxygen, which attacks the carbon backbone and finally is removed into a biological buffer in the form of carbonate or bicarbonate ions.14b The degradation of oxygen affects depletion of the oxygen level at the cellular microenvironment activating HIF-α (Figure 13). CaP nanoparticles excited MSCs to express BMP2 cascade via intramembranous osteogenesis.21 However, the presence of HIF-α caused an upregulation of Sox-9 and a downregulation of RunX-2 (Figure 13).16c Therefore, the major pathway of intramembranous bone formation in ectopic sites via upregulation of RunX-2 is

3. CONCLUSIONS C-CaP is a relatively easy-to-synthesize material, which could be effective in vitro for cellular imaging and ROS scavenging (Supporting Information). However, instead of remaining only as a fluorescent nanoprobe, this material was observed to have the magical potential of modifying the fate of MSCs to differentiate into chondrocytes. In nature, cartilage-related injuries and diseases are very difficult to repair. Osteoarthritis and sports injury of joints are problems that have ruined many lives. Poor vasculature, limited mass transfer, and transiently stable ECM matrix materials/growth factors limit the rapid 382


ACS Omega

Article

graphs. All of the micrographs were captured at 20× magnification. To evaluate the cell metabolic activity and cytotoxicity, 3(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was done. Next, 104 cells/mL were seeded on a tissue culture plate (TCP), which also served as the control, and incubated at 37 °C. After 24 h, different w/v % of C-CaP containing media were added. After 3 and 7 days, the sample and TCP (control) were washed with PBS and incubated in 0.5 mg/mL MTT solution at 37 °C for 4 h. Dimethyl sulfoxide (DMSO) was added and stirred to dissolve the purple formazan crystals thus formed. A microplate reader, Plate screen (RMS, Chandigarh, India), was used for measuring the absorbance at 595 nm. [For blood compatibility study of the powder, kindly refer to the Supporting Information.] The alkaline phosphatase (ALP) assay was conducted quantitatively by colorimetric analysis of the yellow product of p-nitrophenol that resulted from enzymatic cleavage of colorless p-nitrophenol phosphate (p-NPP, Sigma-Aldrich) by the ALP enzyme. Briefly, 5 mM (p-NPP) solution (ALP substrate) was prepared in the absence of light. The cells (104/ sample) were seeded with different concentrations of CDdoped calcium phosphate and undoped calcium phosphate. After 7 days, the samples were washed with normal saline. The samples were incubated with 40 μL of substrate in dark environment at room temperature for 60 min. The yellow product was assessed by absorbance measurement at 405 nm on a microplate reader. Nitro blue tetrazolium (NBT) assays in vitro by both spectroscopic and microscopic methods were performed using the protocol described in our previous report with certain modification. Briefly, 6 mg/mL NBT (SRL Chemicals, Mumbai) solution was prepared in PBS and protected from light. MSCs cultured in DMEM (Hi Media) were added in poly-L-lysine-coated culture plates and incubated with different concentrations of samples up to 3 days. For induction of ROS, the samples were kept in UV for 30 min before the day of measurement, followed by incubation of NBT solution containing media (1:9). The samples after 24 h of incubation were utilized for assay. For spectroscopy, the media was discarded, and the cells were lysed using DMSO and 1 M KOH solution. Finally, the optical density was measured at 610 nm.25 4.4. Fabrication of 3D Printed Scaffolds. The slurry for printing was prepared by the following method. First, 20% gelatin (w/v) was prepared in warm DI water and mixed thoroughly to prepare 5% C-CaP (w/v) stable slurry following a previously reported study with certain modifications.26 The slurry was allowed to mix overnight and was degassed by noctanol prior to printing. The printing was carried out in Envisiontec 3D Bioplotter with the following parameters: 17 °C, 4 bar pressure, and head speed 19 mm/s using a dispenser having 300 μm diameter based on a standard CAD model (0− 90° lattice with average strand distance 250 μm). The printed structures are cross-linked using 5% glutaraldehyde (v/v) in water in a dark environment for 6 h. The scaffolds were treated further with 10% glycine solution for neutralizing the unreacted aldehyde groups to reduce the toxicity. The scaffolds were washed thoroughly with water and dried at room temperature. Wharton-jelly-derived MSCs were cultured on the 3D printed scaffolds (1 cm2 area and 1 mm height) with an initial cell density of 105 cells/sample. After 7 days of culture in low serum DMEM, the scaffolds were implanted in white

engineering of cartilage tissue. The composite scaffolds made from C-CaP could be an answer to this problem. Most importantly, the mechanism explored in this study could be useful in understanding the correlation between tuning the oxygen tension and modification of differentiation pathways in the near future.

4. EXPERIMENTAL SECTION All of the materials utilized in the current study were used as is without further purification unless specifically mentioned. For all of the reactions, deionized water (DI water, conductivity: 18.5 mΩ cm−1) was utilized. CaNO3, sucrose, Na2HPO4, KH2PO4, NaCl, KCl, NaOH, gelatin, etc. were procured from Merck India. 4.1. Synthesis of CD-Doped Calcium Phosphate Nanorods. The synthesis of CD-doped CaP (C-CaP) nanopowder was conducted in a simple microwave-assisted single-step route. The reaction mixture was prepared by mixing 0.5 M sucrose in DI H2O along with 0.3 M Ca (NO3)2 and 0.2 M (NH4)2HPO4. The pH of the reaction mixture was raised to 11 by mixing with 1 M NaOH. The mixture was immediately transferred to a domestic microwave (1000 W, 2.6 GHz, LG) and was irradiated for 5 min. The mixture was taken out, and 1 M HCl was added to adjust the pH to neutrality. The mixture was allowed to stir for 15 h. Finally, the suspension turned brownish-white (chocolate-milk color). The nanopowder was collected by centrifugation followed by washing twice with distilled water. Finally, the powders were oven-dried and crushed using a ball mill with zirconia balls (Jyoti Laboratories, Mumbai). 4.2. Characterization of Nanopowders. The synthesized nanopowders were characterized by UV−vis spectroscopy (Varian Cary), fluorescence spectroscopy (Perkin Elmer LS55), XPS (VG scientific ESCALAB MK-2, Mg Kα), HRTEM (JEOL, JEM-2100), EDAX (Oxford Instruments), FTIR (Thermo Nicolet, Nexus 8700), Raman spectroscopy (Jobin Yvon Horiba, T 64 000), DLS (Malvern, Zetasizer), and SEM (Carl Zeiss, EVO 60). The band gap of the powder was determined using the standard protocol reported previously using the standard absorbance spectrum of sucrose-derived CDs and calcium phosphate nanoparticles, already reported in the literature.24 The measurement was conducted using the following formula: E = hC/λ

Here, E is the band-gap energy (eV), h is Planck’s constant (6.626 × 10−34 J s), C is the velocity of light at vacuum (3 × 108 m/s), and λ is the cutoff wavelength in the UV−vis spectrum (nm). 4.3. In Vitro Characterization of Powder. The bioimaging study was conducted by growing cells on poly-Llysine-coated coverslips (Blue-Star) (104 cells/sample). The CCaP mixed media was added (10 μg/mL) to the cells and incubated for 12 h. The media was removed, and the coverslips were washed with phosphate-buffered saline (PBS). The cells were counterstained with DAPI (Life Technologies) for nucleus and imaged using an inverted fluorescence microscope (Carl Zeiss, Germany). The coverslips were mounted on glass slides (Hi Media) and imaged using both fluorescence and differential interference contrast (DIC) modes. Two filters of excitation (365 nm bandpass 25 and 470 nm bandpass 50 nm) and emission (450 nm bandpass 25 and 540 nm bandpass 25 nm) were employed for capturing the fluorescence micro383


ACS Omega

Article

Table 1. List of Primer Sequences and Respective Melting Temperatures gene name

forward primer sequence (5′-3′)

reverse primer sequence (5′-3′)

melting temperature (°C)

human HIF-1α PECAM GAPDH collagen-II aggrecan Sox-9 BMP-2

TTCACCTGAGCCTAATAGTCC TCAAATGATCCTGCGGTATTC CCATGGAGAAGGCTGGGG GGCAATAGCAGGTTCACGTACA TGCATTCCACGAAGCTAACCTT AGCGAACGCACATCAAGAC ACCCGCTGTCTTCTAGCGT

CAAGTCTAAATCTGTGTCCTG CCACCACCTTACTTGACAGGA CAAAGTTGTCATGGATGACC CGATAACAGTCTTGCCCCACTT GACGCCTCGCCTTCTTGAA GCTGTAGTGTGGGAGGTTGAA CTCAGGACCTCGTCAGAGGG

53.9 58.5 54 53.9 53.7 53.7 57

Wistar rats (female, n = 3) subcutaneously. The animals were sacrificed upon 15 and 30 days via euthanization. [For SEM and fluorescence microscopy studies of MSCs cultured in 3D printed composites, kindly refer to the Supporting Information]. 4.5. Histology and Immunohistochemistry Protocol. The collected tissue was fixed using 10% formaldehyde. It was dried using the gradient of alcohol and finally embedded into paraffin blocks. Histology was performed upon tissue sections cut by a Leica microtome machine with 5 μM section thickness. Importantly, along with H&E cartilage-specific stains like Toluidine blue, Alcian blue-nuclear fast red and fast greensafranin were used. For finding cartilage-specific proteins, ColII immunohistochemistry was conducted. For staining, dewaxing of the sections was performed by treating with xylene (24 h), followed by alcohol gradient treatment prepared in water (100, 70, and 50%). Finally, the sections were treated with water and stained using water-based dyes. 4.5.1. Hematoxylin and Eosin Staining. The nuclei were stained with hematoxylin (3−4 min) and rinsed in running tap water. Sections were further stained with eosin for 1 min, followed by washing with water to remove excess dye. 4.5.2. Toluidine Blue Staining. The hydrated sections were stained in Toluidine blue working solution for 2 min. The sections were washed in distilled water until excess blue stain was removed. 4.5.3. Alcian Blue Staining. The hydrated sections were stained in Alcian blue solution for 30 min, washed in running tap water for 2 min, and counterstained in nuclear fast red solution (0.1 g nuclear fast red, 5 g aluminum sulfate dissolved in 100 mL of distilled water) for 5 min, washed in running tap water for 1 min, dehydrated through graded alcohol, cleared in xylene, and mounted (chemicals utilized were procured from Sigma). 4.5.4. Fast Green FCF/Safranin Staining. The nuclei of the tissue sections were stained with Weigert’s iron hematoxylin for 5 min. This was followed by washing, staining with Fast Green for 5 min, and again washing with 1% acetic acid. Finally, they were stained with safranin for 3 min, washed, and mounted. (All of the chemicals were procured from Hi Media.) 4.5.5. Immunohistochemistry Protocol. The hydrated sections were incubated in 3% H2O2 solution prepared in methanol at room temperature for 10 min to block endogenous peroxidase activity. The sections were rinsed in 300 μL of PBS for 2 changes, 5 min each. Antigen retrieval step was conducted to unmask the antigenic epitope. The most commonly used antigen retrieval is a citrate buffer method. The slides were arranged in a staining container. First, 300 μL of 10 mM citrate buffer, pH 6.0, was added into the staining container and incubated at 95−100 °C for 10 min (optimal incubation time should be determined by the user). The slides were taken out to cool for 20 min. They were rinsed in 300 μL

of PBS for 2 changes, 5 min each, followed by addition of 100 μL of blocking buffer (e.g., 10% fetal bovine serum in PBS) onto the sections of the slides. The slides were incubated in a humidified chamber at room temperature for 1 h. The blocking buffer was drained off the slides. Then, 100 μL of appropriately diluted primary antibody (in antibody dilution buffer, e.g., 0.5% bovine serum albumin in PBS) was added to the sections on the slides and incubated in a humidified chamber at room temperature for 1 h. The slides were washed in 300 μL of PBS for 2 changes, 5 min each. Next, 100 μL of appropriately diluted biotinylated secondary antibody (using the antibody dilution buffer) was added to the sections on the slides and incubated in a humidified chamber at room temperature for 30 min. The slides were washed in 300 μL of PBS for 2 changes, 5 min each; 100 μL of appropriately diluted streptavidin-HRP conjugates (using the antibody dilution buffer) was then added to the sections on the slides and incubated in a humidified chamber at room temperature for 30 min (protected from light). The slides were washed in 300 μL of PBS for 2 changes, 5 min each; 100 μL of DAB substrate solution (freshly made just before use: 0.05% DAB−0.015% H2O2 in PBS) was added to the sections on the slides to reveal the color of antibody staining. Color development was allowed for less than 5 min until the desired color intensity was reached. The slides were washed in 300 μL of PBS for 2 changes, 5 min each. Counterstaining of slides was performed by immersing them in hematoxylin (Sigma) for 1−2 min and rinsing them in running tap water for more than 15 min. 4.6. Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) Study. In the case of C-CaP, MSCs were cultured upon both 3D scaffolds and in tissue culture plates with different concentrations of the powder suspended in media. The samples of CD-doped calcium phosphate suspended in cell culture media, explored in PCR studies are labelled as CCaP1 (10 μg/mL), CCaP2 (20 μg/mL), CCaP3 (30 μg/mL), CCaP4 (40 μg/mL) and CCaP scaffold (nanocomposite) in the results section. Total RNA was isolated from cell culture plates using an RNA extraction kit (Genetix, India) according to the manufacturer’s instruction, and concentration was balanced by measuring it in “Nanodrop” (Biorad). RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) was used for cDNA synthesis according to the manufacturer’s instructions. PCR amplification was done for 35 cycles using the following conditions: 94 °C (denaturation) for 30 s, Variable 1 (annealing) for 30 s, and 72 °C extension for 30 s, and a final extension at 72 °C for 10 min in the thermal cycler (Eppendorf, Germany). PCR products were then analyzed by 1% agarose gel electrophoresis. The gels were cast with addition of ethidium bromide into them and bands were imaged Geldoc (Biorad) machine. The bands were analyzed using Image-J software, and relative band intensities were plotted. 384


ACS Omega

Article

(6) (a) Meng, F. G.; Zhang, Z. Q.; Huang, G. X.; Chen, W. S.; Zhang, Z. J.; He, A. S.; Liao, W. M. Chondrogenesis of mesenchymal stem cells in a novel hyaluronate-collagen-tricalcium phosphate scaffolds for knee repair. Eur. Cells Mater. 2016, 31, 79−94. (b) Gawlitta, D.; Benders, K. E.; Visser, J.; van der Sar, A. S.; Kempen, D. H.; Theyse, L. F.; Malda, J.; Dhert, W. J. Decellularized cartilage-derived matrix as substrate for endochondral bone regeneration. Tissue Eng., Part A 2015, 21, 694−703. (7) Eldridge, S.; Nalesso, G.; Ismail, H.; Vicente-Greco, K.; Kabouridis, P.; Ramachandran, M.; Niemeier, A.; Herz, J.; Pitzalis, C.; Perretti, M.; Dell’Accio, F. Agrin mediates chondrocyte homeostasis and requires both LRP4 and α-dystroglycan to enhance cartilage formation in vitro and in vivo. Ann. Rheum. Dis. 2016, 75, 1228−1235. (8) (a) Zhang, Z.; Gupte, M. J.; Jin, X.; Ma, P. X. Injectable Peptide Decorated Functional Nanofibrous Hollow Microspheres to Direct Stem Cell Differentiation and Tissue Regeneration. Adv. Funct. Mater. 2015, 25, 350−360. (b) Ba, R.; Wei, J.; Li, M.; Cheng, X.; Zhao, Y.; Wu, W. Cell-bricks based injectable niche guided persistent ectopic chondrogenesis of bone marrow-derived mesenchymal stem cells and enabled nasal augmentation. Stem Cell Res. Ther. 2015, 6, 16. (9) (a) Zhu, Y.; Zhang, Y.; Liu, Y.; Tao, R.; Xia, H.; Zheng, R.; Shi, Y.; Tang, S.; Zhang, W.; Liu, W.; Cao, Y.; Zhou, G. The influence of Chm-I knockout on ectopic cartilage regeneration and homeostasis maintenance. Tissue Eng., Part A 2015, 21, 782−92. (b) Yamashita, A.; Morioka, M.; Yahara, Y.; Okada, M.; Kobayashi, T.; Kuriyama, S.; Matsuda, S.; Tsumaki, N. Generation of Scaffoldless Hyaline Cartilaginous Tissue from Human iPSCs. Stem Cell Rep. 2015, 4, 404−418. (10) Zhou, N.; Hu, N.; Liao, J. Y.; Lin, L. B.; Zhao, C.; Si, W. K.; Yang, Z.; Yi, S. X.; Fan, T. X.; Bao, W.; Liang, X.; Wei, X.; Chen, H.; Chen, C.; Chen, Q.; Lin, X.; Huang, W. HIF-1alpha as a Regulator of BMP2-Induced Chondrogenic Differentiation, Osteogenic Differentiation, and Endochondral Ossification in Stem Cells. Cell Physiol. Biochem. 2015, 36, 44−60. (11) (a) Nahar-Gohad, P.; Gohad, N.; Tsai, C. C.; Bordia, R.; Vyavahare, N. Rat aortic smooth muscle cells cultured on hydroxyapatite differentiate into osteoblast-like cells via BMP-2SMAD-5 pathway. Calcif. Tissue Int. 2015, 96, 359−69. (b) Lei, Y.; Sinha, A.; Nosoudi, N.; Grover, A.; Vyavahare, N. Hydroxyapatite and calcified elastin induce osteoblast-like differentiation in rat aortic smooth muscle cells. Exp. Cell Res. 2014, 323, 198−208. (c) Suto, M.; Nemoto, E.; Kanaya, S.; Suzuki, R.; Tsuchiya, M.; Shimauchi, H. Nanohydroxyapatite increases BMP-2 expression via a p38 MAP kinase dependent pathway in periodontal ligament cells. Arch. Oral Biol. 2013, 58, 1021−8. (12) (a) Robins, J. C.; Akeno, N.; Mukherjee, A.; Dalal, R. R.; Aronow, B. J.; Koopman, P.; Clemens, T. L. Hypoxia induces chondrocyte-specific gene expression in mesenchymal cells in association with transcriptional activation of Sox9. Bone 2005, 37, 313−22. (b) Schipani, E. Hypoxia and HIF-1 alpha in chondrogenesis. Semin. Cell Dev. Biol. 2005, 16, 539−46. (13) Lee, H. H.; Chang, C. C.; Shieh, M. J.; Wang, J. P.; Chen, Y. T.; Young, T. H.; Hung, S. C. Hypoxia enhances chondrogenesis and prevents terminal differentiation through PI3K/Akt/FoxO dependent anti-apoptotic effect. Sci. Rep. 2013, 3, No. 2683. (14) (a) Zhao, S.; Lan, M.; Zhu, X.; Xue, H.; Ng, T.-W.; Meng, X.; Lee, C.-S.; Wang, P.; Zhang, W. Green Synthesis of Bifunctional Fluorescent Carbon Dots from Garlic for Cellular Imaging and Free Radical Scavenging. ACS Appl. Mater. Interfaces 2015, 7, 17054− 17060. (b) Das, B.; Dadhich, P.; Pal, P.; Srivas, P. K.; Bankoti, K.; Dhara, S. Carbon nanodots from date molasses: new nanolights for the in vitro scavenging of reactive oxygen species. J. Mater. Chem. B 2014, 2, 6839−6847. (15) Rodrigues, C. V.; Correa, J. R.; Aiube, C. M.; Andrade, L. P.; Galvão, P. M.; Costa, P. A.; Campos, A. L.; Pereira, A. J.; Ghesti, G. F.; Felix, J. F.; Weber, I. T.; Neto, B. A.; Rodrigues, M. O. Down- and Up-Conversion Photoluminescence of Carbon-Dots from Brewing Industry Waste: Application in Live Cell-Imaging Experiments. J. Braz. Chem. Soc. 2015, 26, 2623−2628.

GAPDH was used as the housekeeping gene, and its expression was checked. The gene expressions that were taken into account are hypoxia-inducing factor α-(HIF-α), collagenII, BMP-2, RunX-2, Sox-9, and PECAM (primer sequences and melting temperature are provided in the table below; Table 1). 4.7. Statistical Analysis. All of the results were being reported as mean ± standard deviation (n = 3 if not mentioned), and p ≤ 0.05 was considered statistically significant in a standard Student’s t-test.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsomega.8b01763. • Blood compatibility study of C-CaP powder, physicochemical and in vitro characterization of composite scaffolds, histological analysis of control scaffold, and tracing of the fate of stem cells in vivo (PDF)

■

(PDF)

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. ORCID

Bodhisatwa Das: 0000-0002-1447-9089 Santanu Dhara: 0000-0003-4443-7610 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors acknowledge Nantu Dogra and Krishnabrata Panda for their kind help in histology. The authors also like to thank Dr. Ronak Reshamwala and Dr. Megha Shah Reshamwala for their inputs in interpreting the histological analysis of the data.

■

REFERENCES

(1) Litwic, A.; Edwards, M. H.; Dennison, E. M.; Cooper, C. Epidemiology and burden of osteoarthritis. Br. Med. Bull. 2013, 105, 185−99. (2) Tanaka, Y. Human mesenchymal stem cells as a tool for joint repair in rheumatoid arthritis. Clin. Exp. Rheumatol. 2015, 33, S58− 62. (3) Breedveld, F. C. Current and future management approaches for rheumatoid arthritis. Arthritis Res. 2002, 4, S16−21. (4) (a) Hochedlinger, K.; Yamada, Y.; Beard, C.; Jaenisch, R. Ectopic Expression of Oct-4 Blocks Progenitor-Cell Differentiation and Causes Dysplasia in Epithelial Tissues. Cell 2005, 121, 465−477. (b) Liu, T. M.; Wu, Y. N.; Guo, X. M.; Po Hui, J. H.; Lee, E. H.; Lim, B. Effects of Ectopic Nanog and Oct4 Overexpression on Mesenchymal Stem Cells. Stem Cells Dev. 2009, 18, 1013−1021. (5) (a) Fan, H.; Hu, Y.; Li, X.; Wu, H.; Lv, R.; Bai, J.; Wang, J.; Qin, L. Ectopic cartilage formation induced by mesenchymal stem cells on porous gelatin-chondroitin-hyaluronate scaffold containing microspheres loaded with TGF-beta1. Int. J. Artif. Organs 2006, 29, 602− 11. (b) Goodrich, L. R.; Chen, A. C.; Werpy, N. M.; Williams, A. A.; Kisiday, J. D.; Su, A. W.; Cory, E.; Morley, P. S.; McIlwraith, C. W.; Sah, R. L.; Chu, C. R. Addition of Mesenchymal Stem Cells to Autologous Platelet-Enhanced Fibrin Scaffolds in Chondral Defects: Does It Enhance Repair? J. Bone Jt. Surg., Am. Vol. 2016, 98, 23−34. 385


ACS Omega

Article

(16) (a) Naidoo, T.; Frith, J.; Menzies, D. J.; Pradal, C.; Cameron, A.; Wolvetang, E.; Grondahl, L.; Whitehead, D.; Gronthos, S.; Zannettino, A.; Ghosh, P.; Cooper-White, J. Chondro-inductive injectable hydrogels for stem cell-based intervertebral disc tissue engineering Front. Bioeng. Biotechnol. 2016, 4, DOI: 10.3389/ conf.FBIOE.2016.01.02659. (b) Liu, X.; Sun, H.; Yan, D.; Zhang, L.; Lv, X.; Liu, T.; Zhang, W.; Liu, W.; Cao, Y.; Zhou, G. In vivo ectopic chondrogenesis of BMSCs directed by mature chondrocytes. Biomaterials 2010, 31, 9406−9414. (c) Zhou, N.; Hu, N.; Liao, J. Y.; Lin, L. B.; Zhao, C.; Si, W. K.; Yang, Z.; Yi, S. X.; Fan, T. X.; Bao, W.; Liang, X.; Wei, X.; Chen, H.; Chen, C.; Chen, Q.; Lin, X.; Huang, W. HIF-1α as a Regulator of BMP2-Induced Chondrogenic Differentiation, Osteogenic Differentiation, and Endochondral Ossification in Stem Cells. Cell. Physiol. Biochem. 2015, 36, 44−60. (17) Zhu, Y.; Wu, X.; Liang, Y.; Gu, H.; Song, K.; Zou, X.; Zhou, G. Repair of cartilage defects in osteoarthritis rats with induced pluripotent stem cell derived chondrocytes. BMC Biotechnol. 2016, 16, 78. (18) (a) Müller, P.; Bulnheim, U.; Diener, A.; Lüthen, F.; Teller, M.; Klinkenberg, E.-D.; Neumann, H.-G.; Nebe, B.; Liebold, A.; Steinhoff, G.; Rychly, J. Calcium phosphate surfaces promote osteogenic differentiation of mesenchymal stem cells. J. Cell. Mol. Med. 2008, 12, 281−291. (b) Viti, F.; Landini, M.; Mezzelani, A.; Petecchia, L.; Milanesi, L.; Scaglione, S. Osteogenic Differentiation of MSC through Calcium Signaling Activation: Transcriptomics and Functional Analysis. PLoS One 2016, 11, No. e0148173. (19) (a) Liu, Z.; Peng, F.; Wang, H.; Yu, H.; Zheng, W.; Wei, X. Preparation of phosphorus-doped carbon nanospheres and their electrocatalytic performance for O2 reduction. J. Nat. Gas Chem. 2012, 21, 257−264. (b) Wu, J.; Yang, Z.; Sun, Q.; Li, X.; Strasser, P.; Yang, R. Synthesis and electrocatalytic activity of phosphorus-doped carbon xerogel for oxygen reduction. Electrochim. Acta 2014, 127, 53− 60. (c) Choi, C. H.; Park, S. H.; Woo, S. I. Phosphorus-nitrogen dual doped carbon as an effective catalyst for oxygen reduction reaction in acidic media: effects of the amount of P-doping on the physical and electrochemical properties of carbon. J. Mater. Chem. 2012, 22, 12107−12115. (20) (a) Conner, E. M.; Grisham, M. B. Inflammation, free radicals, and antioxidants. Nutrition 1996, 12, 274−277. (b) White, M. J.; Heckler, F. R. Oxygen free radicals and wound healing. Clin. Plast. Surg. 1990, 17, 473−84. (21) (a) Gamblin, A.-L.; Brennan, M. A.; Renaud, A.; Yagita, H.; Lézot, F.; Heymann, D.; Trichet, V.; Layrolle, P. Bone tissue formation with human mesenchymal stem cells and biphasic calcium phosphate ceramics: The local implication of osteoclasts and macrophages. Biomaterials 2014, 35, 9660−9667. (b) Le Nihouannen, D.; Daculsi, G.; Saffarzadeh, A.; Gauthier, O.; Delplace, S.; Pilet, P.; Layrolle, P. Ectopic bone formation by microporous calcium phosphate ceramic particles in sheep muscles. Bone 2005, 36, 1086−93. (22) (a) Akiyama, H. Control of chondrogenesis by the transcription factor Sox9. Mod. Rheumatol. 2008, 18, 213−219. (b) Komori, T. Regulation of osteoblast differentiation by Runx2. Osteoimmunology; Advances in Experimental Medicine and Biology; Springer: Boston, MA, 2010; Vol. 658, pp 43−49. (23) (a) Chen, S.; Gao, M.; Zhou, Z.; Liang, J.; Gong, M.; Dai, X.; Liang, T.; Ye, J.; Wu, G.; Zou, L.; Wang, Y.; Zou, X. Opposite Regulation of Chondrogenesis and Angiogenesis in Cartilage Repair ECM Materials under Hypoxia. J. Mater. Sci. Technol. 2016, 32, 978− 985. (b) Hadjiargyrou, M.; Ahrens, W.; Rubin, C. T. Temporal Expression of the Chondrogenic and Angiogenic Growth Factor CYR61 During Fracture Repair. J. Bone Miner. Res. 2000, 15, 1014− 1023. (24) (a) Yu, W. W.; Qu, L.; Guo, W.; Peng, X. Experimental Determination of the Extinction Coefficient of CdTe, CdSe, and CdS Nanocrystals. Chem. Mater. 2003, 15, 2854−2860. (b) Gude, V.; Das, A.; Chatterjee, T.; Mandal, P. K. Molecular origin of photoluminescence of carbon dots: aggregation-induced orange-red emission. Phys. Chem. Chem. Phys. 2016, 18, 28274−28280.

(c) Hou, S.; Ma, H.; Ji, Y.; Hou, W.; Jia, N. A Calcium Phosphate Nanoparticle-Based Biocarrier for Efficient Cellular Delivery of Antisense Oligodeoxynucleotides. ACS Appl. Mater. Interfaces 2013, 5, 1131−1136. (25) Das, B.; Dadhich, P.; Pal, P.; Dhara, S. Single step synthesized sulfur and nitrogen doped carbon nanodots from whey protein: nanoprobes for longterm cell tracking crossing the barrier of phototoxicity. RSC Adv. 2016, 6, 60794−60805. (26) (a) Wang, B.; Liu, W.; Xing, D.; Li, R.; Lv, C.; Li, Y.; Yan, X.; Ke, Y.; Xu, Y.; Du, Y.; Lin, J. Injectable nanohydroxyapatite-chitosangelatin micro-scaffolds induce regeneration of knee subchondral bone lesions. Sci. Rep. 2017, 7, No. 16709. (b) Martínez-Vázquez, F. J.; Cabañas, M. V.; Paris, J. L.; Lozano, D.; Vallet-Regí, M. Fabrication of novel Si-doped hydroxyapatite/gelatine scaffolds by rapid prototyping for drug delivery and bone regeneration. Acta Biomater. 2015, 15, 200−209.

386


Doping of Carbon Quantum Dots (CDs) in Calcium ... - ACS Publications

Recommend Documents