(-)-Hydroxycitric acid influenced fat metabolism via modulating of

Article Cite This: J. Agric. Food Chem. 2019, 67, 7336−7347

pubs.acs.org/JAFC

(−)-Hydroxycitric Acid Influenced Fat Metabolism via Modulating of Glucose-6-phosphate Isomerase Expression in Chicken Embryos Shengnan Li,†,‡ Zhongmiao Yang,†,‡ Huihui Zhang,†,‡ Mengling Peng,§ and Haitian Ma*,†,‡ †

Downloaded via RUTGERS UNIV on August 8, 2019 at 07:34:00 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

Key Laboratory of Animal Physiology and Biochemistry, College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, China ‡ MOE Joint International Research Laboratory of Animal Health and Food Safety, College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, China § College of Animal Science and Technology, Anhui Agricultural University, Hefei 230036, China ABSTRACT: The current research aimed to explore the impact of (−)-hydroxycitric acid (HCA) on fat metabolism and investigate whether this action of (−)-HCA was associated with modulation of glucose-6-phosphote isomerase (GPI) expression in chicken embryos. We constructed a recombinant plasmid (sh2-GPI) to inhibit GPI expression, and then embryos were treated with (−)-HCA. Results showed that (−)-HCA reduced lipid droplet accumulation, triglyceride content, and lipogenesis factors mRNA level and increased lipolysis factors mRNA expression, while this effect caused by (−)-HCA was markedly reversed when the chicken embryos were pretreated with sh2-GPI. (−)-HCA increased phospho (p)-acetyl-CoA carboxylase, enoyl-CoA hydratase short chain-1, carnitine palmitoyl transferase 1A, p-AMP-activated protein kinase, and peroxisome proliferators-activated receptor α protein expression, and this action of (−)-HCA also dispelled when the chicken embryos were pretreated with sh2-GPI. These data demonstrated that (−)-HCA decreased fat deposition via activation of the AMPK pathway, and the fat-reduction action of (−)-HCA was due to the increasing of GPI expression in chicken embryos. KEYWORDS: fat metabolism, chicken embryos, glucose-6-phosphote isomerase, (−)-hydroxycitric acid

■

INTRODUCTION As a broad and relatively cheap source of dietary protein, broiler farming plays an important role in the composition of the world economy.1 Commercial production of broiler chickens has become a highly industrialized process, and it mainly aims to increase growth rates, which causes broilers’ excessive fat accumulation.2 A recent study certified that a “low-quality diet” is a key factor for humans’ metabolic change and obesity.3 Thus, it is necessary to control fat deposition because it reduces meat quality and brings the risk of lipid metabolism-related disease to consumers.4,5 A series of studies explored ways to control fat metabolism, and dietary supplements with extracted active compounds from plants is regarded as a potential way to inhibit excessive fat accumulation.6 Due to low adversity effects, plant extracts have been used to control fat deposition in animals or humans for many years.7 Previous research showed that (−)-HCA has many biological functions, including decreasing the synthesis of fatty acid and cholesterol level, increasing weight loss, enhancing fat oxidation, or promoting energy expenditure in animals.7,8 Previous research reported that treatment with (−)-HCA increased lipid oxidation through activation of carnitine palmitoyl transferase 1 (CPT-1) and decreased malonyl-CoA production in hepatocytes via reduction of ATP-citrate lyase.9 Acetyl-CoA carboxylase (ACC) catalyzed the reaction to produce malonylCoAm which in return decreased the oxidation of fatty acid by inhibiting of CPT-1.10−12 In broiler chickens, (−)-HCA inhibited fatty acid synthesis via inhibiting NADP-dependent malic enzyme expression and promoting the citric acid cycle.13 In the avian liver, ME1 (malic enzyme) generated NADPH, most of which was used for fatty acid synthase.14 It was found © 2019 American Chemical Society

that there was a direct correlation between the abdominal fat percentage and hepatic ME1 in chicks.15 Our study had found that treatment with (−)-HCA inhibited fat accumulation by inhibiting the expression of FAS (fatty acid synthase) and SREBP-1c (sterol regulatory element binding protein-1c) in broiler chickens.16 FAS is a vital enzyme in regulating the synthesis of fatty acids,17 and SREBP-1c is in charge of governing fatty acid and triglyceride metabolism.18 Although many studies reported that (−)-HCA exerts a key role in controlling fat metabolism, the underlying biochemical mechanisms are still unclear. Supplementation with (−)-HCA promises to alter metabolic pathways due to its structure being similar to citrate. It is reported that the affinity of (−)-HCA to the ATP-citrate lyase was much greater than that of citrate.19 As an ATP-citrate lyase competitive inhibitor,20 (−)-HCA reduced the acetyl-CoA content and then regulated the metabolism of glucose and lipid.7 Our laboratory surprisingly discovered that (−)-HCA significantly increased the protein expression level of GPI (glucose-6phosphote isomerase) in chicken embryos, which also mainly enriched the glucose metabolic pathway.21 GPI plays an important role in gluconeogenesis and glycolysis, it catalyzed the interconversion of fructose-6-phosphate and glucose-6phosphate.22 GPI also can guide the glucose flow into the pentose phosphate pathway to produce NADPH, which is necessary for lipid metabolism.23 In addition to its glycolytic Received: Revised: Accepted: Published: 7336

April 13, 2019 June 10, 2019 June 11, 2019 June 11, 2019 DOI: 10.1021/acs.jafc.9b02330 J. Agric. Food Chem. 2019, 67, 7336−7347

Article

Journal of Agricultural and Food Chemistry Table 1. Primer Sequence of Targeted Genes and β-Actin gene β-actin ACC FAS ME1 CPT1A PPARα SREBP-1c GPI

primer sequences (5′-3′)

orientation

product size (bp)

TGCGTGACATCAAGGAGAAG TGCCAGGGTACATTGTGGTA GTTGTGGTTGGCAGAGCAAG GCACCAAACTTGAGCACCTG TGAAGGACCTTATCGCATTGC GCATGGGAAGCATTTTGTTGT AGCATTACGGTTTAGCATTTCGG CAGGTAGGCACTCATAAGGTTTC GGGTTGCCCTTATCGTCACA TACAACATGGGCTTCCGTCC CAAACCAACCATCCTGACGAT GGAGGTCAGCCATTTTTTGGA GTCGGCGATCCTGAGGAA CTCTTCTGCACGGCCATCTT ATCGCCCAACCAACTCTA GATGATGCCCTGAACGAA

forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse

300

NM_205518

284

NM_205505

96

NM_205155

240

NM_204303

151

NM_001012898

64

NM_001001464

105

NM_204126

259

NM_001006128

manufacturer. After transfection for 48 h, the cells were photographed by fluorescence microscope (Olympus, Japan). Meanwhile, the cells were collected and, according to the mRNA or protein expression of GPI, used to select the best interference efficiency of the recombinant plasmid. Embryos and Treatment. A total of 200 Ross 308 fertilized eggs were purchased from Poultry Breeding Companies (Wuxi, China), and the eggs were divided into eight groups [shNC group, (−)-HCA group, 1 μg sh2-GPI group, 1 μg sh2-GPI + (−)-HCA group, 2 μg sh2-GPI group, 2 μg sh2-GPI + (−)-HCA group, 4 μg sh2-GPI group, and 4 μg sh2-GPI + (−)-HCA group]. The eggs were hatched under conditions of 65% relative humidity at 37 ± 0.5 °C. At 12 days from being hatched, the egg chamber was sterilized, and a recombinant plasmid of shNC or sh2-GPI was injected. Then, the holes were immediately sealed, and continuous incubation was performed for 24 h. At 13 days after being hatched, 1.0 mg per kg of the embryo weight of (−)-HCA or an equal volume of normal saline was used to treat the chicken embryos, and then the chicken embryos were further hatched for another 24 h. After treatment, blood was collected from the allantois vein with a heparinized syringe, and the serum was collected by centrifugation. All serum and livers were fast frozen using liquid nitrogen for further research. H&E Staining. The H&E staining of the livers of the chicken embryos was done according to our recent report.25 Briefly, the livers were fixed, embedded and sectioned, and then photographed using a light microscope (Olympus BX53; Tokyo, Japan). Oil Red O Staining. The method of oil red O staining was based on our recent publication.26 Briefly, the livers were cut into 5 μm sections and dried for 1.5 h at room temperature and fixed in 1% calcium chloride and 4% formaldehyde for 1 h. These sections were treated with 60% isopropanol then stained with oil red O solution and Mayer’s hematoxylin solution. Glycerin gel was used to fix the film on the slide, and the film was photographed under a light microscope. We randomly selected 10 photos from each group to calculate the areas and numbers of fat droplets using a soft of Image-Pro plus. Detection of Lipid Metabolism Related Parameters. The contents of LDL-C, HDL-C, TG, TC, and NEFA in serum and hepatic TG content were detected by the protocols of the manufacturer. Detected Lipid Metabolism-Related Gene Expression. The methods of RNA extraction and reverse transcription were based on our recent publication.25 Briefly, total RNA in livers of chicken embryos were extracted using TRIzol reagent, then the total RNA were reverse transcribed to cDNA. The primer sequences of GPI, ACC (acetyl CoA carboxylase), CPT1A (carnitine palmitoyltransferase-1A), FAS (fatty acid synthase), SREBP-1c (sterol regulatory element binding protein1c), ME1 (malic enzyme), and PPARα (peroxisome proliferatorsactivated receptor α) were designed and synthesized by the TSINGKE

function, GPI can act as a cytokine to stimulate cell proliferation.24 On the basis of these reports, we conjectured that (−)-HCA decreased the fat deposition maybe related to the enhancing of GPI expression in chicken embryos. Thus, the present study first constructed recombinant plasmids (sh2-GPI) and transfected them into chicken embryos, then analyzed the role of GPI on lipid metabolism regulated by (−)-HCA.

■

accession number

MATERIALS AND METHODS

Reagents. (−)-HCA was provided by the U.S. Pharmacopeia Convention (USP, Rockville, WA, USA). A penicillin−streptomycin mixture for cell culture was provided by Sigma (St Louis, MO, USA). Dulbecco’s Modified Eagle Medium (DMEM) and fetal bovine serum (FBS) were provided by Gibco (Paisley, UK). Chicken embryo fibroblast (DF-1) cells were provided by ATCC (Manassas, USA). Lipofectamine 3000 transfection reagent and TRIzol reagent were provided by Invitrogen (Carlsbad, CA, USA). Oil red O solution was obtained from Sigma-Aldrich (St. Louis, MO, USA). The detection kits of high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), triglyceride (TG), total cholesterol (TC), and nonesterified fatty acid (NEFA) were provided by Jiancheng Biotechnology Institution (Nanjing, China). A Superscript II kit was provided by Promega (Madison, WI, USA) Cell Line and Culture. A DMEM medium containing a 1% penicillin−streptomycin mixture and 10% FBS in a humidified atmosphere of 5% CO2 and 95% air at 37 °C was used to culture DF-1 cells. Transfection started at a cell density of 50−75%. Constructed of Anti-GPI shRNA Expression Vectors and Determination of Interference Efficiency. The shRNA sequences of chicken GPI and the control were designed and synthesized by Invitrogen (Shanghai, China): GPI-shRNA2 (forward: 5′-gatccggagaagaatgtgcctgttctccaccagaacaggcacattcttctccttttttg-3′; reverse: 5′aattcaaaaaaggagaagaatgtgcctgttctggtggagaacaggcacattcttctccg-3′), GPIshRNA3 (forward: 5′-gatccgcatgattccctgtgacttcaccacctgaagtcacagggaatcatgctttttg-3′; reverse: 5′-aattcaaaaaagcatgattccctgtgacttcaggtggtgaagtcacagggaatcatgcg-3′), GPI-shRNA5 (forward: 5′gatccgcccaaccaattccatcatgtccaccacatgatggaattggttgggcttttttg-3′; reverse: 5′-aattcaaaaaagcccaaccaattccatcatgtggtggacatgatggaattggttgggcg3′), and NC-shRNA (forward: 5′-gatccgcacacacactctctgtctaaccaccttagacagagagtgtgtgtgcttttttg-3′; reverse: 5′-aattcaaaaaagcacacacactctctgtctaaggtggttagacagagagtgtgtgtgcg-3′). Construction of the recombinant plasmid was accomplished by integration of NC-shRNA or GPI-shRNA into a PLVX-shRNA2 vector (contained the Zoanthus sp. green fluorescent protein), and which were respectively transferred into DF-1 cells with NC-shRNA (shNC), GPI-shRNA2 (sh2-GPI), GPI-shRNA3 (sh3-GPI), and GPI-shRNA5 (sh5-GPI), using the Lipofectamine 3000 transfection reagent based on the protocol of the 7337

DOI: 10.1021/acs.jafc.9b02330 J. Agric. Food Chem. 2019, 67, 7336−7347

Article

Journal of Agricultural and Food Chemistry

Figure 1. Transfection efficiency of the recombinant plasmid in DF1 cells (figure 40×). DF-1 cells transfected with shRNA-NC, GPI-shRNA2, GPIshRNA3, and GPI-shRNA5 were named shNC, sh2-GPI, sh3-GPI, and sh5-GPI, respectively. After transfection for 48 h, the expression of Zoanthus sp. green fluorescent protein (ZsGreen1) was observed under a fluorescence microscope to confirm the success of transfection. (A) Transfected with shNC. (B) Transfected with sh2-GPI. (C) Transfected with sh3-GPI. (D) Transfected with sh5-GPI. Company (Nanjing, China; see also Table 1). The 2−ΔΔCT method was used to analyze the relative mRNA levels. Western Blotting. Extraction of proteins from the livers of chicken embryos or DF-1 cells and BCA assay kits were used to determine the protein concentration. The samples were separated by electrophoresis and transferred to PVDF membranes (Millipore, Bedford, MA, USA). After 3 h of incubation using 5% BSA, the PVDF membranes were treated overnight with rabbit anti-ACCα (Cell Signaling Technology, Boston, MA, USA), anti-GAPDH and anti-p-ACCα (Cell Signaling Technology), anti-GPI (Bioworld Technology, Saint Louis Park, MN, USA), anti-AMPKα (Sangon Biotech, Shanghai, China), anti-pAMPKα (Sangon Biotech), anti-PPARα (Bio Basic Canada Inc., Tacoma, Washington, USA), anti-CPT1A (Bio Basic Canada Inc.), and anti-ECHS1 antibodies (Bio Basic Canada Inc.). Then, the membranes were treated with goat antirabbit IgG (Bioworld Technology, Saint Louis, MN, USA) for 2 h at room temperature. Proteins abundance were standard with GAPDH. Animal Research Statement. All test procedures in chicken embryos and all other procedures were strictly implemented according to the Management of Laboratory Animals center of Nanjing Agricultural University. The protocol was approved by the Institutional Animal Welfare and Ethics Committee of the Nanjing Agricultural University (project number: IACUC2018015). Statistical Analysis. The data were presented with means ± SD, and they were analyzed using the ANOVA method followed by Dunnett’s test (Graph Pad Software, San Diego, CA, USA), and the significant differences were considered at P < 0.05.

GPI mRNA level in DF-1 cells (P < 0.05; Figure 2A). However, treatment with sh3-GPI made no significant difference in the GPI protein expression level in DF-1 cells (P > 0.05; Figure 2B). Due to the significant effect of the GPI knockdown effect in DF1 cells, sh2-GPI was chosen for subsequent experiments. Knockdown of GPI Expression in Chicken Embryos Treated With (−)-HCA. In chicken embryos, transfection with different doses of sh2-GPI markedly reduced the expression level of GPI mRNA/protein when compared with shNC treatment (P < 0.01; Figure 2C and D). In chicken embryos, (−)-HCA treatment evidently enhanced the GPI mRNA/ protein expression level (P < 0.05). Meanwhile, pre-transfection with sh2-GPI eliminated the increasing effect of (−)-HCA in chicken embryos in a dose-dependent manner (P > 0.01; Figure 2C and D). Histopathological examination results showed that no morphological abnormality was observed on hepatocytes, indicating that treatment with sh2-GPI or (−)-HCA has no side effect on the chicken’s embryonic development (Figure 3). In chicken embryos, in order to highlight the role of sh2-GPI in (−)-HCA regulation of lipids, treatment with 4 μg of sh2-GPI was selected for the subsequent analysis. Effect of GPI Knockdown on Lipid Droplets Deposition Regulated by (−)-HCA in Chicken Embryos. Oil red O (Figure 4A) analysis indicated that treatment with (−)-HCA obviously decreased lipid droplet accumulation, which includes the area and counts of fat droplets (P < 0.01; Figure 4B and C), while sh2-GPI treatment markedly enhanced the accumulation of lipid droplets in chicken embryo livers (P < 0.01; Figure 4B and C). Importantly, sh2-GPI treatment significantly reversed the inhibition effect of (−)-HCA on lipid droplet accumulation in chicken embryos when compared with (−)-HCA alone treatment (P < 0.01; Figure 4B and C). In addition, the triglyceride content in liver and serum was markedly reduced

■

RESULTS Knockdown of GPI Expression in DF-1 Cells. As shown in Figure 1, three shRNAs were successfully transfected into DF1 cells, and they had a similar transfection efficiency. The cells transfected with sh2-GPI robustly decreased the mRNA/protein expression levels of GPI (P < 0.05; Figure 2A and B). Moreover, our data showed that transfection with sh5-GPI decreased the 7338


Article


Figure 2. Knockdown of GPI expression using the PLVX-shRNA2 plamid to deliver shRNA. (A) GPI mRNA level in DF-1 cells transfected with shNC or GPI-shRNA. (B) GPI protein level in DF-1 cells transfected with shNC or GPI-shRNA. Chicken embryos were microinjected with 25 μL of lipofectamine without or with 1, 2, or 4 μg of anti-GPI shRNA expression vectors for 24 h, then injected with (−)-HCA at a concentration of 1.0 mg per kg of the embryo for another 24 h. (C) GPI mRNA level in liver of chicken embryos transfected with different doses of GPI-shRNA or injected with (−)-HCA. (D) GPI protein level in liver of chicken embryos transfected with different doses of GPI-shRNA or injected with (−)-HCA. Values are means ± SD, n = 6. **P < 0.01 and *P < 0.05, relative to shNC group; ##P < 0.01, relative to (−)-HCA alone treatment group; NS, indicated no difference.

after (−)-HCA treatment (P < 0.05), and sh2-GPI treatment markedly enhanced the triglyceride content (P < 0.05). Similarly, sh2-GPI treatment dispelled the decrease of triglyceride content led by (−)-HCA in chicken embryos (P < 0.01; Figure 5A and B). In chicken embryos, the contents of TC, NEFA, and HDL-C had no significant difference after (−)-HCA or sh2-GPI treatment (P > 0.05; Figure 5C−E). Compared with (−)-HCA alone treatment, sh2-GPI pretreatment significantly reduced TC content (P < 0.01; Figure 5D). In addition, in chicken embryos, sh2-GPI treatment revised the decreasing of LDL-C content caused by (−)-HCA (P < 0.01; Figure 5F). Impact of GPI Knockdown on Related Factors Expression of Lipid Metabolism. (−)-HCA treatment markedly decreased the mRNA expression levels of FAS, ME1, ACC, SREBP-1c, while it increased the mRNA levels of PPARα and CPT1A (P < 0.05; Figure 6). In chicken embryos, compared with shNC treatment, sh2-GPI treatment increased the mRNA levels of FAS, ME1, ACC, SREBP-1c and decreased the mRNA levels of CPT1A and PPARα (P < 0.05; Figure 6). In addition, in

chicken embryos, the changes of lipid metabolism related factors mRNA level led by (−)-HCA were markedly reversed with pretreatment with sh2-GPI (P < 0.01; Figure 6). Impact of GPI Knockdown on AMPK Signaling Activation Caused by (−)-HCA in Chicken Embryos. Compared with shNC treatment, the p-AMPK protein level was enhanced after (−)-HCA treatment (P < 0.05; Figure 7B), while sh2-GPI treatment markedly reduced the p-AMPK protein level in livers of chicken embryos (P < 0.05; Figure 7B). Meanwhile, compared with shNC treatment, (−)-HCA treatment increased p-ACC, CPT1A, PPARα, and ECHS1 protein levels (P < 0.05; Figure 7C−F), and sh2-GPI treatment decreased p-ACC, PPARα, CPT1A, and ECHS1 protein levels (P < 0.05; Figure 7C−F). In chicken embryos, the increasing of p-AMPK protein expression caused by (−)-HCA was completely inhibited by pretreatment with sh2-GPI (P < 0.01; Figure 7B). In chicken embryos, the p-ACC, PPARα, CPT1A, and ECHS1 protein level enhancement caused by (−)-HCA was also reversed when pretreated with sh2-GPI (P < 0.05; Figure 7C−F). 7339


Article


Figure 3. Histopathological examination of livers in chicken embryos tranfected with sh2-GPI or injected with (−)-HCA. (A) shNC group. (B) (−)-HCA treatment group. (C) 1 μg sh2-GPI treatment group. (D) 1 μg sh2-GPI + (−)-HCA treatment group. (E) 2 μg sh2-GPI treatment group. (F) 2 μg sh2-GPI + (−)-HCA treatment group. (G) 4 μg sh2-GPI treatment group. (H) 4 μg sh2-GPI + (−)-HCA treatment group.

■

DISCUSSION Loss of function is the most effective method for functional analysis of a target gene, thus we constructed three recombinant plasmids and transfected them into chicken embryo fibroblast (DF-1) cells to verify the knockdown efficiency on GPI expression. Among three recombinant plasmids, transfection with sh2-GPI significantly decreased the GPI mRNA/protein expression level in DF-1 cells, which showed that sh2-GPI had the best knockdown efficiency. A significant decrease of target gene expression in chick embryos with liposomal mediated gene transfer is reported .27,28 Allantoic sac injection has been shown to be an efficient transgene pathway, which is consistent with the absorption of materials from allantoic fluid,29 and the gene expression lasted for at least 96 h after injection of plasmid vectors.30 In this study, the recombinant lentiviral vector of anti-

GPI expression was injected into chicken embryos, and the result showed that the GPI expression level was significantly inhibited in a dose-dependent manner. Furthermore, no morphological abnormality was observed on hepatocytes in chicken embryos transfected with sh2-GPI. A previous study also reported that the PLVX-shRNA2 plasmid vector could not damage the cell. These results indicated that in chicken embryos, GPI gene expression had been blocked, which provided a foundation for subsequent investigation of the role of GPI in (−)-HCA regulated lipid metabolism. In the current study, the triglyceride contents in serum and liver were decreased after treatment with (−)-HCA. The effect of (−)-HCA’s suppression of fat deposition in humans31 and animals32 has been known for many years. In addition, as mainly bioactive substances in Garcinia cambogia, it has been reported 7340


Article


Figure 4. Effect of (−)-HCA on lipid droplet accumaltion in the liver of chicken embryos pre-transfected with sh2-GPI. (A) Representative photomicrographs of liver stained with oil red O. (B) Counts of lipid droplets. (C) Total area of droplets. Values are means ± SD, n = 6. **P < 0.01, relative to shNC group; ##P < 0.01, relative to (−)-HCA alone treatment group; NS, indicated no difference.

monophosphate (cAMP) is an integral constituent of the kinase cascade that links many extracellular signals in order to control a number of cellular functions. The increasing of the cAMP level can activate AMPK and then exert important fuctions.37 The present study revealed that treatment with (−)-HCA increased the p-AMPK protein level in chicken embryos. It has been reported that activation of AMPK usually inhibits fatty acid synthesis and accelerates fatty acid catabolism.38 A number of lipid metabolism factors are the downstream factors of AMPK, such as PPARα and SREBP-1c.39 PPARα is an important nuclear receptor in regulating fatty acid catabolism gene expression, such as that of CPT-1.40 The present results showed that chicken embryos treated with (−)-HCA signifcantly increased the PPARα and CPT1A mRNA level. A previous study also reported that (−)-HCA increases fatty acid oxidation via activating CPT-1 activity.41 In addition, HCA-SX treatment resulted in the enhancing of hormone-sensitive lipase, PPARα, and hypoxia-inducible factor-1 expression level in human adipocytes.42 Improtantly, our data showed that in chicken embryos, pretransfection with sh2-GPI had reserved the enhancement of CPT1A and PPARα mRNA level caused by (−)-HCA. Fat deposition is a complex process that relies on a balance between fatty acid synthesis and lipolysis in the body. Our data revealed that (−)-HCA markedly reduced the mRNA expression level of ME1, ACC, FAS, and SREBP-1c in chicken embryos. In the liver, SREBP-1c functions as a regulator of fatty acid synthesis, and it can directly regulate lipogenesis-related gene transcription, including that of ACC and FAS enzymes.43

that (−)-HCA can reduce lipid content in mice under a high-fat diet33 or in 3T3-L1 cells.34 Our previous study revealed that abdominal fat deposition was decreased after treatment with (−)-HCA in broiler chickens.16 Usually, accumulation of lipid droplet was considered as a key indicator for evaluating lipid metabolism in the body.35 Our present study indicated that in the liver of chicken embryos, the total area and counts of lipid droplets were significantly decreased after treatment with (−)-HCA. A previous study indicated that (−)-HCA reduced the synthesis of fatty acid via reducing the acetyl-CoA supply in primary chicken hepatocytes36 or broiler chickens.13 It has been widely proved that glucose metabolism is closely related to lipid metabolism in the body, and acetyl-CoA is a key factor in the transformation of glycolipid metabolites. Importantly, our recently surprising discovery was that GPI protein level was markedly enhanced in chicken embryos after treatment with (−)-HCA.21 GPI is an essential enzyme in glycolytic and gluconeogenic processes that catalyzes reversible isomerization.22 This study indicated that in chicken embryos, pretransfection with sh2-GPI had reversed the suppressing effect of (−)-HCA on lipid droplet and triglyceride contents. On the basis of these data, we hypothesized that (−)-HCA decreased fat deposition in chicken embryos through increasing the GPI expression. Our recent study showed that (−)-HCA treatment accelerated gluconeogenesis and inhibited glycolysis25 and increased the cAMP content in the livers of chicken embryos (unpublished data). It is well-known that cyclic adenosine 3′,5′7341


Article


Figure 5. Effect of (−)-HCA on lipid metabolism related parameters in chicken embryos pretransfected with sh2-GPI. (A) Serum triglyceride (TG) content. (B) TG content in liver. (C) Nonesterified fatty (NEFA) content in serum. (D) Serum total cholesterol (TC) content. (E) High-density lipoprotein cholesterol (HDL-C) content in serum. (F) Low-density lipoprotein cholesterol (LDL-C) content in serum. Values are means ± SD, n = 6. **P < 0.01 and *P < 0.05, relative to shNC group; ##P < 0.01, relative to (−)-HCA alone treatment group; NS, indicated no difference.

In addition, ME1 catalyzes the oxidative decarboxylation of malate and generates nicotinamide adenine dinucleotide phosphate (NADPH). In avian species, NADPH used in fatty acid synthesis is mainly produced by malic enzymes.44 In chicken embryos, pretransfection with sh2-GPI removed the decrease of ME1, ACC, FAS, and SREBP-1c mRNA levels caused by (−)-HCA. Our previous research had indicated that (−)-HCA inhibited lipid synthesis mRNA expression and led to the inhibition of fat deposition in chickens. Thus, these resutls implied that in chicken embryos, the fat reduction action of

(−)-HCA might be related to the increasing of GPI expression level. This study revealed that in chicken embryos, (−)-HCA treatment significantly increased p-AMPK protein level, while pretransfection with sh2-GPI had prevented the increasing of pAMPK protein level. Consistent with the increasing of p-AMPK, in chicken embryos, treatment with (−)-HCA increased p-ACC, CPT1A, ECHS1, and PPARα protein levels. A previous study reported that activation of AMPK can increase the p-ACC protein expression level.45 Our recent study also certified that (−)-HCA treatment increased the expression level of p-ACC 7342


Article


Figure 6. Effect of (−)-HCA on lipid metabolism related gene mRNA level in chicken embryos pretransfected with sh2-GPI. (A) Malic enzyme (ME1) mRNA level. (B) Acetyl CoA carboxylase (ACC) mRNA level. (C) Fatty acid synthase (FAS) mRNA level. (D) Sterol regulatory element binding protein-1c (SREBP-1c) mRNA level. (E) Carnitine palmitoyl transferase-1A (CPT1A). (F) Peroxisome proliferator-activated receptor α (PPARα) mRNA level. Values are means ± SD, n = 6. **P < 0.01 and *P < 0.05, relative to shNC group; ##P < 0.01, relative to (−)-HCA alone treatment group; NS, indicated no difference. 7343


Article


Figure 7. Effect of (−)-HCA on the AMPK signaling pathway in chicken embryos pretransfected with sh2-GPI. (A) Immunoblot of AMPK, p-AMPK, ACC1α, p-ACC1α, PPARα, CPT1A, and enoyl-CoA hydratase short chain 1 (ECHS1) protein expression; GAPDH was used as a loading control. (B) p-AMPK/AMPK protein level. (C) p-ACC1α/ACC1α protein level. (D) PPARα protein level. (E) CPT1A protein level. (F) ECHS1 protein level. Values are means ± SD, n = 6. **P < 0.01 and *P < 0.05, relative to shNC group; ##P < 0.01 and #P < 0.05, relative to (−)-HCA alone treatment group; NS, indicated no difference.

protein; this result revealed that (−)-HCA reduced fat deposition by inhibiting the activity of ACC.46 PPARα is the downstream factor of AMPK, so activation of AMPK can increase the PPARα protein expression level in HepG2 cells.39

Our previous study had reported that in livers of chicken embryos, PPARα expression level was significantly up-regulated after treatment with (−)-HCA.26 ECHS1 plays a crucial role in the second step of fatty acid β-oxidation in the body.47 Similarly, 7344


Article


Figure 8. Schematic diagram of the possible mechanism of (−)-HCA’s regulation on fat deposition via modulating of GPI expression in chicken embryos. (−)-HCA treatment decreased lipid deposition via activation of the AMPK pathway, which led to the decreasing of lipogenesis related gene expression and enhancing of lipolysis related gene expression; however, the effect of (−)-HCA on lipid droplet accumulation and lipid metabolism related factor expression levels was reversed in chicken embryos pretransfected with sh2-GPI. These results indicated that the fat-reduction action of (−)-HCA might be related to its increasing the GPI expression in chicken embryos.

Research Funds for the Central Universities (no. JCQY201906; no. KYDZ201901), and Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

in chicken embryos, pretreatment with sh2-GPI completely reversed the increasing of p-ACC, CPT1A, ECHS1, and PPARα protein levels. Our recently study certified that (−)-HCA accelerated glucose metabolism, which eventually resulted in the reduction of fat accumulation.36 Considering the role of GPI in glycolysis, we deemed that in chicken embryos, (−)-HCA reduced fat accumulation via activating the AMPK, and this action might be achieved by increasing GPI expression, which then affected the glucose metabolism. In conclusion, our data showed that treatment with (−)-HCA decreased lipid deposition via activation of the AMPK pathway, which led to the decreasing of lipogenesis related gene expression and enhancing of lipolysis related gene expression in chicken embryos. Importantly, in chicken embryos, pretransfection with sh2-GPI had reversed the effect of (−)-HCA on lipid droplet accumulation and lipid metabolism related factor expression levels. The results revealed that the fatreduction action of (−)-HCA might be related to the increasing of GPI expression in chicken embryos (Figure 8). The present data will provide a new viewpoint to understand the mechanism of fat reduction by (−)-HCA in animals and humans.

■

Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS USED (−)-HCA, (−)-hydroxycitric acid; DF-1 cells, chicken embryo fibroblast cells; ZsGreen1, Zoanthus sp. green fluorescent protein; DMEM, Dulbecco’s Modified Eagle Medium; GPI, glucose-6-phosphote isomerase; FBS, fetal bovine serum; ACC, acetyl CoA carboxylase; CPT1A, carnitine palmitoyl transferase 1A; TC, total cholesterol; FAS, fatty acid synthase; shRNA, short hairpin RNA; AMPK, adenosine 5′-monophosphate (AMP)-activated protein kinase; ECHS1, enoyl-CoA hydratase short chain-1; HDL-C, high-density lipoprotein cholesterol; ME1, malic enzyme; LDL-C, low-density lipoprotein cholesterol; PPARα, peroxisome proliferators-activated receptor α; NEFA, nonesterified fatty acid; SREBP-1c, sterol regulatory element binding protein-1c; TG, triglyceride; PVDF, polyvinylidene fluoride

■

AUTHOR INFORMATION

Corresponding Author

*Tel.: (+86)25-8439 6763. Fax: (+86)25-8439 8669. E-mail: [email protected].

REFERENCES

(1) Malley, T. J.; Butts, J.; Wiedmann, M. Seek and destroy process: Listeria monocytogenes process controls in the ready-to-eat meat and poultry industry. J. Food Prot. 2015, 78, 436−445. (2) Mallard, J.; Douaire, M. Strategies of selection for leanness in meat production. In Leanness in Domestic Birds: Genetic, Metabolic, and Hormonal Aspects; Leclercq, B., Whitehead, C. C., Eds.; Butterworths, Oxford, UK, 1988; pp 3−23. (3) Balaji, M.; Ganjayi, M. S.; Hanuma Kumar, G. E.; Parim, B. N.; Mopuri, R.; Dasari, S. A review on possible therapeutic targets to contain obesity: The role of phytochemicals. Obes. Res. Clin. Pract. 2016, 10, 363−380. (4) Ji, B.; Ernest, B.; Gooding, J. R; Das, S.; Saxton, A. M; Simon, J.; Dupont, J.; Metayer-Coustard, S.; Campagna, S. R; Voy, B. H Transcriptomic and metabolomic profiling of chicken adipose tissue

ORCID

Haitian Ma: 0000-0002-6706-0580 Author Contributions

H.M. conceived this study. S.L. executed the experiments. M.P., H.Z., and Z.Y. collected the sample. S.L. and H.M. wrote this manuscript. All authors approved the final version of the manuscript. Funding

This work was supported by the National Natural Science Foundation of China (no. 31572483), the Fundamental 7345


Article

Journal of Agricultural and Food Chemistry in response to insulin neutralization and fasting. BMC Genomics. 2012, 13, 441. (5) Ahima, R. S. Digging deeper into obesity. J. Clin. Invest. 2011, 121, 2076−2079. (6) Wang, L.; Waltenberger, B.; Pferschy-Wenzig, E. M.; Blunder, M.; Liu, X.; Malainer, C.; Blazevic, T.; Schwaiger, S.; Rollinger, J. M.; Heiss, E. H.; Schuster, D.; Kopp, B.; Bauer, R.; Stuppner, H.; Dirsch, V. M.; Atanasov, A. G. Natural product agonists of peroxisome proliferatoractivated receptor gamma (PPARgamma): a review. Biochem. Pharmacol. 2014, 92, 73−89. (7) Chuah, L. O.; Ho, W. Y.; Beh, B. K.; Yeap, S. K. Updates on Antiobesity Effect of Garcinia Origin (−)-HCA. Evid-Based. Compl. Alt. 2013, 2013, 751658. (8) van Loon, L. J.; van Rooijen, J. J.; Niesen, B.; Verhagen, H.; Saris, W. H.; Wagenmakers, A. J. Effects of acute (−)-hydroxycitrate supplementation on substrate metabolism at rest and during exercise in humans. Am. J. Clin. Nutr. 2000, 72, 1445−1450. (9) Jena, B. S.; Jayaprakasha, G. K.; Singh, R. P.; Sakariah, K. K. Chemistry and biochemistry of (−)-hydroxycitric acid from Garcinia. J. Agric. Food Chem. 2002, 50, 10−22. (10) Mcgarry, J. D.; Brown, N. F. The Mitochondrial Carnitine Palmitoyltransferase SystemFrom Concept to Molecular Analysis. FEBS J. 2010, 244, 1−14. (11) Rasmussen, B. B.; Holmbäck, U. C.; Volpi, E.; Morioliondore, B.; Paddonjones, D.; Wolfe, R. R. Malonyl coenzyme A and the regulation of functional carnitine palmitoyltransferase-1 activity and fat oxidation in human skeletal muscle. J. Clin. Invest. 2002, 110, 1687−1693. (12) Kim, K. H. Regulation of mammalian acetyl-coenzyme A carboxylase. Annu. Rev. Nutr. 1997, 17, 77−99. (13) Peng, M.; Han, J.; Li, L.; Ma, H. Suppression of fat deposition in broiler chickens by (−)-hydroxycitric acid supplementation: A proteomics perspective. Sci. Rep. 2016, 6, 32580. (14) Hillgartner, F. B.; Salati, L. M.; Goodridge, A. G. Physiological and molecular mechanisms involved in nutritional regulation of fatty acid synthesis. Physiol. Rev. 1995, 75, 47−76. (15) Morris, S. M.; Winberry, L. K.; Fisch, J. E.; Back, D. W.; Goodridge, A. G. Developmental and nutritional regulation of the messenger RNAs for fatty acid synthase, malic enzyme and albumin in the livers of embryonic and newly-hatched chicks. Mol. Cell. Biochem. 1984, 64, 63−68. (16) Han, J.; Li, L.; Wang, D.; Ma, H. (−)-Hydroxycitric acid reduced fat deposition via regulating lipid metabolism-related gene expression in broiler chickens. Lipids Health Dis. 2016, 15 (1), 37. (17) Munoz, G.; Ovilo, C.; Noguera, J. L.; Sanchez, A.; Rodriguez, C.; Silio, L. Assignment of the fatty acid synthase (FASN) gene to pig chromosome 12 by physical and linkage mapping. Anim. Genet. 2003, 34, 234−235. (18) Sato, R. Sterol metabolism and SREBP activation. Arch. Biochem. Biophys. 2010, 501, 177−181. (19) Kim, Y. J.; Kim, K. Y.; Kim, M. S.; Lee, J. H.; Lee, K. P.; Park, T. A mixture of the aqueous extract of Garcinia cambogia, soy peptide and lcarnitine reduces the accumulation of visceral fat mass in rats rendered obese by a high fat diet. Genes Nutr. 2008, 2, 353−358. (20) Stallings, W. C.; Blount, J. F.; Srere, P. A.; Glusker, J. P. Structural studies of hydroxycitrates and their relevance to certain enzymatic mechanisms. Arch. Biochem. Biophys. 1979, 193, 431−448. (21) Peng, M.; He, Q.; Li, S.; Li, L.; Ma, H. Integrated analysis of proteomics-delineated and metabolomics-delineated hepatic metabolic responses to (−)-hydroxycitric acid in chick embryos. J. Cell. Biochem. 2019, 120, 1258. (22) Dong, X.; Tang, H.; Hess, K. R.; Abbruzzese, J. L.; Li, D. Glucose metabolism gene polymorphisms and clinical outcome in pancreatic cancer. Cancer 2011, 117, 480−491. (23) Tong, X.; Zhao, F.; Thompson, C. B. The molecular determinants of de novo nucleotide biosynthesis in cancer cells. Curr. Opin. Curr. Opin. Genet. Dev. 2009, 19, 32−37. (24) Zong, M.; Lu, T.; Fan, S.; Zhang, H.; Gong, R.; Sun, L.; Fu, Z.; Fan, L. Glucose-6-phosphate isomerase promotes the proliferation and

inhibits the apoptosis in fibroblast-like synoviocytes in rheumatoid arthritis. Arthrit. Res. Ther. 2015, 17, 100. (25) Li, S.; Yang, Z.; Zhang, H.; Peng, M.; Ma, H. Potential role of ALDH3A2 on the lipid and glucose metabolism regulated by (−)-hydroxycitric acid in chicken embryos. Anim Sci. J. 2019, DOI: 10.1111/asj.13225. (26) Peng, M.; Li, L.; Yu, L.; Ge, C.; Ma, H. Effects of (−)-hydroxycitric acid on lipid droplet accumulation in chicken embryos. Anim. Sci. J. 2018, 89, 237−249. (27) Itasaki, N.; Bel-Vialar, S.; Krumlauf, R. ’Shocking’ developments in chick embryology: electroporation and in ovo gene expression. Nat. Cell Biol. 1999, 1, E203−207. (28) Pekarik, V.; Bourikas, D.; Miglino, N.; Joset, P.; Preiswerk, S.; Stoeckli, E. T. Screening for gene function in chicken embryo using RNAi and electroporation. Nat. Biotechnol. 2003, 21, 93−96. (29) ten Busch, M.; Milakofsky, L.; Hare, T.; Nibbio, B.; Epple, A. Regulation of substances in allantoic and amniotic fluid of the chicken embryo. Comp. Biochem. Physiol. A Physiol. 1997, 116, 131−136. (30) McDonnell, K.; Bowden, E. T.; Cabal-Manzano, R.; Hoxter, B.; Riegel, A. T.; Wellstein, A. Vascular leakage in chick embryos after expression of a secreted binding protein for fibroblast growth factors. Lab. Invest. 2005, 85, 747−755. (31) Vasques, C. A.; Schneider, R.; Klein-Junior, L. C.; Falavigna, A.; Piazza, I.; Rossetto, S. Hypolipemic effect of Garcinia cambogia in obese women. Phytother. Res. 2014, 28, 887−891. (32) Sullivan, A. C.; Triscari, J.; Spiegel, J. E. Metabolic regulation as a control for lipid disorders. II. Influence of (–)-hydroxycitrate on genetically and experimentally induced hypertriglyceridemia in the rat. Am. J. Clin. Nutr. 1977, 30, 777−884. (33) Kim, Y. J.; Choi, M. S.; Park, Y. B.; Kim, S. R.; Lee, M. K.; Jung, U. J. Garcinia Cambogia attenuates diet-induced adiposity but exacerbates hepatic collagen accumulation and inflammation. World J. Gastroenterol. 2013, 19, 4689−4701. (34) Hasegawa, N. Garcinia extract inhibits lipid droplet accumulation without affecting adipose conversion in 3T3-L1 cells. Phytother. Res. 2001, 15, 172−173. (35) Mehlem, A.; Hagberg, C. E.; Muhl, L.; Eriksson, U.; Falkevall, A. Imaging of neutral lipids by oil red O for analyzing the metabolic status in health and disease. Nat. Protoc. 2013, 8, 1149−1154. (36) Li, L.; Peng, M.; Ge, C.; Yu, L.; Ma, H. (−)-Hydroxycitric Acid Reduced Lipid Droplets Accumulation Via Decreasing Acetyl-Coa Supply and Accelerating Energy Metabolism in Cultured Primary Chicken Hepatocytes. Cell. Physiol. Biochem. 2017, 43, 812−831. (37) De Rooij, J.; Zwartkruis, F. J.; Verheijen, M. H.; Cool, R. H.; Nijman, S. M.; Wittinghofer, A.; Bos, J. L. Epac is a Rap1 guaninenucleotide-exchange factor directly activated by cyclic AMP. Nature 1998, 396, 474−477. (38) Madiraju, A. K.; Alves, T.; Zhao, X.; Cline, G. W.; Zhang, D.; Bhanot, S.; Samuel, V. T.; Kibbey, R. G.; Shulman, G. I. Argininosuccinate synthetase regulates hepatic AMPK linking protein catabolism and ureagenesis to hepatic lipid metabolism. Proc. Natl. Acad. Sci. U. S. A. 2016, 113, E3423−3430. (39) Wu, C.; Luan, H.; Wang, S.; Zhang, X.; Wang, R.; Jin, L.; Guo, P.; Chen, X. Modulation of lipogenesis and glucose consumption in HepG2 cells and C2C12 myotubes by sophoricoside. Molecules 2013, 18, 15624−15635. (40) Vega, R. B.; Huss, J. M.; Kelly, D. P. The coactivator PGC-1 cooperates with peroxisome proliferator-activated receptor alpha in transcriptional control of nuclear genes encoding mitochondrial fatty acid oxidation enzymes. Mol. Cell. Biol. 2000, 20, 1868−1876. (41) Ishihara, K.; Oyaizu, S.; Onuki, K.; Lim, K.; Fushiki, T. Chronic (−)-hydroxycitrate administration spares carbohydrate utilization and promotes lipid oxidation during exercise in mice. J. Nutr. 2000, 130, 2990−2995. (42) Roy, S.; Rink, C.; Khanna, S.; Phillips, C.; Bagchi, D.; Bagchi, M.; Sen, C. K. Body weight and abdominal fat gene expression profile in response to a novel hydroxycitric acid-based dietary supplement. Gene Expression 2003, 11, 251−262. 7346


Article

Journal of Agricultural and Food Chemistry (43) Knight, B. L.; Hebbachi, A.; Hauton, D.; Brown, A. M.; Wiggins, D.; Patel, D. D.; Gibbons, G. F. A role for PPARalpha in the control of SREBP activity and lipid synthesis in the liver. Biochem. J. 2005, 389, 413−421. (44) Hillgartner, F. B.; Salati, L. M.; Goodridge, A. G. Physiological and molecular mechanisms involved in nutritional regulation of fatty acid synthesis. Physiol. Rev. 1995, 75 (1), 47−76. (45) Ha, J.; Daniel, S.; Broyles, S. S.; Kim, K. H. Critical phosphorylation sites for acetyl-CoA carboxylase activity. J. Biol. Chem. 1994, 269, 22162−22168. (46) Li, L.; Zhang, H.; Yao, Y.; Yang, Z.; Ma, H. (−)-Hydroxycitric Acid Suppresses Lipid Droplet Accumulation and Accelerates Energy Metabolism via Activation of the Adiponectin-AMPK Signaling Pathway in Broiler Chickens. J. Agric. Food Chem. 2019, 67, 3188− 3197. (47) Chang, Y.; Wang, S. X.; Wang, Y. B.; Zhou, J.; Li, W. H.; Wang, N.; Fang, D. F.; Li, H. Y.; Li, A. L.; Zhang, X. M.; Zhang, W. N. ECHS1 interacts with STAT3 and negatively regulates STAT3 signaling. FEBS Lett. 2013, 587, 607−613.

7347


(-)-Hydroxycitric acid influenced fat metabolism via modulating of

Recommend Documents