A Facile-Synthesized Star Polycation is Constructed as A Highly

Subscriber access provided by Macquarie University

Article

A Facile-Synthesized Star Polycation is Constructed as A Highly Efficient Gene Vector in Pest Management Jianhao Li, Jin Qian, Yuanyuan Xu, Shuo Yan, Jie Shen, and Meizhen Yin ACS Sustainable Chem. Eng., Just Accepted Manuscript • DOI: 10.1021/ acssuschemeng.9b00004 • Publication Date (Web): 13 Feb 2019 Downloaded from http://pubs.acs.org on February 25, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sustainable Chemistry & Engineering

A Facile-Synthesized Star Polycation is Constructed as A Highly Efficient Gene Vector in Pest Management Jianhao Li,† Jin Qian,‡ Yuanyuan Xu,‡ Shuo Yan,‡ Jie Shen,*‡ and Meizhen Yin*† †

State Key Laboratory of Chemical Resource Engineering, Beijing Advanced Innovation Center for Soft Matter Science and Engineering, BAIC-SM, Beijing Laboratory of Biomedical

Materials，Beijing University of Chemical Technology, No. 15 the North Third Ring Road East, Chaoyang District, Beijing 100029, PR China ‡

Department of Entomology and MOA Key Laboratory for Monitory and Green Control of Crop

Pest, China Agricultural University, No. 2 Yuanmingyuan West Road, Haidian District, Beijing 100193, PR China Correspondence to J. Shen and M. Yin, Email: [email protected]; [email protected]

ACS Paragon Plus Environment

1

ACS Sustainable Chemistry & Engineering 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 25

ABSTRACT Gene vectors have been extensively applied in various fields. However, the high economic cost of gene vectors limits their development and application, and there is an urgent demand of developing highly efficient gene vectors with low cost, especially for large-scale application. Here, we reported a simple but effective star polycation as gene vector for pest management. Our polycation was constructed by commercial and cheap material sources, and the facile synthesis procedure was simplified to 2 reaction steps, decreasing the cost to a large extent. This vector showed a low cytotoxicity as well as a high gene delivery efficacy into live cells. The vector-doublestranded RNA (dsRNA) down-regulated the pest key developmental gene expression to inhibit the pest growth. Our work provides an efficient gene vector with low cost for scientific researches, which may also promote the practice and development of RNA interference (RNAi)-based pest management.

KEYWORDS: Star polycation, gene vector, low-cost, facile-synthesized, pest management.


2

Page 3 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION During the past decade, genetic engineering has attracted the worldwide research interests, especially delivering nucleic acids to modulate specific protein expression in numerous biological processes.1 Because the free oligonucleotides, DNA and siRNA are rapidly degraded, and their introduction into cells needs a positive charge vector to deliver by electrostatic interaction. 2 In general, the current gene vectors are divided into two categories: virus vectors and synthetic vectors. A recombinant virus allows an efficient transfection with low DNA dose, but it is associated with safety problem and hard to produce in large-scale.3 Meanwhile, the non-viral vectors, especially the synthetic vectors, have attracted more attentions because of their potential for limited immunogenicity, their ability to accommodate and deliver large-size genetic materials, and the potential for modification of their surface structures. 4 Among them, the great efforts have therefore been devoted to develop polycations as the gene vectors.5 The rationale is that polycations pack large gene coils into nano particle by charge neutralizing, which prevents gene degradation and facilitates its cellular uptake through endocytosis pathways.6 In addition, polycations have a great potential for their chemical versatility and large-scale production.7 To date, polyethylenimine (PEI),8 poly(amidoamine) (PAMAM)9 and poly (2-N- (dimethyl aminoethyl) methacrylate) (PDMAEMA) 10 are the most frequently used polycations. PEIs, with multi primary, secondary, and tertiary amines in the structure, have an excellent gene transfection but a high toxicity with the increase of molecular weight.11 Dendrimer PAMAMs exhibit a good transfection efficiency and a low cytotoxicity, whereas their synthesis and purification are difficult.12 PDMAEMA is a biocompatible, water-soluble, and weak cationic polycation, which exhibits both pH and temperature responsive behavior. 13 In addition, the monomer 2-N-(dimethyl aminoethyl) methacrylate (DMAEMA) is a commercially available and


3


Page 4 of 25

inexpensive chemical raw material. The polymerization of DMAEMA is usually conducted in Atom Transfer Radical Polymerization (ATRP), which can control the repeat unit and the structure of the final product precisely.14 Despite the great progress in the area of medical and pharmaceutical sciences, there is still a wide knowledge gap regarding the potential application of vectors in agriculture for pest management.15 A variety of parameters are required for an ideal gene vector with respect to environment safety, high transfection and low-cost for massive application.16,17 Chitosan is one of the most widely used vectors in the field of agricultural, which relies on its structural and biological properties with a cationic character, solubility in aqueous acidic media, and biodegradability. 18 Nevertheless, challenges still exist regarding to the transfection efficiency of chitosan gene delivery vector.19 Even though synthesized polycations have a high gene transfection efficiency, the synthesis process is labor-consuming, and the economic cost is high, which restrain the largescale application for pest management. Therefore, an ideal vector with both high efficiency gene delivery and low cost may provide more advantages than traditional vectors in agricultural application.20 In this study, we develop a star polycation (SPc) acting as a highly efficient but low-cost gene vector for pest management. Pentaerythritol, a common commercial chemical source, was synthesized as the star initiator to initiate polymerization of DMAEMA in a facile operation. The purification of the crude product was optimized to simplify the operation and decrease the organic solvent usage. The cell-penetrating ability and the gene transfection efficacy of SPc were assayed both in vitro and in vivo. The goal of this study is to develop synthetic gene vector with low cost, low cytotoxicity and high gene transfection efficacy for pest management.


4

Page 5 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


EXPERIMENTAL SECTION Synthesis of star initiator (Pt-Br). Pentaerythritol (98%, Alfa Aesar) was recrystallized from water and dried under vacuum. 2-Bromo-2-methylpropionyl bromide and triethylamine were purchased from HEOWNS. Other agents were obtained from Beijing Chemical works. The star initiator Pt-Br was synthesized as the previous report.21,22 In brief, 2-Bromo-2-methylpropionyl bromide (253 mg, 1.11 mmol) was added dropwise into the pentaerythritol solution (25 mg, 0.18 mmol) in dry tetrahydrofuran (THF, 20 mL) and triethylamine (TEA, 111.3 mg, 1.11 mmol) at 0 °C. After stirring 24 h at room temperature, the reaction was quenched with methanol. The solvent was removed under the reduced pressure and the residue recrystallized in cold ether to afford Pt-Br (50 mg, 40%) as a white powder. 1H NMR (400 MHz, CDCl3, Bruker 400) δ 4.33 (s, 8H), 1.94 (s, 24H). Synthesis of star polycation (SPc). N, N, N’, N’, N’’-Pentamethyl diethylenetriamine (PMDETA, 98%), and CuBr (99.999%) were purchased from Sigma Aldrich. 2-(dimethyl amino) ethyl methacrylate (DMAEMA, 99%) were purchased from Energy Chemical and distilled under a vacuum. A flask equipped with a magnetic stirrer was charged with the initiator Pt-Br (40 mg, 0.055 mmol), DMAEMA (2.2 g, 7.7 mmol) and dry THF (8 mL). The mixture was degassed by nitrogen for 30 min. CuBr (46 mg, 0.22 mmol) and PMDETA (110 mg, 0.44 mmol) were added. The flask was sealed and the polymerization was carried out in an oil bath at 60 °C for 7 h. The reaction was quenched by cooling down and air exposure. After removal of THF in a rotary evaporator, the crude polymer was purified by dialysis in water for four times, prior to being dried under reduced pressure. The product of white powder was obtained (1.8 g, 80%). The structure of SPc was confirmed by 1H NMR (400 MHz, D2O, Bruker 400) and the molecular weight was analyzed by GPC (Shimadzu LabSolutions GPC).


5


Page 6 of 25

Preparation of the SPc–DNA complexes. Agarose gel electrophoresis was applied to determine

the

purity.

The

concentration

of

synthesized

DNA

fragments

(TGCTTGGGACGTAATGCAAG) was measured by absorption at 260 and 280 nm. An average weight of 325 per phosphate group of DNAs was assumed. All SPc–DNA complexes were formed by mixing SPc and DNA solutions at various mass ratio. Each mixture was vortexed and incubated for 30 min at room temperature, before loaded on a 1.5% agarose gel. SPc was examined for its ability to bind DNA through agarose gel electrophoresis at 110 V for 20 min in TAE buffer solution (1 mM EDTA, 0.114% glacial acetic acid, 40 mM Tris Base). The image was captured under UV light. Particle size and zeta potential measurements. SPc was dissolved in deionized (DI) water to form nanoparticles. The particle size and zeta potential of the SPc and SPc-DNA complexes were tested in triplicate at 25 °C with a Zetasizer Nano ZS (Malvern Instruments, Southborough, MA). The morphology of the SPc and SPc-DNA complexes were measured by scanning electron microscopy (SEM, JSM-7500F). In vitro cell uptake of SPc. At room temperature, SPc and the DNA fragments labelled with Gel-Red (Biotium, USA) were incubated at different mass ratios of 1/8, 1/4, 1/2, 1/1 and 2/1 for 0.5 h before adding into the Drosophila S2 cell medium. Gel-red was added to all treatments. The labeled DNA and SPc were used as control. After incubating for 48 h, the fluorescence images were captured by fluorescence microscopy (EVOS, USA). Cytotoxicity assay. Cytotoxicity was characterized by the cell survival ratios (the percentage of viable cells to total cells). S2 cells were seeded into 35 × 35 mm2 cell culture dishes at a seeding density of 2.5 ×105cells per well. After seeding for 7 h, the divided S2 cells adhesion to the bottoms of dishes were incubated with SPc at a concentration of 0.5 μM, 1.0μM, 1.5 μM, 2.0μM, and 2.5


6

Page 7 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


μM, respectively. The commercial gene vector PEI (25 kDa) at working concentration of 1.0 μM was added into another dishes as controls. After 48 h incubation, the old culture medium was replaced with fresh medium mixed with 1% Tali viability kit-Dead Cell Green (Invitrogen, Catalog A10787) for 30 min. The Dead Cell Green Dye would mark the dead cells instead of live cells with green fluorescence, for the viable cells with integrated cell membrane would keep Dead Cell Green Dye outside cells. The quantitative calculation of apoptotic and normal cells was performed through a fluorescent microscope (EVOS f1, AMG). To investigate the toxicity of vector-DNA complex, SPc, DNA and SPc–DNA complexes were separately incubated with the S2 cells for 48 h in cell medium of different concentrations (DNA: 0, 2, 4, 8, 16 ng/μL, SPc: 2, 4, 8, 16, 40 ng/μL), and then 100 μL cell medium was incubated with 1 μL Dead Cell Green (1:100 dilution (Invitrogen, USA)) for 0.5 h. The 0 ng/μL DNA was set as control. The cell viability was tested as mentioned above. Gene transfection assay. The plasmid DNA (pDNA) expressing Green Fluorescent Protein (GFP, Clontech, USA) was used to test the cell transfection efficiency on the S2 cell line. Incubating the SPc with pDNA (100 ng) solution at a mass ratio of 1/1 for 15 min at room temperature to prepare the SPc–pDNA complexes before adding into the cell medium. pDNA alone and sterile water were set as controls. After 48 h transfection, the fluorescence images were captured by fluorescence microscopy. The green fluorescence was used to determine the GFP expression since no fluorophore in SPc. SPc-mediated RNA interference (RNAi) in Agrotis ypsilon. RNA extraction is performed using Total RNA Kit (Tiangen, China), and cDNA reverse transcription was performed according to the TIANScript cDNA first strand synthesis kit. Doublestranded RNA (dsRNA) of the VATPase was prepared by using T7 RiboMAX expression RNAi system (Promega, USA). The 4


7


Page 8 of 25

μg dsV-ATPase was incubated with SPc by the best mass ratios for 0.5 h and injected into the third instar larva of A. ypsilon. The 6 μg of dsV-ATPase was incubated with SPc similarly and treated the second instar larva of A. ypsilon by oral feeding. dsRNA and dsGFP were used as control. After 24 h, the transcriptional changes of V-ATPase were analyzed by quantitative reverse transcript-PCR (qRT-PCR) using TransStart Top Green qPCR SuperMix, with RPS-15 used as a reference gene. After 72 h, the photos of each groups were captured for comparison by fluorescence microscopy (EVOS, USA). Specific primers and sequences of synthesis of dsRNA and RT-PCR were listed in Table S1.

RESULTS AND DISCUSSION Using nanoparticle to deliver dsRNA toward genetic control of pests has emerged due to its potential to revolutionize pest management.23-25 Up to date, we have developed several fluorescence perylenediimide-based vectors for effective gene and protein delivery.26-28 Considering the potential of large-scale application in field, the development of gene vectors with both high gene transfection and low cost is badly needed. Moreover, the star-shaped structure has a high density of functional groups and unique chemical properties of dendrimers, which is considered as good candidates for mass production of functional polymers. 29-31 In this work, the star initiator Pt-Br was successfully synthesized based on the commercially available pentaerythritol with high yield (>90%). The structural characterization was confirmed by 1H NMR (Figure S1). The polymerization of Pt-Br and DMAEMA was carried out under nitrogen atmosphere, which is an important step to prevent the catalyst deactivation (Scheme 1A). At the end of polymerization, solvent (THF) was firstly removed by rotary evaporator and re-used in the next polymerization, which is benefit for cost reduction. To remove the residual reagents


8

Page 9 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(DMAEMA, copper, PMDETA), dialysis was carried out to purify the crude product in pure water for 4 times, as shown in Scheme 1B. The final product SPc was obtained as white powder after freeze-dried to remove water. The successful polymerization of DMAEMA into polymer structures for SPc was clearly confirmed by 1H NMR (Figures S2). The purified polymer was analyzed by GPC in H2O using glucan as the standard for estimation of molecular weights, which showed unimodal distributions in GPC traces (Table S2) with low molecular weight distributions (Mw/Mn < 1.5). Both NMR and GPC data showed the structure of SPc, which indicated that our synthesis procedure was successful to produce pure product. Compared with the previous methods using aluminum oxide column or precipitation for purification,32-35 dialysis was used in the purification procedure. This strategy not only improved the purity of SPc, but also simplified the operation.36-39 In addition, our synthesis method decreased the usage of chemical agent and simplified the synthesis procedure, which decreased the production cost (Table S3-S4) to meet the need of massive production in practice. We believe that the cost can be decreased to a large extend if the procedure is expanded.


9


Page 10 of 25

Scheme 1. (A) Synthesis route of Pt-Br and SPc. i: 2-Bromo-2-methylpropionyl bromide, TEA, THF, 0 °C to room temperature; ii: DMAEMA, PDMAEMA, CuBr, THF, 60 °C. (B) Schematic illustration of the preparation procedure of SPc. The gene condensation capabilities of SPc were measured by the particle size and zeta potential charge. Owing to the amine group in the side chain, SPc was positive charge (+20.9 mV) and could bind the negative charge DNA, decreasing the zeta potential to +4.0 mV (Table 1). Meanwhile, the size of SPc-DNA increased to 260 nm tested by DLS and SEM (Figure 1). No obvious change was found in particle size and zeta potential during the course of 10 days (FigureS3), indicating the excellent stability of SPc. These data confirmed that SPc was successfully interacted with gene to form stable nano particle.


10

Page 11 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. SEM images of (A) SPc and (B) SPc-DNA complex, scale bar = 500 nm.

Table 1. Particle size and zeta potential of SPc and SPc-DNA complex. SPc

SPc-DNA

size (nm)

100.5

260.0

Zeta potential (mv)

+20.9

+4.0

For the cellular transfection, SPc and gene must form a stable complex in the solution. Agarose gel retardation assay was performed to study the stability of SPc-DNA complexes at various mass ratios. As shown in Figure 2A, the band’s intensity of the migrated DNA gradually decreased with the increasing mass ratios, indicating SPc had the excellent performance in binding DNA and ensuring the stability of the nanocarrier-DNA complexes. To study the ability of DNA delivery into live cells, Drosophila S2 cells were incubated with the SPc-DNA complexes at various mass ratios. Because the DNA was conjugated with Gel-Red, the DNA could be traced by the detectable fluorescent signal in vitro. As shown in Figure 2B-C, the fluorescence intensity of DNA inside the cells in the SPc-DNA treatment was higher than that of DNA alone, suggesting that more DNA


11


Page 12 of 25

was delivered into cells with the help of SPc. The best mass ratio was 1/1 from the data of fluorescence intensity, which clearly highlighted that our economical and practical cationic SPc could bind DNA and be internalized into cells as an efficient gene vector. Perylenediimide-cored cationic dendrimer (G2) was investigated as an advanced fluorescent gene vector with higher transfection than commercial PEI in vivo. 40,41 We found that SPc possessed the same best mass ratio as G2 (1/1, data not shown), which confirmed the excellent gene delivery efficiency of SPc as G2. In addition, compared with G2 and PEI, the economic synthesis and efficient gene delivery make SPc more suitable for large-scale product and application. 42

Figure 2. (A) Gel electrophoresis assay of DNA retardation by SPc at various SPc/DNA mass ratios. (B) Fluorescence intensities of DNA delivered by SPc in cells at different SPc/DNA mass ratios. (C) Fluorescence images of SPc-DNA (mass ratio is 1/1) and DNA in cells after 48 h incubation. a’, b’ and c’ are separated channels of DNA fluorescence, scale bar = 150 μm.


12

Page 13 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The gene transfection in vitro was examined via a GFP plasmid. As shown in Figure 3, neglectable fluorescence signals of GFP were found in the cells of control or GFP plasmid alone treatment. In remarked contrast, a strong green fluorescence signal was observed when cells were incubated with SPc-GFP plasmid, suggesting that SPc was an efficient gene vector for in vitro applications.

Figure 3. GFP expression of the (A) water, (B) GFP plasmid and (C) SPc-GFP plasmid in cells. A’, B’ and C’ are separated channels of GFP fluorescence, scale bar = 150 μm. Biosafety is an essential characterization of nano vector for in vivo application.43-46 To investigate the cytotoxicity, the SPc and SPc–DNA complexes were assessed by a cytotoxicity assay using S2 cells. Compared with the commercial gene vector PEI (25 kDa), SPc has much lower cytotoxicity and much better biocompatibility (Figure S4). As shown in Figure 4, no obvious cell death indicated by Dead Cell Green could be detected in the cells after incubated with SPcDNA at mass ratios of 1/1. The reason is that dialysis was easily and effectively to remove the


13


Page 14 of 25

toxic regent.47-49 Owing to the compact tertiary amine in four arms, SPc possesses high gene transfection efficiency even in relative low dose, which improves the biosafety in application.

Figure 4. (A) Cytotoxicity assay of SPc-DNA at various concentrations. (B) Fluorescence image of cell death (green) of control and SPc-DNA. a’ and b’ are separated channels of death cell fluorescence, scale bar = 150 μm. Compared with traditional pest management with chemical pesticides, RNAi-based pest management has high specificity to the target species, which is considered as a green and sustainable method in agriculture.50-52 Above results indicate that our new vector might be suitable for in vivo DNA or RNA delivery. We ask whether our vector could deliver the dsRNA to achieve RNAi effect for pest management. As feeding and injection are commonly used delivery methods of dsRNA53-55, the A. ypsilon larvae were selected and treated with the SPc-dsV-ATPase complex via the two method respectively. Larvae treated with the same amount of either dsV-ATPase or dsGFP were set up for comparison. Firstly, the RT-PCR result indicated that the SPc- dsV-ATPase complexes knocked down V-ATPase gene more efficiently, compared to the dsRNA alone treatment (Figure 5A). As shown in Figure 5B, four-day post oral feeding, the body lengths of the larvae, fed with SPc-dsRNA complexes, were obviously reduced compared with the control group


14

Page 15 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(dsGFP), suggesting an apparent effect of growth inhibition. Our results demonstrated that SPc were suitable as an effective gene carrier for in vivo applications. .

Figure 5. (A) SPc-dsV-ATPase complexes knocked down the target gene efficiently after oral feeding and injection. (B) A. ypsilon larvae’s body length was apparently reduced by the SPc-dsVATPase complexes treatment. CONCLUSION In summary, we developed a star polycation (SPc) as an efficient but low-cost gene vector for pest management. The chemical sources of SPc were cheap and easily available. In addition, dialysis was applied in the purification procedure instead of the aluminum oxide column or precipitation, to avoid the excess usage organic solvents that were expansive and toxic. These efforts not only simplified the synthesis and purification, but also decreased the cost to a large extent. SPc has four arms in one core with compact tertiary amine, which endows with high gene transfection efficiency. The gene vector can deliver dsRNA to knock down insect gene expression


15


Page 16 of 25

and inhibit the pest growth. In vitro and in vivo experiments results indicated the gene delivery efficiency of SPc is as high as previous reported vector (G2), and with a great advantage of much lower manufacture cost. Overall, we prepared a facile-synthesized star polycation as the simple, economic, and efficient gene vector for pest management.

ASSOCIATED CONTENT Supporting Information Spectrums of NMR. Figures of stability test and toxicity test. Tables of GPC data, gene sequences and cost accounting.

AUTHOR INFORMATION Corresponding Author * Email: [email protected]. (J. Shen) * Email: [email protected]. (M. Yin)

ACKNOWLEDGMENT This research was financially supported by the Beijing Natural Science Foundation (6182020) and the National Natural Science Foundation (21774007, 21574009 and 31872295) and Fundamental Research Funds for the Central Universities (PT1811) and Beihuazhongri United Fund (PYBZ1822). REFERENCES


16

Page 17 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(1)

Leung, H. M.; Chan, M. S.; Liu, L. S.; Wong, S. W.; Lo, T. W.; Lau, C.-H.; Tin, C.; Lo, P.

K. Dual-function, cationic, peptide-coated nanodiamond systems: facilitating nuclear-targeting delivery for enhanced gene therapy applications. ACS Sustainable Chem. Eng. 2018, 6, 9671-9681. (2) Cassinelli, V.; Oberleitner, B.; Sobotta, J.; Nickels, P.; Grossi, G.; Kempter, S.; Frischmuth, T.; Liedl, T.; Manetto, A. One-step formation of "chain-armor"-stabilized DNA nanostructures. Angew. Chem., Int. Ed. 2015, 54, 7795-7798. Angew. Chem. 2015, 127, 7905-7090. (3)

Evans, C. H.; Ghivizzani, S. C.; Robbins, P. D. Arthritis gene therapy's first death. Arthritis

Res. Ther. 2008, 10, 110. (4)

Zhou, J.; Liu, J.; Cheng, C. J.; Patel, T. R.; Weller, C. E.; Piepmeier, J. M.; Jiang, Z.;

Saltzman, W. M. Biodegradable poly(amine-co-ester) terpolymers for targeted gene delivery. Nat. Mater. 2011, 11, 82-90. (5)

Lachelt, U.; Wagner, E. Nucleic acid therapeutics using polyplexes: a journey of 50 years

(and Beyond). Chem. Rev. 2015, 115, 11043-11078. (6)

Ponnuswamy, N.; Bastings, M. M. C.; Nathwani, B.; Ryu, J. H.; Chou, L. Y. T.; Vinther,

M.; Li, W. A.; Anastassacos, F. M.; Mooney, D. J.; Shih, W. M. Oligolysine-based coating protects DNA nanostructures from low-salt denaturation and nuclease degradation. Nat. Commun. 2017, 8, 15654. (7)

Jin, L.; Zeng, X.; Liu, M.; Deng, Y.; He, N. Current progress in gene delivery technology

based on chemical methods and nano-carriers. Theranostics 2014, 4, 240-255.


17


(8)

Page 18 of 25

Wang, P.-Y.; Lian, Y.-S.; Chang, R.; Liao, W.-H.; Chen, W.-S.; Tsai, W.-B. Modulation

of PEI-mediated gene transfection through controlling cytoskeleton organization and nuclear morphology via nanogrooved topographies. ACS Biomater. Sci. Eng. 2017, 3, 3283-3291. (9)

Wang, B.; Sun, Y.; Davis, T. P.; Ke, P. C.; Wu, Y.; Ding, F. Understanding effects of

pamam dendrimer size and surface chemistry on serum protein binding with discrete molecular dynamics simulations. ACS Sustainable Chem. Eng. 2018, 6, 11704-11715. (10) Li, Y.; Xu, B.; Bai, T.; Liu, W. Co-delivery of doxorubicin and tumor-suppressing p53 gene using a POSS-based star-shaped polymer for cancer therapy. Biomaterials 2015, 55, 12-23 (11) Liu, S.; Zhou, D.; Yang, J.; Zhou, H.; Chen, J.; Guo, T. Bioreducible zinc (II)-coordinative polyethylenimine with low molecular weight for robust gene delivery of primary and stem cells. J. Am. Chem. Soc. 2017, 139, 5102-5109. (12) Sun, Y.; Jiao, Y.; Wang, Y.; Lu, D.; Yang, W. The strategy to improve gene transfection efficiency and biocompatibility of hyperbranched PAMAM with the cooperation of PEGylated hyperbranched PAMAM. Int. J. Pharmaceut. 2014, 465, 112-119. (13) Cheng, L.; Li, Y.; Zhai, X.; Xu, B.; Cao, Z.; Liu, W. Polycation-b-polyzwitterion copolymer grafted luminescent carbon dots as a multifunctional platform for serum-resistant gene delivery and bioimaging. ACS Appl. Mater. Interfaces 2014, 6, 20487-20497 (14) Matyjaszewski, K.; Tsarevsky, N. V. Nanostructured functional materials prepared by atom transfer radical polymerization. Nat. Chem. 2009, 1, 276-288. (15) Rai, M.; Ingle, A. Role of nanotechnology in agriculture with special reference to management of insect pests. Appl. Microbiol. Biot. 2012, 94, 287-293.


18

Page 19 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(16) Borgatta, J.; Ma, C.; Hudson-Smith, N.; Elmer, W.; Plaza Pérez, C. D.; De La Torre-Roche, R.; Zuverza-Mena, N.; Haynes, C. L.; White, J. C.; Hamers, R. J. Copper based nanomaterials suppress root fungal disease in watermelon (citrullus lanatus): role of particle morphology, composition and dissolution behavior. ACS Sustainable Chem. Eng. 2018, 6, 14847-14856. (17) Liu, H.; Wang, H.; Yang, W.; Cheng, Y. Disulfide cross-linked low generation dendrimers with high gene transfection efficacy, low cytotoxicity, and low cost. J. Am. Chem. Soc. 2012, 134, 17680-17687. (18) Strand, S. P.; Lelu, S.; Reitan, N. K.; de Lange Davies, C.; Artursson, P.; Varum, K. M. Molecular design of chitosan gene delivery systems with an optimized balance between polyplex stability and polyplex unpacking. Biomaterials 2010, 31, 975-987. (19) Bowman, K.; Leong, K. W. Chitosan nanoparticles for oral drug and gene delivery. Int. J. Nanomed. 2006, 1, 117-128. (20) Wightman, L.; Kircheis, R.; Rossler, V.; Carotta, S.; Ruzicka, R.; Kursa, M.; Wagner, E. Different behavior of branched and linear polyethylenimine for gene delivery in vitro and in vivo. J. Gene Med. 2001, 3, 362-372. (21) Yuan, W.; Yuan, J.; Zhou, M.; Pan, C. Synthesis, characterization, and fluorescence of pyrene‐containing eight‐arm star‐shaped dendrimer‐like copolymer with pentaerythritol core. J. Polym Sci. Pol. Chem. 2008, 46, 2788-2798. (22) Saikia, B. J.; Das, D.; Boruah, M.; Dolui, S. K. Synthesis and fluorescence properties of star‐shaped polymers carrying two fluorescent moieties. Polym. Int. 2014, 63, 1047-1055.


19


Page 20 of 25

(23) Rosso, M. N.; Jones, J. T.; Abad, P. RNAi and functional genomics in plant parasitic nematodes. Annu. Rev. Phytopathol. 2009, 47, 207-232. (24) Parsons, K. H.; Mondal, M. H.; McCormick, C. L.; Flynt, A. S. Guanidiniumfunctionalized interpolyelectrolyte complexes enabling RNAi in resistant insect pests. Biomacromolecules 2018, 19, 1111-1117. (25) Kumar, S.; Nehra, M.; Dilbaghi, N.; Marrazza, G.; Hassan, A. A.; Kim, K. H. Nano-based smart pesticide formulations: emerging opportunities for agriculture. J. Control. Release, 2019, 294, 131-153. (26) He, B.; Chu, Y.; Yin, M.; Mullen, K.; An, C.; Shen, J. Fluorescent nanoparticle delivered dsRNA toward genetic control of insect pests. Adv. Mater. 2013, 25, 4580-4584. (27) Liu, K.; Xu, Z.; Yin, M. Perylenediimide-cored dendrimers and their bioimaging and gene delivery applications. Prog. Polym. Sci. 2015, 46, 25-54. (28) Zheng, Y.; You, S.; Ji, C.; Yin, M.; Yang, W.; Shen, J. Development of an amino acidfunctionalized fluorescent nanocarrier to deliver a toxin to kill insect pests. Adv. Mater. 2016, 28, 1375-1380. (29) Yang, D.-P.; Oo, M. N. N. L.; Deen, G. R.; Li, Z.; Loh, X. J. Nano-star-shaped polymers for drug delivery applications. Macromol. Rapid Commun. 2017, 38, 1700410. (30) Dirlam, P. T.; Goldfeld, D. J.; Dykes, D. C.; Hillmyer, M. A. Polylactide foams with tunable mechanical properties and wettability using a star polymer architecture and a mixture of surfactants. ACS Sustainable Chem. Eng. 2019, 7, 1698-1706.


20

Page 21 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(31) Michalski, A.; Brzezinski, M.; Lapienis, G.; Biela, T. Star-shaped and branched polylactides: synthesis, characterization, and properties. Prog. Polym. Sci. 2019, 89, 159-212. (32) Van de Wetering, P.; Cherng, J.-Y.; Talsma, H.; Crommelin, D.; Hennink, W. 2(Dimethylamino) ethyl methacrylate based (co) polymers as gene transfer agents. J. Control. Release 1998, 53, 145-153. (33) Chrysostomou, V.; Pispas, S. Stimuli‐responsive amphiphilic PDMAEMA‐b‐PLMA copolymers and their cationic and zwitterionic analogs. J. Polym Sci. Pol. Chem. 2018, 56, 598610. (34) Cheng, Y.; Yumul, R. C.; Pun, S. H. Virus‐inspired polymer for efficient in vitro and in vivo gene delivery. Angew. Chem., Int. Ed. 2016, 55, 12013-12017. Angew. Chem. 2016, 128, 12192–12196 (35) Liu, X.; Yin, H.; Zhang, Z.; Diao, B.; Li, J. Functionalization of lignin through ATRP grafting of poly (2-dimethylaminoethyl methacrylate) for gene delivery. Colloids Surf. B: Biointerfaces 2015, 125, 230-237. (36) Ishizu, K.; Satoh, J.; Sogabe, A. Architecture and solution properties of AB-type brushblock-brush amphiphilic copolymers via ATRP techniques. J. Colloid Interf. Sci. 2004, 274, 472479. (37) Averick, S. E.; Magenau, A. J. D.; Simakova, A.; Woodman, B. F.; Seong, A.; Mehl, R. A.; Matyjaszewski, K. Covalently incorporated protein–nanogels using AGET ATRP in an inverse miniemulsion. Poly. Chem. 2011, 2, 1476-1478


21


Page 22 of 25

(38) Le Droumaguet, B.; Velonia, K. In situ ATRP-mediated hierarchical formation of giant amphiphile bionanoreactors. Angew. Chem. Int. Ed. 2008, 47, 6263-6266. Angew. Chem. 2008, 120, 6359-6362. (39) Li, J.; Xiao, H.; Kim, Y. S.; Lowe, T. L. Synthesis of water-soluble cationic polymers with star-like structure based on cyclodextrin core via ATRP. J. Polym. Sci. Pol. Chem. 2005, 43, 63456354. (40) Shen, D.; Zhou, F.; Xu, Z.; He, B.; Li, M.; Shen, J.; Yin, M.; An, C. Systemically interfering with immune response by a fluorescent cationic dendrimer delivered gene suppression. J. Mater. Chem. B. 2014, 2, 4653-4659. (41) Jiang, L.; Ding, L.; He, B.; Shen, J.; Xu, Z.; Yin, M.; Zhang, X. Systemic gene silencing in plants triggered by fluorescent nanoparticle-delivered double-stranded RNA. Nanoscale. 2014, 6. 9965-9969. (42) Xu, Z.; He, B.; Shen, J.; Yang, W.; Yin, M. Systemic gene silencing in plants triggered by fluorescent nanoparticle-delivered doublestranded RNA. Chem. Commun. 2013, 49, 3646-3648 (43) Ji, C.; Gao, Q.; Dong, X.; Yin, W.; Gu, Z.; Gan, Z.; Zhao, Y.; Yin, M. A size-reducible nanodrug with an aggregation-enhanced photodynamic effect for deep chemo-photodynamic therapy. Angew. Chem. Int. Ed. 2018, 57, 11384-11388.Angew. Chem. 2018, 130, 11554-11558. (44) Gao, Q.; Zhang, X.; Yin, W.; Ma, D.; Xie, C.; Zheng, L.; Dong, X.; Mei, L.; Yu, J.; Wang, C.; Gu, Z.; Zhao, Y. Functionalized MoS2 Nanovehicle with Near-Infrared Laser-Mediated Nitric Oxide Release and Photothermal Activities for Advanced Bacteria-Infected Wound Therapy. Small 2018, 14, e1802290.


22

Page 23 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(45) Oh, J. K.; Siegwart, D. J.; Lee, H.-i.; Sherwood, G.; Peteanu, L.; Hollinger, J. O.; Kataoka, K.; Matyjaszewski, K. Biodegradable nanogels prepared by atom transfer radical polymerization as potential drug delivery carriers: synthesis, biodegradation, in vitro release, and bioconjugation. J. Am. Chem. Soc. 2007, 129, 5939-5945 (46) Zhang, S.; Li, J.; Wei, J.; Yin, M. Perylenediimide chromophore as an efficient photothermal agent for cancer therapy. Sci. Bull. 2018, 63, 101-107 (47) Wei Hsu, B. Y.; Wang, M.; Zhang, Y.; Vijayaragavan, V.; Wong, S. Y.; Yuang-Chi Chang, A.; Bhakoo, K. K.; Li, X.; Wang, J. Silica–F127 nanohybrid-encapsulated manganese oxide nanoparticles for optimized T1 magnetic resonance relaxivity. Nanoscale 2014, 6, 293-299 (48) Hsu, B. Y. W.; Ng, M.; Zhang, Y.; Wong, S. Y.; Bhakoo, K.; Li, X.; Wang, J. A hybrid silica nanoreactor framework for encapsulation of hollow manganese oxide nanoparticles of superior T1 magnetic resonance relaxivity. Adv. Funct. Mater. 2015, 25, 5269-5276. (49) Liu, W.; Zhang, X.; Wei, G.; Su, Z. Reduced graphene oxide-based double network polymeric hydrogels for pressure and temperature sensing. Sensors 2018, 18.3162. (50) Bachman, P. M.; Bolognesi, R.; Moar, W. J.; Mueller, G. M.; Paradise, M. S.; Ramaseshadri, P.; Tan, J.; Uffman, J. P.; Warren, J.; Wiggins, B. E.; Levine, S. L. Characterization of the spectrum of insecticidal activity of a double-stranded RNA with targeted activity against western corn rootworm (diabrotica virgifera virgifera leconte). Transgenic Res. 2013, 22, 1207-1222. (51) Lin, Y.-H.; Huang, J.-H.; Liu, Y.; Belles, X.; Lee, H.-J. Oral delivery of dsRNA lipoplexes to German cockroach protects dsRNA from degradation and induces RNAi response. Pest. Manag. Sci. 2017, 73, 960-966.


23


Page 24 of 25

(52) Mamta, B.; Rajam, M. V. RNAi technology: a new platform for crop pest control. Physiol. Mol. Biol. Pla. 2017, 23, 487-501. (53) Christiaens, O.; Smagghe, G. The challenge of RNAi-mediated control of hemipterans. Curr. Opin. Insect. Sci. 2014, 6, 15-21. (54) Huvenne, H.; Smagghe, G. Mechanisms of dsRNA uptake in insects and potential of RNAi for pest control: A review. J. Insect. Physiol. 2010, 56, 227-235. (55) Katoch, R.; Sethi, A.; Thakur, N.; Murdock, L. L. RNAi for insect control: current perspective and future challenges. Appl. Biochem. Biotech. 2013, 171, 847-873.


24

Page 25 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


For Table of Contents Use Only Abstract Graphic:

Synopsis: A facile-synthesized star polycation is developed as an efficient but low-cost gene vector for pest management.


25

A Facile-Synthesized Star Polycation is Constructed as A Highly

Recommend Documents