A Chemical Surface Modification of Chitosan by Glycoconjugates To

Biomacromolecules 2003, 4, 224-231

224

A Chemical Surface Modification of Chitosan by Glycoconjugates To Enhance the Cell-Biomaterial Interaction Yu-Chi Wang,† Shu-Huei Kao,‡ and Hsyue-Jen Hsieh*,† Department of Chemical Engineering, National Taiwan University, Taipei 106, Taiwan, and Graduate Institute of Biomedical Technology, Taipei Medical University, Taipei 110, Taiwan Received August 3, 2002; Revised Manuscript Received December 3, 2002

The use of wheat germ agglutinin (WGA), a lectin molecule, to modify chitosan and enhance the cellbiomaterial interaction was examined. The percentage of living fibroblast cells on the surfaces of tissue culture polystyrene (TCPS) control, WGA-modified chitosan, and unmodified chitosan films increased to 99%, 99%, and 85%, respectively, after seeding for 48 h. DNA staining revealed that a portion of fibroblasts cultivated on chitosan films were undergoing apoptosis. In contrast, fibroblasts growing on WGA-modified chitosan film surfaces did not show any indication of apoptosis. The number of fibroblast cells was the highest on the WGA-modified chitosan surfaces, followed by the TCPS and unmodified chitosan surfaces. This WGA-mediated enhancement on the fibroblast cell-biomaterial interaction was cell type dependent. Other types of cells may need different lectin molecules for enhanced interaction with biomaterials. Further, the evaluation of the heat shock protein (HSP) mRNA expression indicated that HSP 90 expression was increased in the fibroblast cells cultivated on chitosan films and decreased to basal levels on the WGAmodified chitosan films. Taken together, our data suggest that the use of WGA and other lectin molecules to enhance the cell-biomaterial interaction via oligosaccharide-mediated cell adhesion is a promising way to improve cell adhesion and proliferation, the two key issues in tissue engineering. Introduction The technology of tissue engineering is founded upon the use of polymer scaffolds which serve to support, reinforce, and in some cases organize the regenerating tissues.1-3 The scaffold may be required to release bioactive substances at a controlled rate or to directly influence the behavior of incorporated or ingrown cells. Good performance of these scaffolds usually demands a porous scaffold microstructure, with the pore characteristics being application specific. A number of natural and synthetic polymers are currently being employed as tissue scaffolds.4-7 The microstructures of these systems range from hydrogels, open-pore structures, to fibrous matrixes. Since the range of potential artificial tissue systems is broad, there is a continuous ongoing search for materials which either possess desirable tissue-specific properties or may have broad applicability and can be tailored for different tissue systems. There is ample evidence suggesting that chitosan (poly(1,4-D-glucosamine)) may be one such material. Chitosan is a partially deacetylated derivative of chitin, the major structural polymer in arthropod exoskeletons.8,9 Commercially available preparations have degrees of decetylation ranging from 50 to 90%. Chitosan is a crystalline polysaccharide and is normally insoluble in aqueous solutions above pH 7. Chitosan and some of its derivatives have been utilized in a number of biomedical applications, including * To whom correspondence should be addressed. Telephone: +886-223633097. FAX: +886-2-23623040. E-mail: [email protected]. † National Taiwan University. ‡ Taipei Medical University.

drug delivery systems10,11 and wound dressings.12 It has been reported that chitosan is a potentially useful material in medicine owing to its good biocompatibility and low toxicity.13 Further, the presence of amino groups in the chitosan molecules makes them suitable for further chemical modifications which in turn allow extensive adjustment of the chemical and biological properties of the chitosan materials. Desirable aspects of scaffold chemistry may include specific interaction with, or mimicry of, extracellular matrix components, growth factors, or cell surface receptors; however, it is very difficult to control the surface properties of most artificial materials used for tissue engineering. This is due to nonspecific protein adsorption onto the material surfaces, which usually leads to the emergence of a woundhealing phenotype for cells in contact with the material. Additionally, the presence of nonspecifically adsorbed proteins on the materials will make the design of cell type specific materials extremely difficult. Important parameters such as the strength of cell adhesion, the rate of cell migration, and the rate of cell proliferation are strongly dependent upon the surface concentrations and conformation of the adsorbed proteins. The adhesive proteins such as fibronectin, vitronectin, and collagen have been found to be effective in promoting cell adhesion to biomaterial surfaces.14-16 The cell attachment promoting properties of these adhesive proteins can be duplicated by short peptide sequences such as RGD (Arg-Gly-Asp).17,18 In the present study we proposed a novel use of lectin to improve the cellbiomaterial interaction. Many biologic interactions with cell

10.1021/bm0256294 CCC: $25.00 © 2003 American Chemical Society Published on Web 02/19/2003

Surface Modification for Enhanced Interaction

surface carbohydrates are mediated by lectins. Lectins are ubiquitous, natural, nonenzymatic glycoproteins of nonimmune origin that recognize and bind to glycoconjugate structures.19,20 In addition, lectins have specificity that can detect subtle differences in ligand carbohydrate structure.21 The various known lectins are partially characterized by the monosaccharide units that inhibit their interaction with a glycoconjugate structure, but they hold a much higher affinity for specific oligosaccharides than for monosaccharides.19 There are many biologic adhesive processes depending on lectin-sugar interactions. For instance, bacterial adherence to host cells, mammalian mannose-binding protein and pathogen binding, platelet adhesion to monocytes and neutrophils, and endothelial cell-neutrophil and endothelial cell-monocyte adhesion.22-27 In this study, we chose wheat germ agglutinin (WGA), a commonly used lectin molecule having an affinity for N-acetyl-β-D-glucosaminyl residues, and N-acetyl-β-D-glucosamine oligomers,28 to modify the surface properties of chitosan films. We demonstrated that WGA covalently bound onto chitosan films could improve the biocompatibility of chitosan via oligosaccharide-mediated fibroblast cell adhesion. In other words, a WGA-modified biomaterial surface would promote the adhesion of fibroblast cells. The biocompatibility of the chitosan and WGA-modified chitosan was evaluated based on the growth, activities, and viabilities of the cells adhering to these material surfaces.29-32 This WGA-mediated enhancement on the fibroblast cell-biomaterial interaction was cell type dependent. Other types of cells may need different lectin molecules for enhanced interaction with biomaterials. To investigate this topic, concanavalin A (Con A), another lectin molecule, was also utilized to modify chitosan. Con A has an affinity for R-Dmannosyl and R-D-glucosyl residues.33 We found that for endothelial cells the Con A-modified chitosan was more effective than the WGA-modified chitosan in promoting cell-biomaterial interaction, suggesting that the effect is cell type specific and also lectin type specific. To analyze further the cellular responses to various biomaterial surfaces, the heat shock protein (HSP) mRNA expression has been taken as a marker of intracellular events.31,32 The HSP 70 and HSP 90 families are a set of highly conserved proteins essential for cellular recovery, survival, and maintenance of normal cell functions. When cells are under stress, HSP 70 functions in a dual role as a cytokine and as a chaperone and HSP 90 also functions as a molecular chaperone and assists the refolding of other damaged proteins.34 The evaluation on the mRNA expression of these two HSPs in the cells indicated that HSP 90 expression was increased on chitosan film surfaces and decreased to basal levels on WGA-modified chitosan film surfaces. Our results thereby suggest that the use of WGA and other lectins to enhance the cellbiomaterial interaction is a promising way to improve cell adhesion and proliferation. Materials and Methods Preparation of Chitosan Films. For the fabrication of chitosan films, 3% (w/v) chitosan solution was prepared by

Biomacromolecules, Vol. 4, No. 2, 2003 225

dissolving chitosan power (Sigma, USA) with a degree of deacetylation greater than 85% in 2% (v/v) acetic acid for 24 h. The sample (5 mL) was poured into 3-cm (i.d.) dishes and then allowed to dry for 24 h to form a thin film in each dish. The acidity of the film was neutralized by adding 1 N NaOH solution. The films were repeatedly washed with Hanks’ balanced salt solution until the film pH returned to a physiologic range (pH ) 7.4). Immobilization and Quantification of WGA on Chitosan Films. 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) was used to conjugate wheat germ agglutinin (WGA) to chitosan films. WGA (Sigma, USA) was activated by EDC (Sigma, USA), 10 mg/mL in phosphate-buffered saline solution (PBS, pH ) 7.4), for 2 h with mixing at 37 °C, followed by immersing chitosan films in this solution for 24 h. Excess reaction solution was removed by repeated washing in PBS. For the quantification of WGA immobilized on chitosan films, a 0.3 mCi portion of N-acetyl-D-[1-3H]glucosamine (Amersham, USA) was added to 1 mL of WGA solution (2 mg/mL in PBS) and incubated for 12 min to generate 3Hlabeled WGA. The reaction solution was then eluted through a PBS-equilibrated Sephadex G-25M column (Pharmacia LKB Biotechnology, USA) and 1 mL fractions were collected and then counted in a Beckman LS 5000C counter (Beckman Instruments, USA). Protein concentration was measured by the Lowry method. Unlabeled WGA was added to generate a final 3H-labeled/unlabeled WGA mixture with a total protein concentration of 1.2 mg/mL in PBS. The WGA mixture was then used in the immobilization of WGA on 1 cm2 chitosan films. The films were washed as described above and then counted for scintillation. Control samples without using EDC were also measured to determine the nonspecific adsorption of WGA to the chitosan films. All samples were run in parallel and performed in duplicate. EDC-mediated covalent binding of WGA to chitosan films was calculated by the following formula: covalent binding ) (total binding - nonspecific binding).35 The resultant films were designated WGA-chitosan films. Immobilization of Con A on Chitosan Films. For comparison, concanavalin A (Con A), another lectin molecule, was also utilized to modify chitosan films. The procedure described in the previous section for immobilizing WGA on chitosan films was followed to immobilize Con A (Sigma, USA) (starting concentration was 2 mg/mL) on chitosan films. The resultant films were designated Con A-chitosan films. Cell Culture. Human skin fibroblasts were cultivated in DMEM with 10% FCS (Gibco BRL, USA) and incubated at 37 °C under humid atmosphere in 5% CO2/ 95% air. Bovine aortic endothelial cells were also cultivated in DMEM with 10% FCS (Gibco BRL, USA) and incubated at 37 °C in 5% CO2 balanced with air. mRNA Isolation and Reverse Transcriptase Polymerase Chain Reaction (RT-PCR). Cells were cultured on chitosan films for 24 h. Total RNA was isolated from the cells by RNeasy Mini kit (QIAGEN GmbH, Germany) and was dissolved in diethylpyrocarbonate (DEPC) (Sigma, USA) treated water. RNA yields were measured by A260, and

226

Biomacromolecules, Vol. 4, No. 2, 2003

Wang et al.

Table 1. The Sequences of Oligonucleotides Used as 5′ and 3′ Primers in RT-PCR transcript β-actin HSP 70 HSP 90

5′ primer

3′ primer

size of product

ref

ATCATGTTTGAGACCTTCAA CTAGCCTGAGGAGCTGCTGCGACAG ATCATCCCCAACCCTCAGG

CATCTCTTGCTCGAAGTCGA GTTCCCTGCTCTCTGTCGGCTCGGCT CGGGAGATGTTCAGGGGC

450 204 952

36 32 36

concentration and quality were checked on agarose gel. The total RNA samples were reversely transcribed to cDNA using a Thermoscript RT-PCR system (Invitrogen life technologies, USA). PCR was carried out for 35 cycles (denaturation at 94 °C for 1.5 min, annealing at 56 °C for 1.5 min, elongation at 72 °C for 2 min) from 2 µL of cDNA. PCR products (10 µL) were analyzed in 1.5% agarose gel stained with ethidium bromide. The primer pairs sequences used were obtained from published sequences and were purchased from a local supplier (Mission Biotech, Taiwan). The amplification procedure consisted of 35 cycles for β-actin and heat shock protein (HSP) 70 and 90 with the oligonucleotide primer sets as shown in Table 1. These amplified products were confirmed to be those of the gene transcripts by the detection of a 204 bp band (HSP 70 mRNA), 952 bp band (HSP 90 mRNA), and 450 bp band (β-actin mRNA). The values of each band were measured with image analysis (Universal software, USA), and the expressions of HSP mRNA were determined relative to that obtained for β-actin. Amplified β-actin mRNA was generally used as an internal standard for semiquantification.32,36,37 Cell Growth Studies. For the assessment of the kinetics of cell growth, fibroblast cells (or bovine aortic endothelial cells) were seeded onto tissue culture polystyrene (TCPS) (Costar, USA) and chitosan films at a density of 1.5 × 104 cells/cm2. TCPS is a commercialized material which is specially treated for optimum growth of most anchoragedependent cells and thus widely utilized as a control surface in biomaterial research. After a period of time, TCPS or chitosan films were rinsed gently with Hank’s buffered saline solution (HBSS) (Life Technologies, USA) and the number of attached cells was quantified by staining the cells with trypan blue. Cytotoxicity Testing by MTT Assay. DMEM containing the film leach-out products from unmodified or modified chitosan films was filtered through 0.22 µm filter (Millipore, USA) and used at various concentrations for testing its effect on the cellular viability. Fibroblast cells were seeded in 24-well plates and incubated for 24 h at 37 °C in 5% CO2/95% air. Cells were then exposed to leach-out products of varying concentrations for 24 h. Thiazolyl blue (MTT) assay was performed as standard protocol, to assess cellular activity.38 Cytocompatibility Testing. Unmodified or modified chitosan films were cut into 2 cm × 2 cm pieces, sterilized with 70% ethanol, rinsed with PBS, and placed in six-well nontreated culture plates (Nunc, Denmark), with tissue culture polystyrene (TCPS) plates as control surfaces. Fibroblast cells were seeded (1 × 105 cells) on films and in control wells. Cell morphology and attachment were monitored using an Optimas 5.2 image analysis system

(Optimas, USA) connected to an IX70 inverted phase contrast microscope (Olympus, Japan) via CCD imaging camera. Evaluation of Cell Condition Using NAO and PI Fluorescent Dyes. To measure changes of cellular condition on different surface modification, the fluorescent probes 10nonyl acridine orange (NAO) and propidium iodide (PI) (Molecular Probes, Netherlands) were used. NAO was used to stain the mitochondria of fibroblasts, whereas DNA staining by PI was utilized to identify dead cells. Cell monolayers were washed with medium and then incubated in this medium with the fluorescent probes at 37 °C under 5% CO2/95% air for the indicated length of time. At the end of the incubations, cells were washed twice with cold PBS and resuspended by trypsinization at room temperature with trypsin/EDTA solution per well. After trypsin neutralizing solution was added, the cell suspension was stored in the dark at 4 °C until the time of analysis. Samples were then analyzed by flow cytometry on the FACS Calibur (Becton Dickinson, USA). Green (520 nm) and red (>650 nm) fluorescence emissions from NAO and PI, respectively, were collected using logarithmic amplification. To confirm further the cellular condition of fibroblasts cultivated on various surfaces, immunofluorescence staining with the probes NAO and PI was also carried out and visualized by fluorescence microscopy. Results Quantification of Bound WGA. To immobilize WGA on chitosan films, we developed a coupling method in which the carboxyl groups of WGA were modified with 1-ethyl3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) and then reacted with the amino group of chitosan. In this process, a peptide bond was formed between WGA and chitosan. The coupling efficiency of WGA, defined as the ratio of immobilized WGA to initially added WGA (i.e., amount bound/starting WGA), was greater than 90% if the starting concentration of WGA was below 2000 µg/mL (Figure 1). Therefore, in the following experiments WGA at a starting of concentration of 2000 µg/mL was chosen for immobilizing WGA on chitosan films. The same experimental conditions were used to immobilize Con A on chitosan films. Cell Viability and Morphologic Analysis. The cell morphology micrographs revealed cells spreading and having spindle morphology on TCPS control surface, chitosan, and WGA-chitosan films (Figure 2). A similar situation was found in the cell adhesion and cell growth (Figure 3). In comparison with TCPS and chitosan, the WGA-modified chitosan films appeared to allow for the greatest fibroblast adhesion and growth after 60 h in culture (Figure 3).



Figure 1. Covalent binding of N-acetyl-D-[1-3H]glucosamine-labeled WGA to chitosan film via a cross-linker EDC (n ) 3).

Therefore, for fibroblast cells WGA-modified chitosan films are more cytocompatible than TCPS and chitosan films. This WGA-mediated enhancement on the fibroblast cell-biomaterial interaction could be cell type dependent. Other types of cells may need different lectin molecules for enhanced interaction with biomaterials. To investigate this issue, concanavalin A (Con A), another lectin molecule, was also utilized to modify chitosan. We found that for endothelial cells the Con A-modified chitosan was slightly more effective than the WGA-modified chitosan in promoting cell-biomaterial interaction, suggesting that the effect of enhanced interaction with biomaterials is cell type specific and also lectin type specific (Figure 4). Evaluation of Cellular Condition. To investigate the response of cells to modified surfaces used as culture substrata, the state and activity of fibroblast cells were analyzed using flow cytometry and fluorescence microscopy. The two fluorescent probes NAO and PI were used. NAO was used to stain the mitochondria of fibroblasts, whereas DNA staining by PI was utilized to identify dead cells. The flow cytometry analysis indicated that at 24 h the ratios of living fibroblast cells were both about 93% on the TCPS and WGA-modified chitosan surfaces but only near 74% on chitosan surface (Figures 5 and 6). These ratios increased further to 99%, 99%, and 85%, respectively, at 48 h (Figure 6). The fluorescence microscopy analysis was also carried out in which the staining of NAO (green) indicated the presence of mitochondria in live cells and the DNA staining by PI (red) was utilized to identify apoptotic cells (Figure 7). It was found that a portion of fibroblast cells cultivated on chitosan films was undergoing apoptosis (Figure 7b). In contrast, fibroblasts growing on TCPS and WGA-modified chitosan surfaces did not show any indication of apoptosis (parts a and c of Figure 7). These data suggest that the role of WGA in this situation is to mediate the cytoskeleton of cell and biomaterial interaction, therefore decreasing the environmental stress and inhibiting the cell apoptosis. It is conceivable that WGA might mediate cell-biomaterial interactions by the species-specific affinity for glycoconjugate structures on the fibroblast cell surface. These affinities not only promote the cell adhesion on the biomaterials but also create better environment for cell growth.

Figure 2. Phase microscope images of fibroblast cells attached to (a) tissue culture polystyrene (TCPS), (b) unmodified chitosan film, and (c) WGA-chitosan film after 48 h of culture. (Bar ) 20 µm.)

Cytotoxicity Testing by MTT Assay. Cytotoxicity of materials was assessed by MTT assay (Figure 8). The viability of fibroblast cells seeded onto the WGA-chitosan was found to be similar to that of cells seeded on TCPS control surface and greater than that of cells seeded on chitosan films. These data suggest that WGA-modified chitosan films are not toxic to the cells. Analysis of mRNA Expression. It is widely accepted that exposure of cells to several types of stress such as heat shock may immediately induce the expression of HSPs in order to mediate many cytoprotective events. Therefore, it was difficult to evaluate HSP expression accurately in the early

228


Wang et al.

Figure 3. Growth curves of fibroblast cells cultivated on WGAchitosan film, TCPS, and unmodified chitosan film. Data are presented as mean ( standard deviation (n ) 4).

Figure 4. Growth of bovine aortic endothelial cells cultivated on unmodified chitosan, WGA-chitosan, and Con A-chitosan films for 48 h (n ) 4).

adhesion stage (soon after plating) because the cells were strongly activated by the trypsin treatment. The incubation time used to evaluate the HSP mRNA expression was set at 24 h after cell seeding to avoid the aforementioned difficulty. These conditions for mRNA analysis were similar to those proposed by Kato et al.32 Whitley et al.34 showed that some members of the HSP 70 family are expressed constitutively and others are strictly stresses inducible. However, little is known about its function within the cell. Upregulation of the inducible form of HSP 70 has been most closely associated with the development of thermotolerance. In other words, HSP 70 was not significantly enhanced without heat shock. Our results showed that there was no significant difference in HSP 70 mRNA expression for the cells cultivated on a TCPS control surface, chitosan, and WGAmodified chitosan films for 24 h (Figure 9 and Figure 10a). In contrast, the HSP 90 mRNA expression was significantly enhanced in the cells cultivated on chitosan films, as compared with TCPS control surface and WGA-modified chitosan films (Figure 9 and Figure 10b). Kato et al.31 noted that for surfaces more hydrophobic than TCPS, the HSP 90 mRNA expression was lower than that on TCPS. Our results, however, suggest that chitosan surface, which was less hydrophobic than TCPS, could enhance the HSP 90 mRNA expression. We also found that the conjugation of WGA to chitosan significantly altered the surface property of chitosan

Figure 5. Flow cytometric patterns of fibroblast cells stained with NAO and PI. The cells were cultured on (a) TCPS, (b) unmodified chitosan, and (c) WGA-chitosan films for 48 h.

films and thereby lowered the HSP 90 mRNA expression, which could imply the cells being under a less stressful condition. Discussion In the present study we documented for the first time the use of WGA-modified chitosan as a novel biomaterial to enhance the growth of fibroblast cells. The cells cultured on WGA-chitosan surfaces remained viable and maintained spindle morphology similar to that displayed by fibroblast cells cultured on TCPS control surface. Additionally, the higher density of fibroblast cells was found on the WGAchitosan films, as compared with the cells seeded on the TCPS, suggesting an increased affinity of these cells for the WGA-chitosan surfaces. The previous study mentioned that chitosan is a biocompatible substrate for growth of various


Figure 6. State of fibroblast cells on TCPS, unmodified chitosan, and WGA-chitosan surfaces. The results of flow cytometric analysis using NAO and PI stains are summarized and presented at different time points.


Figure 8. Cytotoxicity of chitosan and WGA-modified chitosan materials on fibroblast cells determined by MTT assay. The high value of cell viability is an indication of low cytotoxicity. Viability of control cells cultured on TCPS is taken as 1. (n ) 3; /, P < 0.05 vs chitosan.)

Figure 9. Analysis of HSP mRNA expression in fibroblast cells by RT-PCR. The HSP 90, β-actin, and HSP 70 mRNA expression in the fibroblast cells that adhered to TCPS control surface, unmodified chitosan films, and WGA-chitosan films after seeding for 24 h. M is the molecular weight marker of 100-1500 bp.

Figure 7. Fluorescence microscopy analysis of fibroblast cells stained with NAO and PI. Fibroblasts were cultured on (a) TCPS, (b) unmodified chitosan, and (c) WGA-modified chitosan surfaces for 12 h (100×).

types of cells. Human epithelial cells, keratinocytes, and fibroblasts all have been demonstrated to attach and multiply

on the surface of chitosan films. Moreover, we found that the WGA-modified chitosan had greater affinity for fibroblasts than the unmodified chitosan. We also observed that lectins of different types are capable of binding to different glycosylated cell membrane components. For example, the density of bovine aortic endothelial cells cultured on the WGA-modified chitosan film was similar to that cultured on the unmodified chitosan film. However, another lectin (Con A) appeared to slightly enhance the endothelial cellchitosan interaction (Figure 4). Our results suggest that the WGA-enhanced cell growth is fibroblast cell specific. Other types of cells may need different lectin molecules for enhanced interaction with biomaterials. The application of lectins and lectin-like molecules to act as drug delivery adjuvants is currently an important trend.39-41 Our study clearly indicates that the use of WGA to modify chitosan not only promotes fibroblast cell adhesion41 but also increases the number of fibroblast cells growing on the chitosan surface. The method that we used to immobilize lectin on chitosan via its carboxyl groups was mediated by the coupling agent 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC). Ertl et al. investigated the effects of EDC modification on the carboxyl of groups of lectin.41 In contrast to modification on the amino groups, they found that the modification on the carboxyl groups of lectin led to

230


Figure 10. Quantitative results of the expression of HSP mRNA in fibroblast cells determined by the RT-PCR method: (a) HSP 70; (b) HSP 90. (Normalized by β-actin; n ) 4; /, P < 0.05 vs chitosan.)

considerable decrease in its hemagglutination activity as well as its hemolytic activity, while its ability to bind to immobilized carbohydrate was only slightly affected. In other words, after EDC modification the binding ability of lectin for immobilized carbohydrate was retained fairly well, which might be the case in our study. Many biologic interactions with surface carbohydrates are mediated by lectins, such as protein folding and trafficking, the modulation of cell-cell and cell-matrix interactions.42 Initial attachment of cells to the WGA-modified chitosan was more pronounced than the unmodified chitosan. The number of cells remaining alive on the different surfaces was determined by flow cytometry. As shown in Figure 6, greater than 90% of cells remained nonapoptotic like and adherent on the WGA-modified chitosan film, which was significantly higher than the percentage of cells remaining nonapoptotic like on the unmodified chitosan films. On the other hand, previously studies by Kato et al.31,32 evaluated cell-polymer interactions in terms of HSP mRNA expressions and concluded that HSP could be a very sensitive marker. We also utilized the HSP mRNA expression as an index of cellsubstrate interactions to determine the biocompatibility of biomaterials and to analyze the effect of lectin covalently bound to the chitosan. We found that the use of WGAmodified chitosan as a biomaterial decreased the expression of the HSP 90 mRNA to the basal levels found in cells cultured on TCPS control surface (Figure 10). The HSP 70 protects cells during various kinds of environmental stress and HSP 90 potentially interacts with 10 or more different

Wang et al.

cochaperones, as well as with HSP 70 and its cochaperones.43 When cells are under stress, HSP 90 proteins will be induced to protect other HSPs and maintain the function of cytoskeletal proteins. The role of WGA in this situation is probably to mediate the cytoskeleton-biomaterial interactions, so that it may decrease the environmental stress and thereby lessen the demand of the HSP 90.44 On the other hand, the expression of HSP 90 mRNA for the cells cultured on the chitosan films was higher than that on the TCPS, suggesting that the cells on the chitosan films suffered more stress than those on other surfaces. We have no direct evidence to explain these differences of adhesion and expression of genes on different surfaces. However, one can associate the phenomenon with the presence of flexible dangling chains on the surface of a polymeric material. Narita et al.45 assume that a loosely cross-linked architecture, containing some graft-like polymer chains could be formed on the surface. Therefore, if a biomaterial has dangling chains on its surface, they might be flexible enough to access the membrane of the cells to undergo an effective binding with them. It is conceivable from our data that the WGA and other lectin molecules might mediate cell-biomaterial interactions by the species-specific affinity for glycol-conjugate structures on the fibroblast cell surface. Nizheradze46 and Hebert47 indicated that the occurrence of diverse carbohydrate moieties on the cell surface and in the extracellular matrix makes lectins be able to form the suitable binding with the cell surface structures. These affinities not only promote the cell adhesion to the chitosan films but also create a less stressful material environment for cultivated cells. The current tissue engineering research aims to develop new classes of biodegradable biomaterials with specific bioactivity. The use of lectin-modified chitosan described in this study is a starting point for the development and optimization of a variety of scaffolds for tissue regeneration. Chitosan can be modified with different lectins in order to induce specific cellular interaction with the chitosan material. For example, bulk scaffolds can be fabricated in specific shapes by using suitable molds, followed by lectin modification to generate more specific and selective cell adherence to the scaffolds. Biomaterial researchers may apply the techniques of surface modification described here to modulate and improve host responses to biomaterials. Conclusions Researchers in the field of tissue engineering seek to provide signals to biological systems that prompt certain cells to form regenerated tissues. The development of new biomaterials now focuses on the molecular design of scaffolds for tissue engineering and for in situ tissue regeneration and repair, with minimally invasive surgery. The results described herein indicate that WGA and other lectins have excellent potential as an essential part of materials for a variety of engineered tissue systems. It will be feasible to design a new generation of biomaterials tailored for specific patients and also for specific therapeutic purposes. More importantly, bioactive stimuli can be incorporated with biomaterials to modulate gene expression and thus enhance the performance of attached cells in a predictable manner.


Acknowledgment. This study was financially supported by the National Science Council, Taiwan (Grant Number NSC90-2214-E-002-001). References and Notes (1) (2) (3) (4) (5) (6) (7) (8) (9) (10) (11) (12) (13) (14) (15) (16) (17) (18) (19) (20) (21) (22) (23)

Langer, R. Mol. Ther. 2000, 1, 12-15. Langer, R. Acc. Chem. Res. 2000, 33, 94-101. Langer, R. S.; Vacanti, J. P. Sci. Am. 1999, 280, 86-89. Murphy, W. L.; Kohn, D. H.; Mooney, D. J. J. Biomed. Mater. Res. 2000, 50, 50-58. Thomson, R. C.; Mikos, A. G.; Beahm, E.; Lemon, J. C.; Satterfield, W. C.; Aufdemorte, T. B.; Miller, M. J. Biomaterials 1999, 20, 20072018. Peter, S. J.; Miller, M. J.; Yasko, A. W.; Yaszemski, M. J.; Mikos, A. G. J. Biomed. Mater. Res. 1998, 43, 422-427. Murphy, W. L.; Mooney, D. J. J. Periodontal Res. 1999, 34, 413419. Suh, J. K.; Matthew, H. W. Biomaterials 2000, 21, 2589-2598. Muzzarelli, R. A.; Mattioli-Belmonte, M.; Pugnaloni, A.; Biagini, G. EXS 1999, 87, 251-264. Genta, I.; Perugini, P.; Pavanetto, F.; Modena, T.; Conti, B.; Muzzarelli, R. A. EXS 1999, 87, 305-313. Sabnis, S.; Block, L. H. Int. J. Biol. Macromol. 2000, 27, 181-186. Loke, W. K.; Lau, S. K.; Yong, L. L.; Khor, E.; Sum, C. K. J. Biomed. Mater. Res. 2000, 53, 8-17. Thomas, C.; Sharma, P. Biomater. Artif. Cells Artif. Org. 1990, 18, 1-24. Dixit, P.; Hern-Anderson, D.; Ranieri, J.; Schmidt, C. E. J. Biomed. Mater. Res. 2001, 56, 545-555. Thompson, G. J. L.; Vohra, R. K.; Carr, M. H.; Walker, M. G. Surgery 1991, 109, 20-27. Mudera, V.; Eastwood, M.; McFarland, C.; Brown, R. A. Wound Repair Regen. 2002, 10, 397-408. Davis, D. H.; Giannoulis, C. S.; Johnson, R. W.; Desai, T. A. Biomaterials 2002, 23, 4019-4027. Wang, D. A.; Ji, J.; Sun, Y. H.; Shen, J. C.; Feng, L. X.; Elisseeff, J. H. Biomacromolecules 2002, 3, 1286-1295. Weis, W. I.; Kahn, R.; Fourme, R.; Drickamer, K.; Hendrickson, W. A. Science 1991, 254, 1608-1615. Larsen, E.; Celi, A.; Gilbert, G. E. Cell 1989, 59, 305-312. Larsen, E.; Palabrica, T.; Sajer, S. Cell 1990, 63, 467-474. Springer, T. A. Nature 1990, 346, 425-434. Bevilacqua, M. P.; Pober, J. S.; Mendrick, D. L.; Cotran, R. S.; Gimbrone, M. A. Proc. Natl. Acad. Sci. U.S.A. 1987, 84, 92389242.

Biomacromolecules, Vol. 4, No. 2, 2003 231 (24) Bevilacqua, M. P.; Stengelin, S.; Gimbrone, M. A., Jr.; Seed, B. Science 1989, 243, 1160-1165. (25) Hardouin, P.; Anselme, K.; Flautre, B.; Bianchi, F.; Bascoulenguet, G.; Bouxin, B. Joint Bone Spine 2000, 67, 419-424. (26) Altankov, G.; Thom, V.; Groth, T.; Jankova, K.; Jonsson, G..; Ulbricht, M. J. Biomed. Mater. Res. 2000, 52, 219-230. (27) McFarland, C. D.; Thomas, C. H.; DeFilippis, C.; Steele, J. G.; Healy, K. E. J. Biomed. Mater. Res. 2000, 49, 200-210. (28) Nagata, Y.; Burger, M. M. J. Biol. Chem. 1974, 249, 3116-3122. (29) Kato, S.; Kishida, A.; Hanyu, N.; Maruyama, I.; Akashi, M. J. Biomater. Sci., Polym. Ed. 2000, 11, 333-340. (30) Kato, S.; Akagi, T.; Sugimura, K.; Kishida, A.; Akashi, M. Biomaterials 2000, 21, 521-527. (31) Kato, S.; Akagi, T.; Sugimura, K.; Kishida, A.; Akashi, M. Biomaterials 1998, 19, 821-827. (32) Kato, S.; Akagi, T.; Kishida, A.; Sugimura, K.; Akashi, M. J. Biomater. Sci., Polym. Ed. 1997, 8, 809-814. (33) Reeke, G. N.; Becker, J. W.; Cunningham, B. A.; Gunther, G. R.; Wang, J. L.; Edelman, G. M. Ann. N. Y. Acad. Sci. 1974, 234, 369382. (34) Whitley, D.; Goldberg, S. P.; Jordan, W. D. J. Vasc. Surg. 1999, 29, 748-751. (35) Kuwahara, H.; Funada, T.; Hatakeyama, T.; Aoyagi, H. Biosci. Biotechnol. Biochem. 2000, 64, 1278-1281. (36) Kinoshita, T.; Imamura, J.; Nagai, H.; Shimotohno, K. Anal. Biochem. 1992, 206, 231-235. (37) Mivechi, N. F.; Rossi, J. J. Cancer Res. 1990, 15, 2877-2884. (38) Ciapetti, G.; Granchi, D.; Verri, E.; Savarino, L.; Cavedagna, D.; Pizzoferrato, A. Biomaterials 1996, 17, 1259-1264. (39) Lahiji, A.; Sohrabi, A.; Hungerford, D. S.; Frondoza, C. G. J. Biomed. Mater. Res. 2000, 51, 586-595. (40) Clark, M. A.; Hirst, B. H.; Jepson, M. A. AdV. Drug DeliVery ReV. 2000, 43, 207-223. (41) Ertl, B.; Heigl, F.; Wirth, M.; Gabor, F. J. Drug Targeting 2000, 8, 173-184. (42) Lehr, C. M. J. Controlled Release 2000, 65, 19-29. (43) Hernandez, M. P.; Sullivan, W. P.; Toft, D. O. J. Biol. Chem. 2002, 277, 38294-38304. (44) Pearl, L. H.; Prodromou, C. Curr. Opin. Struct. Biol. 2000, 10, 4651. (45) Narita, T.; Hirai, A.; Xu, J.; Gong, J. P.; Osada, Y. Biomacromolecules 2000, 1, 162-167. (46) Nizheradze, K. A. Folia Histochem. Cytobiol. 2000, 38, 167-173. (47) Hebert, E. Biosci. Rep. 2000, 20, 213-237.

BM0256294

A Chemical Surface Modification of Chitosan by Glycoconjugates To

Recommend Documents