Article pubs.acs.org/JAFC
6‑Shogaol, a Major Compound in Ginger, Induces Aryl Hydrocarbon Receptor-Mediated Transcriptional Activity and Gene Expression Kazutaka Yoshida,*,† Hideo Satsu,‡ Ayano Mikubo,‡ Haru Ogiwara,‡ Takafumi Yakabe,† Takahiro Inakuma,§ and Makoto Shimizu‡ †
Research & Development Division, Kagome Co., Ltd., 17 Nishitomiyama, Nasushiobara 329-2762, Japan Department of Applied Biological Chemistry, Graduate School of Agricultural and Life Science, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan § Faculty of Contemporary Human Life Science, Department of Food and Nutrition, Tezukayama University, 3-1-3 Gakuenminami, Nara 631-8585, Japan ‡
ABSTRACT: Xenobiotics are usually detoxified by drug-metabolizing enzymes and excreted from the body. The expression of many of drug-metabolizing enzymes is regulated by the aryl hydrocarbon receptor (AHR). Some substances in vegetables have the potential to be AHR ligands. To search for vegetable components that exhibit AHR-mediated transcriptional activity, we assessed the activity of vegetable extracts and identified the active compounds using the previously established stable AHRresponsive HepG2 cell line. Among the hot water extracts of vegetables, the highest activity was found in ginger. The ethyl acetate fraction of the ginger hot water extract remarkably induced AHR-mediated transcriptional activity, and the major active compound was found to be 6-shogaol. Subsequently, the mRNA levels of AHR-targeting drug-metabolizing enzymes (CYP1A1, UGT1A1, and ABCG 2) and the protein level of CYP1A1 in HepG2 cells were shown to be increased by 6-shogaol. This is the first report that 6-shogaol can regulate the expression of detoxification enzymes by AHR activation. KEYWORDS: aryl hydrocarbon receptor (AHR), luciferase assay, ginger, 6-shogaol, 6-gingerol
■
INTRODUCTION The human body is exposed to a wide variety of xenobiotics in one’s lifetime, from food components to environmental toxins to pharmaceuticals; it has developed complex enzymatic mechanisms to detoxify these substances. Lipophilic xenobiotics are usually metabolized into more hydrophilic forms by drug-metabolizing enzymes, mainly in the liver, and excreted from the body. The metabolism of xenobiotics is commonly broken down into three systems: phase I, II, and III systems.1,2 The phase I system is an oxidative process and is mainly mediated by the cytochrome P450 (CYP) supergene family. As a consequence of this step in the detoxification, reactive molecules, which may be more toxic than the parent molecule, are produced. In the phase II system, activated hydrophobic xenobiotics are converted into hydrophilic forms via conjugation reactions with glucuronide, sulfate, or glutathione. The phase II system is composed of conjugation enzymes such as glutathione-S-transferases (GSTs), sulfotransferases (SULTs), and uridine diphosphate glucuronosyltransferases (UGTs). The phase III system is composed of more than 40 different human ATP-binding cassette (ABC) transporter families and is involved in the exclusion of xenobiotics and their metabolites. It has been shown that the gene expression of many of these drug-metabolizing enzymes and transporters is regulated by the aryl hydrocarbon receptor (AHR), which is a ligand-dependent transcription factor present in most cell and tissue types in the body.3 AHR translocates into the nucleus and heterodimerizes with a protein known as the aryl hydrocarbon nuclear translocator (ARNT).4 This AHR/ARNT complex binds to specific enhancer sequences adjacent to target promoters © XXXX American Chemical Society
termed the xenobiotic-responsive element (XRE), which enhances the transcription of target genes encoding phase I metabolic enzymes such as CYP1A1 and CYP1A2, phase II metabolic enzymes such as UGT1A1 and UGT1A6, and phase III metabolic enzymes such as the ABC transporter subfamily G, member 2 (ABCG 2).2,5−9 Therefore, AHR is regarded as a key regulator of xenobiotic metabolism. The regulation of AHR by dietary factors is of considerable importance and interest because AHR regulates drugmetabolizing enzymes as described above, and so it is likely that metabolism of xenobiotics could be modulated by dietary factors via AHR. In previous studies, some substances contained in vegetables, such as flavonoids,10−12 indole compounds,13,14 and curcumin,15 were shown to act as natural AHR ligands. However, it is possible that vegetables contain other AHR-activating compounds because there are so many plant-derived compounds in vegetables. The aim of this study was to search for vegetable components that exhibited AHR-mediated transcriptional activity and modulation of xenobiotic metabolism. Previously, we established the stable AHR-responsive HepG2 cell line by cotransfection of an AHR expression vector (pcDNA-hAHR) and an AHR-responsive vector (pGL3-XRE) containing a luciferase gene and three tandemly arranged XRE elements into the human hepatoma cell line, HepG2.16 Using this cell line, we Received: November 14, 2013 Revised: May 13, 2014 Accepted: May 25, 2014
A
dx.doi.org/10.1021/jf405146j | J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Journal of Agricultural and Food Chemistry
Article
assessed the AHR-mediated transcriptional activity of vegetable extracts and identified new active compounds in vegetables. We also examined the regulation of mRNA and protein expressions of AHR-target xenobiotic-metabolizing genes by these active compounds.
■
MATERIALS AND METHODS
Cell Culture. The stable AHR-responsive HepG2 cells and HepG2/mock cells (empty vectors were transfected) were grown and maintained at 37 °C in Dulbecco’s modified Eagle’s medium (DMEM) High Glucose with L-glutamine and phenol red (Wako Pure Chemical Industries 044-29765 Osaka, Japan), containing 10% fetal bovine serum (Asahi Technoglass, Chiba, Japan), 40 U/mL penicillin, 40 μg/mL streptomycin, and 500 μg/mL G418 (Nacalai Tesque, Kyoto, Japan) in a 100% humidified atmosphere containing 5% CO2. For culturing of HepG2 cells, G418 was removed from the same medium as that used for culturing the stable AHR-responsive HepG2 cells. Preparation of Vegetables Extracts. Fresh vegetables were purchased from local markets in Nasushiobara, Japan (Table 1).
Figure 1. Preparation scheme of vegetable extracts. was used as the “ethyl acetate fraction (EAF)” sample. The aqueous layer was adjusted to pH 5.5 by adding 2 M sodium hydroxide and lyophilized. The obtained lyophilized powder was used as the “water fraction (WF)” sample. Chemicals. 3-Methylcholanthlene (3MC), 6-shogaol, 6-gingerol, 8gingerol, and 10-gingerol were obtained from Wako Pure Chemical Industries. 8-Shogaol and 10-shogaol were obtained from ChromaDex (Irvine, CA, USA). Each phytochemical was dissolved in dimethyl sulfoxide (DMSO) at a concentration of 50 mM. Luciferase Assay. The luciferase assay was carried out to assess AHR-mediated transcriptional activity as previously described.17 The stable AHR-responsive HepG2 cells or HepG2/mock cells were seeded onto a 24-well plate (Corning-Coster Japan Product #3526, Tokyo, Japan) at a density of 1 × 105 cells/well. The 24-well plate was precoated with Type I-C collagen (Nitta Geratin, Osaka, Japan) for 30 min before the cells were seeded. After incubating overnight, the medium was replaced with a medium containing each test sample or 3MC (positive control). Each sample was diluted in the cell culture medium at the test concentration; the final concentration of DMSO was ≤0.1% (v/v) in the cell culture medium. After 24 h of culture, the cells were washed twice with 500 μL of PBS and then lysed with 100 μL of 1× passive lysis buffer (Promega). The lysate was centrifuged at 15000g for 5 min, and the supernatant was used for the luciferase assay. Luciferase activity was determined by a dual-luciferase reporter assay (Promega) with an LB9507 Lumet luminometer (Berthold Technologies, Bad Wildbad, Germany). High-Performance Liquid Chromatography (HPLC) Analysis. The EAF from ginger and the standard phytochemicals were dissolved in methanol at concentrations of 10 mg/mL and 5 mM, respectively. HPLC analysis was performed using a photodiode array detector (L2455, HITACH, Tokyo, Japan) and a PEGASIL-B ODS C18 column (250 mm × 4.6 mm, 4.6 μm; Senshu Scientific, Tokyo, Japan). The mobile phases were as follows: (a) acidified methanol (0.1% trifluoroacetic acid, TFA) and (b) acidified Milli-Q water (0.1% TFA). Pumps were programmed to perform the following gradient at a flow rate of 0.5 mL/min: from 20% solvent A to 80% solvent A over 50 min, to 100% solvent A at 55 min, and then to 0% solvent A at 60 min, with a column temperature of 35 °C. The separated compounds in the EAF were identified by comparison of the retention time and UV spectra to 6-shogaol or 6-gingerol standards. Isolation of Total RNA and Real-Time PCR. The mRNA expression level of CYP1A1, UGT1A1, and ABCG 2, the target genes of AHR, was evaluated by real-time PCR. HepG2 cells were seeded onto a 24-well plate precoated with Type I-C collagen at a density of 1 × 105 cells/well. After overnight incubation, the medium was replaced with a medium containing 6-shogaol. After 24 h of culture, total RNA was extracted from the cells using Isogen. cDNA was prepared from 1 μg of the total RNA. Real-time PCR was performed with SYBR Premix Ex TaqII (TAKARA BIO INC., Otsu, Japan) and the 7900HT Fast Real-Time PCR System (Applied Biosystems, Tokyo, Japan). After denaturing at 95 °C for 30 s, PCR was performed for 40 cycles of denaturing at 95 °C for 5 s, annealing at 60 °C for 30 s, and dissociation at 95 °C for 15 s, followed by 60 °C for 60 s and 95 °C for
Table 1. List of the 23 Vegetables Used in This Study Vegetable
Family name
Scientific name
Ashitaba Asparagus Beetroot
Apiaceae Liliaceae Chenopodiacea
Broccoli
Cruciferae
Broccoli sprout Burdock Cabbage
Cruciferae
Angelica keiskei Asparagus off icinalis L. Beta vulgaris L. ssp. vulgaris var. vulgaris Brassica oleracea var. italica L. Brassica oleracea var. italica L. Arctium lappa L. Brassica oleracea var. capitata L. Daucus carota L. Apium graveolens L. Brassica rapa L. ssp. Pekinensis Solanum melongena L. Zingiber off icinale Brassica rapa var. perviridis Lactuca sativa L. Corchorus olitorius L. Allium cepa L. Capsicum annuum cv. Petroselium crispum Nym. Cucurbita maxima L. Spinacia oleracea L. Solanum lycopersicum L. Nasturtium of f icinale R. Br. Raphanus sativus L.
Asteraceae Cruciferae
Carrot Celery Chinese cabbage Eggplant Ginger Komatsuna
Apiaceae Apiaceae Cruciferae
Lettuce Molokhia Onion Paprika Parsley Pumpkin Spinach Tomato Watercress
Asteraceae Tiliaceae Liliaceae Solanaceae Apiaceae Cucurbitaceae Chenopodiacea Solanaceae Cruciferae
White radish
Cruciferae
Solanaceae Zingiberaceae Cruciferae
Production area in Japan Ibaragi Tochigi Nagano Nagano Shizuoka Tochigi Gunma Chiba Nagano Ibaragi Kochi Miyazaki Tochigi Nagano Tochigi Saga Chiba Nagano Tochigi Tochigi Tochigi Tochigi Hokkaido
Preparation of vegetable extracts was conducted as described in Figure 1. Each vegetable was chopped and boiled in four-times its weight of hot water for 1 h. The extraction liquid was then recovered and centrifuged at 8000g for 10 min at room temperature. A portion of the obtained supernatant (40 mL) was lyophilized, and the resultant powder was used as the “hot water extract (HWE)” sample. A portion of the supernatant (100 mL) was adjusted to pH 3.0 by adding 2 M hydrochloric acid, followed by addition of 200 mL of ethyl acetate. The mixture was then vigorously shaken in a separating funnel to separate it into the ethyl acetate layer and aqueous layer. This extraction was repeated four times. All the ethyl acetate layers were collected, and the ethyl acetate was evaporated. The obtained residue B
dx.doi.org/10.1021/jf405146j | J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Journal of Agricultural and Food Chemistry
Article
Table 2. Primers Used for Real-Time PCR Analysis Sequence (5′ → 3′)
Gene ACTB (NM_001101) CYP1A1 (NM_000499) UGT1A1 (NM_000463) ABCG2 (NM_001257386)
Forward Reverse Forward Reverse Forward Reverse Forward Reverse
Tm
TGGCACCCAGCACAATGAA CTAAGTCATAGTCCGCCTAGAAGCA AGATGGTCAAGGAGCACTACA CTGGACATTGGCGTTCTCAT TGGCTGTTCCCACTTACTGCAC AGGGTCCGTCAGCATGACATC TGCCCAGGACTCAATGCAAC TCGATGCCCTGCTTTACCAAATA
64.7 62.3 69 68 64.6 64.7 64.5 64.7
Figure 2. (A) Effects of the HWEs on AHR-mediated transcriptional activity. Stable AHR-responsive HepG2 cells were incubated with each HWE at 0.5 mg/mL for 24 h, and AHR-mediated transcriptional activity is shown as luciferase activity. Untreated cells were used as the control. (B) Effects of HWEs from ginger, molkhia, parsley, spinach, and ashitaba on AHR-mediated transcriptional activity corrected by AHR-nonspecific luciferase activity. Stable AHR-responsive HepG2 cells and HepG2/mock cells were incubated with each HWE at 0.25 mg/mL for 24 h, and AHR-mediated transcriptional activity is shown as luciferase activity. Luciferase activity in the stable AHR-responsive cells was divided by that in the HepG2/mock cells, and relative values were calculated. Untreated cells were used as the control. (C) Effects of EAFs and WFs from ginger, molkhia, parsley, spinach, and ashitaba on AHR-mediated transcriptional activity. Stable AHR-responsive HepG2 cells were incubated with each sample at 100 μg/mL for 24 h, and AHR-mediated transcriptional activity is shown as luciferase activity. The untreated and the 0.1% DMSO-treated cells were used as controls for WFs and EAFs, respectively. The relative luciferase activity measured for the control was taken as 1. 3MC was used as the positive control (5 μM). Each value is the mean ± SD (n = 3). Statistically significant differences from the value of the control were analyzed by the Dunnett’s test; *p < 0.05; **p < 0.01. Samples containing 30 μg of protein were loaded onto 12.5% polyacrylamide gel. Electrophoresis was conducted in an electrode buffer (25 mM Tris, 192 mM glycine, and 0.1% (w/v) SDS) with a fixed current (20 mA). An Immobilon polyvinylidene difloride (PVDF) membrane (Millipore, Bedford, MA) was treated with methanol and then blotting buffer (100 mM Tris, 192 mM glycine, and 20% methanol). The BioRad tank type of blotting apparatus was used for electrophoretic transfer of the gel to the PVDF membrane at 200 mM over 120 min. After blotting, this PVDF membrane was blocked overnight at 4 °C by 0.1% Tween-20 and 5% skimmed milk dissolved in PBS. It was then incubated for 2 h with mouse monoclonal CYP1A1 antibody (1:100 dilution; sc-25304 Santa Cruz Biotechnology), or incubated for 1 h with mouse monoclonal β-Actin antibody (1:200 dilution; sc-47778 Santa Cruz Biotechnology) dissolved in a Can Get Signal immunoreaction enhancer solution (Toyobo, Japan). After the PVDF membrane had been washed three times with 0.1% Tween-20 dissolved in PBS for 5 min each, it was incubated for 1 h with
15 s. The PCR primers used for CYP1A1 and UGT1A1 were synthesized at Invitrogen; the primers used for β-actin and ABCG 2 were synthesized at TAKARA BIO INC. The sequence of each primer is shown in Table 2. Western Blot Analysis. HepG2 cells were seeded onto a 6-well plate precoated with Type I-C collagen at a density of 1 × 106 cells/ well. After overnight incubation, the medium was replaced with a medium containing 6-shogaol. After 24 h of culture, cells were washed twice with PBS. Cells were scraped off and then suspended in 1 mL of PBS. The precipitate obtained by centrifugation at 1000g for 5 min at 4 °C was homogenized with 0.1 mL of RIPA lysis buffer (Santa Cruz Biotechnology, Santa Cruz, CA) with 0.1 mM phenylmethanesulfonyl fluoride, 0.1 mM sodium orthovanadate, and 0.1% protease inhibitor cocktail, and left on ice for 20 min. The homogenate was centrifuged at 18000g for 15 min at 4 °C. The resulting supernatant was dissolved in electrophoresis sample buffer (Santa Cruz Biotechnology) at 100 °C for 5 min. C
dx.doi.org/10.1021/jf405146j | J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Journal of Agricultural and Food Chemistry
Article
Figure 3. (A) HPLC profiles of the EAFs of ginger. (B) HPLC profiles and chemical structures of 6-gingerol and 6-shogaol. (C) UV spectra of peak 1 (left) and peak 2 (right). (D) UV spectra of 6-gingerol (left) and 6-shogaol (right). antimouse immunoglobulin G-horseradish peroxidase (IgG-HRP; 1:2000 dilution; NA931, GE Healthcare, Buckinghamshire, U.K.) Proteins were detected by an ECL Prime Western Blotting Detection Reagent (GE Healthcare), followed by analysis with an LAS-1000 mini image analyzer and Multi Gauge Ver2.0 (Fuji Photo Film Co., Ltd., Tokyo, Japan). Statistical Analysis. The data from the luciferase assay and realtime PCR were expressed as the mean ± SD. Statistical significance was analyzed using the Dunnett’s test, and a p value of
