A Genetic Toolbox for Modulating the Expression of Heterologous

Subscriber access provided by UNIV OF DURHAM

Article

A genetic toolbox for modulating the expression of heterologous genes in the cyanobacterium Synechocystis sp. PCC 6803 Bo Wang, Carrie Eckert, Pin-Ching Maness, and Jianping Yu ACS Synth. Biol., Just Accepted Manuscript • DOI: 10.1021/acssynbio.7b00297 • Publication Date (Web): 12 Dec 2017 Downloaded from http://pubs.acs.org on December 13, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Synthetic Biology is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Synthetic Biology

1

A genetic toolbox for modulating the expression of heterologous genes in the

2

cyanobacterium Synechocystis sp. PCC 6803

3

Bo Wang 1, Carrie Eckert 1,2, Pin-Ching Maness 1, Jianping Yu 1,*

4

1

Biosciences Center, National Renewable Energy Laboratory, 15013 Denver West Parkway, Golden, CO

5 6

80401, USA 2

Renewable and Sustainable Energy Institute, University of Colorado, Boulder, 4001 Discovery Drive,

7

Boulder, CO 80303, USA

8

*Corresponding author: [email protected]

9

10

Abstract

11

Cyanobacteria, genetic models for photosynthesis research for decades, have recently become

12

attractive hosts for producing renewable fuels and chemicals, owing to their genetic tractability,

13

relatively fast growth, and their ability to utilize sunlight, fix carbon dioxide and, in some cases, fix

14

nitrogen. Despite significant advances, there is still an urgent demand for synthetic biology tools in order

15

to effectively manipulate genetic circuits in cyanobacteria. In this study, we have compared a total of 17

16

natural and chimeric promoters, focusing on expression of the ethylene-forming enzyme (EFE) in the

17

cyanobacterium Synechocystis sp. PCC 6803. We report the finding that the E. coli σ70 promoter Ptrc is

18

superior compared to the previously reported strong promoters, such as PcpcB and PpsbA, for the

19

expression of EFE. In addition, we found that the EFE expression level was very sensitive to the 5’-

20

untranslated region upstream of the open reading frame. A library of ribosome binding sites (RBSs) was

21

rationally designed and was built and systematically characterized. We demonstrate a strategy 1 ACS Paragon Plus Environment

ACS Synthetic Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

22

complementary to the RBS prediction software to facilitate the rational design of an RBS library to

23

optimize the gene expression in cyanobacteria. Our results show that the EFE expression level is

24

dramatically enhanced through these synthetic biology tools and is no longer the rate-limiting step for

25

cyanobacterial ethylene production. These systematically characterized promoters and the RBS design

26

strategy can serve as useful tools to tune gene expression levels and to identify and mitigate metabolic

27

bottlenecks in cyanobacteria.

28

Keywords: cyanobacteria, synthetic biology, protein expression, promoter, RBS, ethylene-forming

29

enzyme

30

Graphical Abstract

31 32

2 ACS Paragon Plus Environment

Page 2 of 35

Page 3 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


33

Cyanobacteria have historically contributed to lowering carbon dioxide levels and raising oxygen levels

34

in the atmosphere through oxygenic photosynthesis, representing the closest bacterial homologs of

35

chloroplasts in plants and algae. 1-3 Some cyanobacterial species also play a major role in the nitrogen

36

cycle on earth because of their ability to fix nitrogen. 4 Other merits of cyanobacteria include their

37

relatively small genome size, their genetic tractability, and their fast growth relative to plants. Therefore,

38

cyanobacteria have historically been used as genetic models for studying photosynthesis. 5 More

39

recently, cyanobacteria have become attractive microbial hosts for producing a spectrum of renewable

40

fuels and chemicals from CO2, water, and sunlight. 6, 7 However, compared to the most studied model

41

microorganisms, such as E. coli and yeast, the development of synthetic biology tools has lagged

42

remarkably for cyanobacteria. This impeded not only the study of the fundamental physiology and

43

metabolism but also the efforts in utilizing cyanobacteria to recycle CO2 to curb the climate change.

44

Given that cyanobacteria show remarkable metabolic plasticity that could accommodate the

45

overproduction of biofuels and commodity chemicals, 3, 8, 9 the ability to create enough driving force –

46

sufficient expression of functional, committed enzymes (catalyzing irreversible reactions) – is imperative

47

in order to direct the metabolic flux towards the synthesis of the compounds of interest. In such a

48

context, a collection of strong promoters in the genetic toolbox would be highly desired. However, due

49

to the lack of strong promoters researchers currently have to double, triple and even quadruple the

50

copies of target genes 3, 10, 11 or use high-copy plasmids 12-14 or multiple tandem promoters 15 to enhance

51

the expression of target genes. It is labor-intensive, time-consuming, and often requires multiple

52

antibiotics which may alter the cell physiology and is undesirable for scale-up. Studies involving

53

development and characterization of synthetic biology tools in cyanobacteria have begun to emerge in

54

recent years. Since it is much more challenging to find a stronger rather than a weaker promoter, here

55

we focus on findings for the strong promoters for cyanobacteria. Huang et al. 16 reported that the Ptrc

56

(PtrcO1 or PtrcO2) promoter was at least four times stronger than Plac, Ptet, PR, PrnpB and PrbcL in 3 ACS Paragon Plus Environment


57

Synechocystis sp. PCC 6803 (referred to as Synechocystis hereafter). Albers et al. 17 found that Ptrc

58

without its lacOs was much weaker than PtrcO2 (with two lac operators). Xu et al. 18 and Markley et al.

59

19

60

and several mutated versions of its core promoter Pcpt-c223 (constitutive), Pcpt-cLac109 and Pcpt-

61

cLac143 (when derepressed using IPTG) showed similar YFP expression. Zhou et al. 20 reported a “super

62

strong” promoter, Pcpc560 (PcpcB), for the expression oftrans-enoyl-CoA reductase and D-lactate

63

dehydrogenase in Synechocystis, with resultant protein levels approximately 15% of the total soluble

64

protein.

65

found that PcpcB from Synechocystis behaves as a strong promoter in Synechococcus sp. PCC 7002

Expression of the target genes can also be optimized at the translational level via optimization of the

66

ribosome binding sites (RBSs). Rational design of RBS sequences has been particularly beneficial for

67

tuning gene expression in E. coli since the advent of predictive software. 21-24 However, RBSs behave

68

differently in cyanobacteria versus in E. coli, 25, 26 and RBS prediction software 22-24 sometimes was not

69

able to accurately predict the strength of RBSs in cyanobacteria. 19, 27 This is probably because

70

cyanobacteria possess complicated post-transcriptional gene regulations, 28-31 which are still elusive to

71

the scientific community. Nevertheless, RBS prediction software could still serve as a useful tool to help

72

designing and creating RBS libraries from scratch, which may be subsequently subjected to further

73

optimization for the expression of the target genes when necessary.

74

Ethylene-forming enzyme (EFE) from Pseudomonas syringae pv. phaseolicola PK2 is a pivotal enzyme

75

that confers bioethylene formation in a spectrum of microorganisms, 32, 33 and its crystal structures

76

obtained under various crystallization conditions were solved recently. 34, 35 Cyanobacterial production

77

of ethylene directly from CO2 and sunlight has been achieved by expression of heterologous EFE, 36 and

78

recent studies showed that ethylene formation was limited by the EFE expression in Synechocystis. 3, 10

79

In this study, we report the construction and characterization of a promoter library and an RBS library


Page 4 of 35

Page 5 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


80

for the expression of heterologous genes, mostly using the EFE as an example. We demonstrate that the

81

E. coli σ70 promoter Ptrc is superior to previously reported strong promoters for the expression of EFE.

82

Ptrc is over two-fold stronger than the promoter PpsbA (from chloroplast of the flowering plant

83

Amaranthus hydridus) 2, 3, and is seven times stronger than PcpcB (Pcpc560) 20 and its variants. We

84

present a rational RBS library design strategy that is complementary to the RBS prediction software for

85

optimizing the gene expression in cyanobacteria, which could greatly minimize the pool size of

86

candidate RBSs to be tested and therefore accelerate the strain development process. We demonstrate

87

that the highest EFE expression level using a single copy of the gene expression cassette can reach up to

88

12.6% of the total soluble protein in Synechocystis, the highest EFE expression level reported to date. A

89

comparison of the ethylene productivities versus EFE abundance in Synechocystis strains showed that

90

the EFE expression is no longer the rate-limiting step in cyanobacterial ethylene production. Our study

91

has significantly expanded the synthetic biology tools for protein expression in cyanobacteria, which will

92

accelerate the metabolic engineering in this system.

93

RESULTS AND DISCUSSION

94

Characterization of a promoter library. In our previous study, by using a chimeric promoter, PpsbA*,

95

and a relative strong RBS (RBSv4; Supplementary file 1.1) we were able to achieve a moderately high

96

level of expression of the ethylene-forming enzyme (EFE), high enough to identify the EFE band on an

97

SDS-PAGE gel. 3 Subsequently, using PpsbA* and RBSv4 we were able to demonstrate consistent and

98

strong expression of EFE at three different neutral sites on the chromosome of Synechocystis (Figure S1).

99

The same set of promoter and RBS was also able to confer high level expression of catalase (KatE from E.

100

coli K12; Figure S2) as well as improved expression of two synthetic operons, i.e., the heterologous

101

hydrogenase subunits and their cognate maturation proteins, when compared to expression from the

102

Ptrc promoter with its native RBS (Figure S3). Interestingly, a close variant of the PpsbA*-RBSv4



Page 6 of 35

103

(Supplementary file 1.1) has led to an over 100-fold increase of the limonene productivity relative to

104

that of using the IPTG-inducible Ptrc promoter in another cyanobacterium, Synechococcus elongatus

105

PCC 7942. 2 The 300-bp PpsbA* promoter consists of a 232-bp DNA fragment from the upstream region

106

of the native Synechocystis petE gene (UpetE; -149 to -380 bp from the start codon of petE gene) and a

107

61-bp core PpsbA promoter from the flowering plant A. hybridus, 37 with a 7-bp interspace sequence

108

between UpetE and PpsbA. 3 Through analyzing the core PpsbA promoter sequence we found that the

109

PpsbA promoter contains nucleotide sequences that are highly similar to that of the E. coli σ70 consensus

110

-35 and -10 regions. The -35 region is the exact consensus sequence of TTGACA, and the -10 region,

111

TATACT, is only one nucleotide different from the consensus sequence of TATAAT (Table 1;

112

Supplementary file 1.1).

113

Table 1. Comparison of the DNA sequences for selected core promoters*.

114

* The -35 region is underlined, and the -10 region is double underlined. Promoters

DNA sequences of the core promoter

Relative promoter strength

115 116

PpsbA*

TATTGGTTGACACGGGCGTATAAGACATGTTATACTGTTGAATAACAAG

100

PpsbA*M1

TATTGGTTGACACGGGCGTATAAGACATGTTATAATGTTGAATAACAAG

79 ± 3

PpsbA*M2

TATTGGTTGACACGG─CGTATAAGACATGTTATACTGTTGAATAACAAG

94 ± 2

PpsbA*M3

TATTGGTTGACACGG─CGTATAAGACATGTTATAATGTTGAATAACAAG

77 ± 4

PpsbA*M4

TATTGGTTGACACGG─CGTAT─AGACATGTTATAATGTTGAATAACAAG

36 ± 1

Ptac

GAGCTGTTGACAATTAATCAT──CGGCTCGTATAATGTGTGG

41 ± 4

Ptrc

GAGCTGTTGACAATTAATCAT─CCGGCTCGTATAATGTGTGG

66 ± 5

Ptic

GAGCTGTTGACAATTAATCATCGCGGCTCGTATAATGTGTGG

54 ± 4

In an effort to increase the EFE expression level by strengthening the promoter, we introduced several point mutations in the core promoter region of the strongest PpsbA* promoter. The promoter mutants


Page 7 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


117

were designated PpsbA*M1, PpsbA*M2, PpsbA*M3 and PpsbA*M4 (Table 1, S1). We found that all of

118

these mutated versions were weaker than PpsbA* (79%, 94%, 77% and 36% of the capacity of PpsbA* in

119

expressing EFE; Figure 1). Interestingly, when TATACT was swapped with TATAAT at the -10 region, the

120

promoter strength dropped by ~20% in PpsbA*M1 (compared to PpsbA*) and PpsbA*M3 (compared to

121

PpsbA*M2), indicating that the -10 region sequence TATACT is preferable to TATAAT in Synechocystis.

122

The optimal interspace between the -35 and -10 regions seems to be 17-18 bp since the promoter

123

became much weaker when the interspace was reduced to 16 bp in PpsbA*M4, consistent with the

124

trend regarding the Ptac, Ptrc, and Ptic serial promoters as reported in literature. 17

125

Next, 12 promoters, natural or chimeric, were investigated for their capability in expressing the

126

ethylene-forming enzyme (EFE) in Synechocystis. For cloning purposes an EcoRV restriction site was

127

introduced between the promoter and the RBS in these constructs (RBSv4+EcoRV; Figure 1A, Table S1),

128

which unexpectedly dramatically hampered the EFE expression, decreasing levels to 19% of that before

129

the EcoRV was inserted (Figure S4). However, since EcoRV has been inserted between the promoter

130

sequence and the RBSv4 in all these 12 promoters, it should not affect our study on the relative strength

131

of these promoters. UpetE was a scar resulting from previous cloning for strain development, and

132

deletion of UpetE led to 26% increase of the EFE expression level (PpsbA+EcoRV vs. PpsbA*+EcoRV;

133

Figure S4), indicating that UpetE has a negative effect for PpsbA-mediated expression. When EFE was

134

expressed under the control of the previously reported “super strong” PcpcB promoter (PcpcB4 or

135

Pcpc560) 20 or its truncated versions (i.e., PcpcB3 and PcpcB1), we found that the EFE expression levels

136

were fairly low, reaching only about 30% of that of PpsbA (Figure 1). To test if the identified

137

transcription factor binding sites (TFBSs) 20 upstream of the core PcpcB promoter may serve as an

138

enhancer for other promoters, the 186-bp TFBSs region was cloned and placed upstream of PpsbA. We

139

didn’t observe any significant difference in EFE expression with or without the TFBSs upstream of PpsbA,

140

suggesting that the TFBSs enhancement seen previously may be limited to the PcpcB core promoter. It is 7 ACS Paragon Plus Environment


Figure 1. A promoter library for EFE expression in Synechocystis. (A) The schematic structure of EFE expression cassette. (B) The relative EFE expression levels from the promoter library quantified based on SDS-PAGE. (C) The representative SDS-PAGE gel and the western blotting results. Two biological and two technical replicates for each strain. Error bars indicate standard deviation of two biological replicates. 141

noteworthy that the PcpcB promoter utilized in the previous study was not decoupled from its native

142

RBS, 20 which suggests that the strong expression of the target genes was not owing to the PcpcB 8 ACS Paragon Plus Environment

Page 8 of 35

Page 9 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


143

promoter itself but was likely due to the coupled impact from both the PcpcB and the downstream RBS.

144

Furthermore, the performance of an RBS is usually dependent on the downstream target gene, which

145

means theoretically PcpcB promoter including its native RBS may not always guarantee strong

146

expression of heterologous genes.

147

As shown in Figure 1, all three E. coli σ70 consensus promoters Ptac, Ptrc and Ptic 38 turned out to be

148

stronger than PpsbA and PcpcB. Particularly, Ptrc was the strongest among these three analogous

149

promoters, reaching about 2.4-fold EFE expression compared to PpsbA, and Ptac and Ptic reached 1.5-

150

and 1.7-fold that of PpsbA, respectively. The relative strength of Ptac, Ptrc and Ptic promoters in

151

Synechocystis is different from what has been reported for E. coli, in which Ptac showed higher activity

152

relative to Ptrc and Ptic. 38 In order to examine the impact of UpetE on the other promoters, we placed

153

UpetE upstream of promoter Ptrc. We found the UpetE-Ptrc hybrid promoter was only 70% as strong as

154

the Ptrc promoter alone (Figure 1), consistent with the negative impact of UpetE when placed upstream

155

of PpsbA (Figure S4). Two versions of the native Synechocystis PpsbA2 promoter were also studied for

156

expression of EFE. Since the PpsbA2 promoter is highly regulated at the 5’-untranslated region (UTR), 31

157

these two examined promoter versions differ in the length of the 5’-UTR, PpsbA2-8 being 16-bp shorter

158

than PpsbA2-6 (Table S1). As a result, we found that PpsbA2-8 was 2.3-fold stronger than PpsbA2-6 for

159

EFE expression (Figure 1), implying that compared to PpsbA2-8, PpsbA2-6 may contain extra elements

160

that negatively affect expression levels. The two versions of the PpsbA2 promoter are stronger than

161

PcpcB but weaker than PpsbA, Ptac, Ptrc and Ptic, with PpsbA2-8 reaching 86% of PpsbA and 37% of Ptrc

162

levels (Figure 1). The T7 promoter has been well studied and broadly applied in the expression of

163

heterologous genes in E. coli and was also successfully applied for expressing luxAB in Anabaena. 39 Yet

164

due to limited number of tightly-regulated inducible promoters and the toxicity of the constitutive

165

overexpression of the T7 RNA polymerase in E. coli and Synechocystis, our attempts to use the T7 RNA

166

polymerase and T7 promoter to express EFE in Synechocystis was unsuccessful (data not shown). 9 ACS Paragon Plus Environment


167

To determine whether the tested promoters exhibit similar expression trends at a higher light

168

intensity, we grew strains with one of four representative promoters, i.e., PpsbA, PcpcB4, Ptrc and

169

PpsbA2-8, under the light intensity of 200 microeinsteins m-2 s-1 (hereafter μE m-2 s-1) versus 35 μE m-2 s-1.

170

The relative strength of these four promoters followed roughly the same trend as that seen under 35 μE

171

m-2 s-1 continuous light conditions (Figure 1, S5). However, Ptrc became more prominent, whereas

172

PcbcB4 was apparently suppressed under high light conditions (Figure S5), which is consistent with a

173

previous report that the cpcB promoter was repressed under higher light conditions. 19 In particular, Ptrc

174

is about 7-, 40-, and 4-fold stronger than PpsbA, PcpcB4 and PpsbA2, respectively, under the light

175

intensity of 200 μE m-2 s-1 (Figure S5B).

176

Design and characterization of an RBS library. Given that insertion of a single EcoRV restriction site

177

between the promoter PpsbA* and the RBSv4 caused dramatic decrease of the EFE expression in

178

Synechocystis (Figure S4), we speculate that the 5’-UTR sequence is critical to the EFE expression. We

179

designed and constructed a library consisting of 13 RBSs for optimizing the expression of EFE in

180

Synechocystis. Instead of using the RBS prediction software, i.e., the RBS Calculator, to generate a series

181

of RBSs with a wide range of predicted translation initiative rates (TIRs), we created an RBS library

182

starting from a strong RBS (RBSv4) that was previously obtained with assistance from the RBS Calculator.

183

3

184

the AT-rich region, altering the Shine-Dalgarno (SD) sequence, and adjusting the length and GC content

185

of the spacer sequence (between the SD sequence and the start codon ATG). These principles were

186

demonstrated to be useful in optimizing the RBS in E. coli, 40 but apparently have not been utilized for

187

designing RBS libraries in cyanobacteria. In addition, we included one RBS sequence – RBSv21, predicted

188

by the RBS Calculator Version 2.0 (https://salislab.net) as the one with the highest TIR for EFE expression

189

in Synechocystis, in our library (Figure 2A).

The design strategy employed in the current study include eliminating the GC-rich sequence, disrupting


Page 10 of 35

Page 11 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. The RBS library for EFE expression in Synechocystis. (A) The schematic structure of EFE expression cassette and the RBS sequences. (B) The relative EFE expression levels from the RBS library quantified based on SDS-PAGE. (C) The representative SDS-PAGE gel and the western blotting results for the RBS library. Two biological and two technical replicates for each strain. Error bars indicate standard deviation of two biological replicates. 190 191

As the GC-rich sequence “CCGTTCCC” in the previously published RBS, RBSv4 3 might form a hairpin

192

structure with the SD sequence and hinder the translation of the efe mRNA, it was firstly eliminated in

193

RBSv6. Surprisingly, the EFE expression level barely changed (Figure 2B-C). Alternatively, by swapping a 11 ACS Paragon Plus Environment


194

single guanine (G) with adenine (A) in the SD sequence (AGGAGG to AGGAGA; RBSv9), we found that the

195

relative expression level of EFE increased by 87%. Further disrupting the AT-rich region led to the

196

highest EFE expression level in this study, reaching 254% that of RBSv4 (named as RBSv33). It is

197

noteworthy that the AT-rich region was also disrupted in the second strongest RBS in the library (RBSv32;

198

235% that of RBSv4). While changing the spacer length (ranging from 4 to 8 bp) exhibits very minor

199

effects on the EFE expression (RBSv10, RBSv19 and RBSv31 versus RBSv4), increasing the AT content in

200

the spacer region dramatically decreases the EFE expression level. In this case, the expression level of

201

EFE decreased to 39% and 11% relative to RBSv4 in RBSv13 and RBSv16, respectively. Although replacing

202

the spacer sequence AACAGC (in RBSv9) with GACAGC (RBSv12) apparently had little effect on the

203

expression of EFE, replacing it with the AACGGC (RBSv35) completely suppressed the expression of efe,

204

providing additional evidence for the vital role of this spacer region for RBS function in Synechocystis

205

(Figure 2). We speculate that the latter spacer sequence forms a very strong stem-loop structure with

206

the upstream region of the RBS (Figure S6), which may become the dominant factor to hinder the

207

translational machinery in this case, leading to ribosome stalling or dissociation.

208

Translation efficiencies predicted by software vs. experimental measurements. RBS prediction

209

software is a quite useful tool in helping researchers to design an RBS library from scratch for optimizing

210

the expression of a target gene,22-24 and it aided in our discovery of a relative strong RBS, RBSv4, for the

211

expression of EFE in Synechocystis in a previous study. 3 However, in that initial study we found that the

212

predicted relative translation efficiencies did not match the experimentally measured ones (unpublished

213

data), a problem similarly encountered by others when designing RBS sequences for cyanobacteria. 19, 27

214

Therefore, we implemented an alternative strategy to further increase the EFE expression in

215

Synechocystis. When comparing the predicted translation efficiencies of the library of RBSs using the

216

RBS Calculator Version 2.0 with EFE levels measured experimentally, we uncovered a large extent of

217

discrepancies, consistent with previous studies in cyanobacteria. 19, 27 The strongest predicted RBS, 12 ACS Paragon Plus Environment

Page 12 of 35

Page 13 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


218

RBSv21, although predicted to be 7.6 times stronger than RBSv4, conferred only about 25% of the EFE

219

expression level from RBSv4 (Figures 2, 3). RBSv6, v13, v16 were also predicted to be 2.6-3.7 times

220

stronger than RBSv4, but the corresponding EFE expression levels were markedly lower than that from

221

RBSv4 (Figure 3). On the other hand, some of the RBSs predicted to have lower efficiencies, e.g., RBSv32

222

and v33, turned out to be more efficient for EFE expression (Figure 3).

Figure 3. Comparison of the software-predicted and measured RBS efficiencies. (A) The EFE expression levels from RBSs relative to that from the RBSv4. The red arrow for v35 indicates the EFE expression level was much lower than the most diluted RBSv32/32 sample (7.5% of that of RBSv4) based on the western blotting result in Figure 2C. (B) The overall prediction accuracy was unsatisfactory. Two biological and two technical replicates for each strain. Error bars indicate standard deviation of two biological replicates. 223

The reason may be attributed to the design principle underlying the RBS prediction software which

224

exclusively focuses on calculating the Gibbs free energy change (ΔGtotal) upon a translation event in the

225

model and hence to predict the translation initiation rate. 21-24 The model, however, does not include

226

other relevant important post-transcriptional factors, such as translational enhancers, 29 antisense RNAs,

227

28

228

translation efficiency at least in some cases in cyanobacteria. It has been reported that cyanobacteria

229

possess different RNases as compared to E. coli. 41 In addition, a recent study showed that antisense

and ribonuclease (RNase) target sites, 31 which, rather than the ΔGtotal, apparently dominate the



230

RNAs (asRNAs) occur at regions of nearly 64% of all transcriptional start sites in Synechocystis, 30

231

implying a global post-transcriptional regulation of gene expressions via asRNAs in this strain. 30 For

232

instance, the AT-rich sequence in the 5’-untranslated region of the psbA2 gene is protected from

233

degradation by the complementary asRNA when exposed to light but is a target of RNase that initiates

234

the psbA2 transcripts degradation in darkness. 31 Although investigating these organism-specific post-

235

transcriptional regulation mechanisms is still in the early stage of development, integration of any

236

known information into the models used by available RBS prediction software might improve the

237

prediction accuracy.

238

Quantification of EFE in total soluble proteins in Synechocystis. As shown in Figure 2C, EFE was

239

prominent among all soluble proteins in Synechocystis. By comparing the intensities of the Synechocystis

240

EFE-FLAG bands with purified EFE-FLAG on the SDS-PAGE gel, we estimated that the EFE levels represent

241

11.1 ± 0.8 % and 12.6 ± 1.6 % of the total soluble protein in two of our best EFE-expressing Synechocystis

242

strains, PB752 (RBSv32) and PB753 (RBSv33), respectively (Figure 4). This is already close to the recently

Figure 4. Quantification of the relative EFE abundance in the total soluble protein of the Synechocystis. Rep I, technical replicate 1; Rep II, technical replicate 2; both were loaded with 1.0 µg total soluble protein. WT, wild-type Synechocystis 6803 strain. v32, Synechocystis strain PB752 (RBSv32). v33, Synechocystis strain PB753 (RBSv33). The amounts of purified EFE loaded were indicated on top of each lane. The quantification was based on the fluorescent signal from the EFE protein on SDS-PAGE gel (see details in the section of METHODS).


Page 14 of 35

Page 15 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


243

reported highest heterologous protein expression levels achieved by using a “super-strong” PcpcB

244

promoter in Synechocystis. 20 Since the Ptrc promoter is stronger than PpsbA*(Figure 1), combination of

245

Ptrc with RBSv32 or RBSv33 could potentially lead to even higher level expression of EFE. However, over

246

10% of the total soluble protein being the target protein in Synechocystis is already a decent level, so we

247

decided to move forward to the following enzyme activity study.

248 249

EFE expression level no longer limits ethylene productivity in Synechocystis. Since the EFE

250

expression level was previously determined as the rate-limiting step in cyanobacterial production of

251

ethylene, 3 we investigated if the enhanced EFE expression leads to increased cellular EFE activity, and

252

ultimately ethylene productivity, in vivo. We firstly conducted an in vitro EFE enzyme activity assay with

253

five engineered strains differing in EFE expression levels. As illustrated in Figure 5, the EFE activities

254

exhibited a positive linear relationship with the EFE expression levels. In particular, the EFE activity from

255

the cell extract of strain PB752 (v32) was 2.5-fold higher than that of our previously reported best efe-

256

expressing strain JU547R (v4), 3 which is consistent with the 2.4-fold increased EFE expression level

257

(Figure 2B). In contrast, the increased EFE expression levels did not lead to proportionally enhanced

258

ethylene productivities when measured directly from the Synechocystis cell culture. As shown in Figure 6,

259

while the in vivo ethylene productivity increases proportionally with the increased EFE expression level

260

at relatively low EFE expression ranges (v16 and v13), the further elevated EFE expression levels exerted

261

lesser impact on the specific ethylene productivity. Eventually, the ethylene productivity only increased

262

by about 45% in the strain with the highest EFE expression level (v32) relative to that of strain JU547R

263

(v4). These findings suggest that EFE expression is the bottleneck in cellular ethylene production when

264

the EFE expression level is relatively low, under which scenario the Synechocystis metabolic plasticity

265

may well sustain the substrate supply for photosynthetic ethylene production. However, when the EFE



266

expression level continues to increase, the intrinsic metabolic network is stretched to supply substrates

267

(α-ketoglutarate and arginine), restricting ethylene production (Figure S7).

Figure 5. In vitro enzyme activity assay for EFE. v16, v13, v4, v9, v32 indicate strains having EFE translated using RBSv16, v13, v4, v9, and v32. All the relative EFE levels were normalized to that of RBSv4. Error bars indicate standard deviation of two biological replicates for the relative EFE level and standard deviation of three biological replicates for the relative ethylene productivity.

Figure 6. Ethylene productivities endowed by the in vivo EFE enzyme activity in five representative Synechocystis strains. v16, v13, v4, v9, v32 indicate strains having EFE translated using RBSv16, v13, v4, v9, and v32. All the relative EFE levels were normalized to that of RBSv4. The relative ethylene productivity was measured in nmol/mL/h/OD730. Error bars indicate standard deviation of two biological replicates for the relative EFE level and standard deviation of three biological replicates for the relative ethylene productivity.


Page 16 of 35

Page 17 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

268

269


CONCLUSIONS Despite increasing research interest in photo-oxygenic, carbon-fixing cyanobacteria, significant

270

advancement in the field relies on the development of synthetic biology toolkits. In this study, a total of

271

17 natural and chimeric promoters and a set of 13 ribosome binding sites (RBSs) were compared for

272

their capabilities for expression of heterologous genes in Synechocystis 6803. We demonstrated that the

273

Ptrc promoter, featured with the E. coli σ70 consensus -35 and -10 elements, is superior to the

274

previously reported strong promoters, such as PcpcB 20, PpsbA 2, 3, 10 and PpsbA2 for expressing EFE in

275

Synechocystis under various laboratory illumination conditions (Figure 1, S5). Ptrc confers apparently

276

higher expression level of EFE under higher light intensities, which is opposite to that of the PcpcB

277

promoter (Figure S5). Noticeably, through the study of PpsbA* and its variants as well as the Ptac, Ptrc

278

and Ptic serial promoters, we found that the -10 region sequence of TATACT is preferable to TATAAT in

279

Synechocystis, and The optimal interspace between the -35 and -10 regions is 17-18 bp (Figure 1, Table

280

1).

281

It is well recognized that the RBS prediction software could estimate the translation initiation rate

282

based on calculating the Gibbs free energy change (ΔGtotal) upon a translation event and it therefore

283

serves as a useful tool to build RBS libraries from scratch. 3, 21-24 Nevertheless, in organism-specific cases

284

its prediction accuracy may be compromised, possibly because of complicated post-transcriptional gene

285

regulations, such as translational enhancers, 29 antisense RNAs, 28 and ribonuclease target sites, 31 that

286

have not yet been integrated into the software model. 21, 28-31 We herein demonstrate a strategy

287

complementary to the RBS prediction software to facilitate rational design of an RBS library to optimize

288

the gene expression in cyanobacteria. Starting with a strong RBS previously obtained from an RBS

289

Calculator-predicted RBS library, 3 our current research uncovered a dynamic range of translation

290

efficiencies using this complementary design principle. The stronger RBSs obtained from this strategy



291

showed traits including a disrupted AT-rich region, a mutation in the Shine-Dalgarno (SD) sequence from

292

AGGAGG to AGGAGA, and a lack of GC-rich or AT-rich sequences in the spacer between the SD sequence

293

and the start codon.

294

The highest EFE expression level from using a single copy of the gene expression cassette with the

295

best RBS (v33) and a moderate-strong promoter (PpsbA*) reached up to 12.6% of the total soluble

296

protein in Synechocystis, which is the highest EFE expression level reported to date. For the first time,

297

strong evidence has been provided that EFE expression is no longer the rate-limiting step in

298

cyanobacterial ethylene production. The synthetic biology toolkits (promoters and RBS design principles)

299

described in this study could be broadly applied to tuning expression levels of foreign genes, as well as

300

to identifying and mitigating metabolic bottlenecks in Synechocystis and other cyanobacteria with

301

immense applications in the production of renewable biofuels and bioproducts.

302

METHODS

303

Bacterial strains and culture conditions. E. coli NEB5α (New England BioLabs, MA, USA) was grown in

304

LB medium and was used as the host for constructing and maintaining all recombinant plasmids.

305

Synechocystis sp. PCC 6803 and the derivative strains were typically inoculated from previously grown

306

healthy culture (OD730 of 0.5-2.0) to an initial OD730 of 0.1 in modified BG11 medium (BG11

307

supplemented with 20 mM TES and 100 mM NaHCO3). The Synechocystis culture flasks were placed on a

308

rotary shaker (150 rpm) inside a Percival chamber (Percival Scientific, Inc., IA, USA) aerated with 5% CO2,

309

under a constant light intensity of about 35 μE m-2 s-1, at 30 oC. When the OD730 of Synechocystis culture

310

reached 0.5-1.0 (which took one day or so), samples were collected for analysis of the relative

311

abundance of the target proteins as well as the EFE activities that are described in detail in the following

312

sections. For Synechocystis culture growing under higher intensity of light, culture was first adapted

313

under 200 μE m-2 s-1 light for about 24 hours and then inoculated to an initial OD730 of 0.1 and grown 18 ACS Paragon Plus Environment

Page 18 of 35

Page 19 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


314

under 200 μE m-2 s-1 until OD730 reached about 0.5 before harvest (which took about one day). For

315

Synechocystis growing under low intensity of light, culture grown under 35 μE m-2 s-1 was inoculated into

316

the medium to an initial OD730 of 0.1 and grown under about 5 μE m-2 s-1 until OD730 reached about 0.5

317

before harvest (which took about one week). For Synechocystis growing on BG11 plates, 10mM TES

318

(pH8.2), 3g/L thiosulfate and 1.5% agar were added to the BG11 medium before autoclaving.

319 320 321

Construction of recombinant plasmids. Typically, the high fidelity Q5 DNA polymerase (New England BioLabs, MA, USA) was used in PCR amplification of DNA fragments. Construction of the promoter library. Plasmid pJU158-EcoRV was constructed by introducing an EcoRV

322

restriction site between the PpsbA promoter (originally cloned from Amaranthus hybridus) 37 and the

323

RBSv4 of the plasmid pJU158 using the Site Directed Mutagenesis Kit (SDM Kit; New England BioLabs,

324

MA, USA) using primers PpsbAR2-EcoRV and RBSv4+F. Then, the 230-bp UpetE fragment was deleted

325

from the pJU158-EcoRV plasmid using the SDM Kit using primers PpsbAF1-AsiSI and DS168-1, resulting

326

in plasmid pPB101. DNA fragments of PcpcB4, PcpcB3, PcpcB1 were PCR amplified from the genomic

327

DNA of Synechocystis 6803 and inserted between the AsiSI and EcoRV restriction sites on pPB101 to

328

replace the PpsbA promoter with PcpcB4, PcpcB3, PcpcB1, respectively, using the Cold Fusion Cloning

329

Kit (System Biosciences, CA, USA). The resultant plasmids were named as pPB102, pPB103, and pPB105.

330

DNA fragment TFBS-PpsbA was amplified from TFBS-PpsbA-RBSv3 (synthesized by GenScript, NJ, USA;

331

Supplementary file 1.2), and used to replace the PpsbA promoter on pPB101 using the Cold Fusion

332

Cloning Kit, resulting in plasmid pPB107. The Ptac promoter was PCR amplified from TFBS-Ptac-RBSv3

333

(synthesized by GenScript, NJ, USA; Supplementary file 1.3) and used to swap the PpsbA promoter on

334

pPB101, resulting in plasmid pPB109. Plasmids pPB121 and pPB122 were generated using the SDM Kit

335

using pPB109 as the PCR template. To construct pPB123, the UpetE DNA fragment was PCR amplified

336

from pJU158 using primers DS168-6 and UpetE2 and inserted into the AsiSI site (which was inactivated



337

after DNA assembly) of plasmid pPB121. Plasmid pPB124 was constructed by deleting the PpsbA from

338

plasmid pJU158 using the SDM Kit using primers UpetE4 and RBSv4+F. pPB117 and pPB118 were

339

constructed by replacing the PpsbA promoter with the native PpsbA2 promoter with varied lengths. To

340

introduce mutations into the PpsbA* promoter, primers PpsbA-M1 and EFE-D-HindIII were utilized to

341

PCR amplify the EFE expression cassette, and then the purified PCR product was digested with HincII,

342

HindIII-HF and DpnI before being inserted between the HincII and HindIII restriction sites on pPB158-

343

EcoRV. The resultant plasmid was denominated as pPB111. Similarly, plasmids pPB112, pPB113 were

344

constructed using the pair of primers of PpsbA-M2 and EFE-D-HindIII, or the pair of primers of PpsbA-M3

345

and EFE-D-HindIII. During constructing pPB113, there was one clone that missed one additional adenine

346

between the -35 and the -10 region of the PpsbA promoter and this mutant was named as pPB114. The

347

DNA sequences of the primers used for constructing the promoter library were listed in Table S2 and the

348

promoter DNA sequences were depicted in Supplementary file Table S1.

349

Construction of the RBS library. The recombinant plasmids for the RBS library were constructed using

350

the SDM Kit with pJU158-EcoRV as the template. The resultant plasmid candidates were initially verified

351

for losing of the EcoRV restriction site, and then confirmed by DNA sequencing. The pPB251 (for RBSv31)

352

and pPB252 (for RBSv32) were mutant clones during constructing pPB158 (for RBSv8). The pPB253 (for

353

RBSv33) was a mutant clone during constructing pPB159 (for RBSv9). The EFE expression cassette on

354

pJU158was PCR amplified using primers PetE-F1 and EFE-D-HindIII and inserted between the BamHI and

355

HindIII sites on plasmid pSCPTH, 42 resulting in plasmid pPB147. To invert the direction of the cat (CmR)

356

gene on the plasmid, the cat gene was PCR amplified using primers CatU1 and CatD2, and inserted back

357

into the pPB147 backbone from which cat gene had been deleted using SDM Kit. The resultant plasmid

358

was designated pPB145. The rrnB terminator was PCR amplified from E.coli KRX genomic DNA using

359

primers rrnBU-efe and rrnBD-SL1, and was inserted between the HindIII and SalI restriction sites on

360

plasmid pPB145, leading to plasmid pPB144. The Synechocystis PB755 (with RBSv35) was a mutant strain 20 ACS Paragon Plus Environment

Page 20 of 35

Page 21 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


361

that was discovered after Synechocystis was transformed with pPB144. The point mutation in the spacer

362

region between the Shine-Dalgarno sequence and the start codon ATG in this strain is postulated to

363

have occurred during the propagation of plasmid pPB144 in E. coli. The EFE expression cassette was

364

inserted to the slr1495-sll1397 neutral site 42 on the chromosome of Synechocystis strain PB755,

365

whereas all other strains harbored the EFE expression cassettes at the slr0168 neutral site on the

366

chromosome of Synechocystis. All the DNA sequences of the RBSs were shown in Figure 2A. The primers

367

were listed in Supplementary file Table S2.

368

Modification of the Synechocystis genome. Synechocystis 6803 was inoculated into the culture

369

medium with an initial OD730 of 0.1, and was grown until the OD730 of the Synechocystis culture reached

370

approximately 0.4. Then, 2 mL of culture was taken from the culture into a 2 mL tube and was

371

condensed to about 0.2 mL after centrifugation and resuspension with the supernatant. About 2 µg of

372

each integration plasmid was mixed with the resuspended Synechocystis cells, and the mixture was

373

incubated under the illumination of about 20 μE m-2 s-1, at 30 oC, for 5-6 hours. The tube was shaken

374

once in the middle of the transformation. Cells were then spread onto the BG11 agar plates

375

supplemented with appropriate antibiotics. The antibiotic concentrations were 50 µg/mL for

376

spectinomycin and 10 µg/mL for chloramphenicol. The plates were placed under the illumination of ~20

377

μE m-2 s-1, 30 oC. After 1-2 weeks, single colonies from the transformation plates were restreaked onto

378

fresh BG11 plates supplemented with appropriate antibiotics. Single colonies of each strain were

379

restreaked until the chromosomes were completely segregated as confirmed by colony PCR using

380

primers flanking the whole integration region. The Synechocystis strains and the relevant integration

381

plasmids were listed in Supplementary Table S3.

382 383

SDS-PAGE and Western blotting. When the OD730 of the Synechocystis culture reached 0.5-1.0, approximately 5 OD730·mL (i.e., the value of OD730 times the value of culture volume in mL equals 5) of



384

cells of each strain were pelleted by centrifugation at 3220 × g, 25 oC, 5 min. Then, the supernatants

385

were aspirated and the cell pellets were stored at -80 oC for later use. To prepare the cell extract, cells

386

were resuspended in 0.5 mL of cold 0.1 M potassium phosphate buffer (pH7.0) supplemented with 0.2

387

mM DTT and Halt Protein Inhibitor Cocktail (Thermo Fisher Scientific, MA, USA), and lysed with bead

388

beating using the Digital Disruptor Genie (Scientific Industries, Inc, NY, USA) at 4 oC. The cell lysate was

389

then centrifuged at 4 oC, 18000×g for 30 min, and then the cell extract (supernatant) was taken into a

390

new tube placed on ice for the following assay. The protein concentrations of the cell extract were

391

quantified using Bradford assay (Thermo Fisher Scientific, MA, USA). Approximately 1.0 µg of proteins of

392

each cell extract were mixed with same volume of the 2x SDS-PAGE sample buffer (950 ul BioRad 2x

393

Laemmli Sample Buffer +50 µl BME) in PCR tubes and heated at 99 oC for 5 minutes using the PCR

394

machine. Samples were then loaded on the Mini-PROTEAN® or Criterion™ TGX Stain-Free™ precast gels

395

(Bio-Rad Laboratories, CA, USA), and the electrophoresis was run at 150 V for ~1 hour, after which the

396

gels were imaged using UV excitation in a FluorChem Q imager (ProteinSimple, CA, USA).

397

Western blotting was conducted using Pierce™ G2 Fast Blotter (Thermo Fisher Scientific, MA, USA)

398

according to the user manual. The primary antibody used to probe the FLAG-Tag fused to the C-terminus

399

of EFE was the mouse monoclonal anti-FLAG antibody purchase from Rockland Immunochemicals Inc.,

400

PA, USA. The secondary antibody was Clean-Blot™ IP Detection Reagent (HRP; Thermo Fisher Scientific,

401

MA, USA).

402

Quantification of EFE in the total soluble protein of Synechocystis. The SDS-PAGE images were

403

obtained using the same method as mentioned above and the florescent signals from the SDS-PAGE gels

404

were processed using the Image Lab software (Bio-Rad Laboratories, CA, USA). The EFE signal was

405

normalized to the RbcL signal in the same sample lane. To estimate the relative EFE abundance in the

406

cell extract, the cell extract of the strain with the highest expression level of EFE was serially diluted by a


Page 22 of 35

Page 23 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


407

factor of two using the cell extract of the wild-type strain, so that a standard curve of EFE relative

408

abundance was generated (Figure S8). The linearity of the standard curve for the fluorescent signal from

409

SDS-PAGE was better than that from the western blot, so the EFE relative abundance was quantified

410

based on the fluorescent signal from SDS-PAGE. For estimating the absolute EFE abundance in the cell

411

extract, 1.0 µg of total soluble proteins (cell extract) of the wild-type and highest EFE-expressing

412

Synechocystis strains as well as 0.05, 0.1, 0.2, 0.3 µg of the purified EFE-FLAG proteins were loaded onto

413

the Mini-PROTEAN® TGX Stain-Free™ precast gels (Bio-Rad Laboratories, CA, USA). The amount of EFE

414

(FLAG-tagged) expressed in the Synechocystis strains was calculated by comparing its fluorescent signal

415

against the standard curve generated from the purified EFE-FLAG proteins.

416

In vitro EFE activity assay. Synechocystis strains were inoculated with an initial OD730 of 0.1 in 50-mL

417

flasks each containing 10 mL of the modified BG11 medium, and were grown under ~50 μE m-2 s-1, 30

418

o

419

Synechocystis culture reached 0.5-1.0, about 5 OD730·mL of cells of each strain were pelleted by

420

centrifugation and then were stored at -80 oC. To prepare the cell extract, cells were resuspended with

421

0.5 mL of cold 0.1 M potassium phosphate buffer (pH7.0) supplemented with 0.2 mM DTT, and were

422

subsequently lysed by bead-beating using the Digital Disruptor Genie (Scientific Industries, Inc, NY, USA)

423

at 4 oC. The cell lysate was then centrifuged at 4 oC, 18000×g for 30 min, and the cell extract

424

(supernatant) was taken into a new tube placed on ice. The protein concentrations of the cell extract

425

were quantified using Bradford assay. For the in vitro EFE activity assay, 400 µL of solution containing 40

426

mM HEPES, 10 mM histidine, 0.2 mM L-arginine, 0.5 mM α-ketoglutarate, 0.2 mM FeSO4 and 2 mM DTT

427

was added into the 1.8-mL glass vials, and then 100 µL of cell extract was added to start the reaction.

428

The vials were sealed immediately and placed on a shaker (150 rpm) at 30 oC. Approximately after 3

429

hours of incubation, 250 µL of gas was sampled from the headspace of the vials using a sample-lock

430

syringe and injected into GC for the ethylene analysis.

C, in the Percival chamber (Percival Scientific, Inc., IA, USA) aerated with 5% CO2. When the OD730 of the



431

Ethylene production from Synechocystis. Synechocystis strains were inoculated with an initial OD730

432

of 0.1 in 50-mL flasks each containing 10 mL of the modified BG11 medium, and were grown under ~50

433

μE m-2 s-1, 30 oC, in the Percival chamber (Percival Scientific, Inc., IA, USA) aerated with 5% CO2. When

434

the OD730 of the Synechocystis culture reached ~0.5, 2 mL culture of each strain was transferred into a

435

13-mL glass tube and was sealed immediately and placed under the same growth condition for 16 hours,

436

after which 500 µL gas was sampled from the headspace and injected into GC for quantification of

437

ethylene. The OD730 of the cell culture was determined using a Beckman DU800 spectrophotometer

438

(Beckman Coulter, CA, USA) at the beginning and end of the 16-hour incubation period, and the average

439

OD730 was used to normalize the ethylene productivity. Three biological replicates were conducted.

440

ASSOCIATED CONTENT

441

Supporting Information

442

Comparison between the psbA promoter used in this study with that used in Synechococcus elongates

443

7942 (Supplementary file 1.1). Synthesized TFBS-PpsbA-RBSv3 as the template for PCR amplification of

444

promoter TFBS-PpsbA (Supplementary file 1.2). Synthesized TFBS-Ptac-RBSv3 as the template for PCR

445

amplification of promoter Ptac (Supplementary file 1.3). Promoter library DNA sequences (Table S1).

446

Primers used in this study (Table S2). Synechocystis strains and integration plasmids (Table S3). Robust

447

expression of EFE using the PpsbA*-RBSv4-efe expression cassette at three different neutral sites on the

448

chromosome of Synechocystis 6803 (Figure S1). Strong expression of the heterologous gene katE using

449

the PpsbA* and RBSv4 in Synechocystis (Figure S2). PpsbA* versus Ptrc expression of synthetic operons

450

in Synechocystis sp. PCC6803 (Figure S3). The EcoRV restriction site and the UpetE fragment hamper the

451

expression of target gene efe (Figure S4). Impact of light intensity on the behavior of promoters (Figure

452

S5). Simulated RNA structure for the 5’ region of the RBSv35+efe (Figure S6). Biological reaction


Page 24 of 35

Page 25 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


453

catalyzed by ethylene-forming enzyme (EFE; Figure S7). Representative standard curves for

454

quantification of the relative EFE levels in the cell extracts of Synechocystis strains (Figure S8).

455

AUTHOR INFORMATION

456

Corresponding Author

457

* Biosciences Center, National Renewable Energy Laboratory, 15013 Denver West Parkway, Golden, CO

458

80401, USA. Email: [email protected].

459

Author Contribution

460

B.W. designed and conducted the majority of the experiments. C.A.E conducted the experiments on

461

hydrogenase expression. B.W., C.A.E., P.M. and J.Y. wrote and revised the manuscript.

462

Conflict of Interest

463

The authors declare no competing financial interest.

464

465

ACKNOWLEDGEMENTS

466

The authors acknowledge financial support from US Department of Energy, Bioenergy Technologies

467

Office for major support of this work. Hydrogenase expression was supported by the DOE Fuel Cell

468

Technologies Office. Preparation of purified EFE-FLAG protein was supported by NREL LDRD, with

469

technical assistance from Markus Alahuhta.

470



471

References:

472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516

[1] Raven, J. A., and Allen, J. F. (2003) Genomics and chloroplast evolution: what did cyanobacteria do for plants?, Genome Biol. 4, 209. [2] Wang, X., Liu, W., Xin, C., Zheng, Y., Cheng, Y., Sun, S., Li, R., Zhu, X. G., Dai, S. Y., Rentzepis, P. M., and Yuan, J. S. (2016) Enhanced limonene production in cyanobacteria reveals photosynthesis limitations, Proc. Natl. Acad. Sci. U. S. A. 113, 14225-14230. [3] Xiong, W., Morgan, J. A., Ungerer, J., Wang, B., Maness, P.-C., and Yu, J. (2015) The plasticity of cyanobacterial metabolism supports direct CO2 conversion to ethylene, Nature Plants 1, 15053. [4] Kasting, J. F., and Siefert, J. L. (2002) Life and the evolution of Earth's atmosphere, Science 296, 10661068. [5] Zarzycki, J., Axen, S. D., Kinney, J. N., and Kerfeld, C. A. (2013) Cyanobacterial-based approaches to improving photosynthesis in plants, J. Exp. Bot. 64, 787-798. [6] Wang, B., Wang, J., Zhang, W., and Meldrum, D. R. (2012) Application of synthetic biology in cyanobacteria and algae, Front. Microbiol. 3, 344. [7] Angermayr, S. A., Gorchs Rovira, A., and Hellingwerf, K. J. (2015) Metabolic engineering of cyanobacteria for the synthesis of commodity products, Trends Biotechnol. 33, 352-361. [8] Wan, N., DeLorenzo, D. M., He, L., You, L., Immethun, C. M., Wang, G., Baidoo, E. E. K., Hollinshead, W., Keasling, J. D., Moon, T. S., and Tang, Y. J. (2017) Cyanobacterial carbon metabolism: Fluxome plasticity and oxygen dependence, Biotechnol. Bioeng. 114, 1593-1602. [9] Xiong, W., Cano, M., Wang, B., Douchi, D., and Yu, J. (2017) The plasticity of cyanobacterial carbon metabolism, Curr. Opin. Chem. Biol. 41, 12-19. [10] Ungerer, J., Tao, L., Davis, M., Ghirardi, M., Maness, P.-C., and Yu, J. (2012) Sustained photosynthetic conversion of CO2 to ethylene in recombinant cyanobacterium Synechocystis 6803, Energy Environ. Sci. 5, 8998. [11] Mo, H., Xie, X., Zhu, T., and Lu, X. (2017) Effects of global transcription factor NtcA on photosynthetic production of ethylene in recombinant Synechocystis sp. PCC 6803, Biotechnol Biofuels 10, 145. [12] Angermayr, S. A., van der Woude, A. D., Correddu, D., Vreugdenhil, A., Verrone, V., and Hellingwerf, K. J. (2014) Exploring metabolic engineering design principles for the photosynthetic production of lactic acid by Synechocystis sp. PCC6803, Biotechnol Biofuels 7, 99. [13] Armshaw, P., Carey, D., Sheahan, C., and Pembroke, J. T. (2015) Utilising the native plasmid, pCA2.4, from the cyanobacterium Synechocystis sp. strain PCC6803 as a cloning site for enhanced product production, Biotechnol Biofuels 8, 201. [14] Ng, A. H., Berla, B. M., and Pakrasi, H. B. (2015) Fine-tuning of photoautotrophic protein production by combining promoters and neutral sites in the cyanobacterium Synechocystis sp. strain PCC 6803, Appl. Environ. Microbiol. 81, 6857-6863. [15] Veetil, V. P., Angermayr, S. A., and Hellingwerf, K. J. (2017) Ethylene production with engineered Synechocystis sp PCC 6803 strains, Microb Cell Fact 16, 34. [16] Huang, H. H., Camsund, D., Lindblad, P., and Heidorn, T. (2010) Design and characterization of molecular tools for a Synthetic Biology approach towards developing cyanobacterial biotechnology, Nucleic Acids Res. 38, 2577-2593. [17] Albers, S. C., Gallegos, V. A., and Peebles, C. A. (2015) Engineering of genetic control tools in Synechocystis sp. PCC 6803 using rational design techniques, J. Biotechnol. 216, 36-46. [18] Xu, Y., Alvey, R. M., Byrne, P. O., Graham, J. E., Shen, G., and Bryant, D. A. (2011) Expression of genes in cyanobacteria: adaptation of endogenous plasmids as platforms for high-level gene expression in Synechococcus sp. PCC 7002, Methods Mol. Biol. 684, 273-293. 26 ACS Paragon Plus Environment

Page 26 of 35

Page 27 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564


[19] Markley, A. L., Begemann, M. B., Clarke, R. E., Gordon, G. C., and Pfleger, B. F. (2015) Synthetic biology toolbox for controlling gene expression in the cyanobacterium Synechococcus sp. strain PCC 7002, ACS Synthetic Biology 4, 595-603. [20] Zhou, J., Zhang, H., Meng, H., Zhu, Y., Bao, G., Zhang, Y., Li, Y., and Ma, Y. (2014) Discovery of a super-strong promoter enables efficient production of heterologous proteins in cyanobacteria, Sci. Rep. 4, 4500. [21] Espah Borujeni, A., Channarasappa, A. S., and Salis, H. M. (2014) Translation rate is controlled by coupled trade-offs between site accessibility, selective RNA unfolding and sliding at upstream standby sites, Nucleic Acids Res. 42, 2646-2659. [22] Salis, H. M., Mirsky, E. A., and Voigt, C. A. (2009) Automated design of synthetic ribosome binding sites to control protein expression, Nat. Biotechnol. 27, 946-950. [23] Seo, S. W., Yang, J. S., Kim, I., Yang, J., Min, B. E., Kim, S., and Jung, G. Y. (2013) Predictive design of mRNA translation initiation region to control prokaryotic translation efficiency, Metab. Eng. 15, 67-74. [24] Na, D., and Lee, D. (2010) RBSDesigner: software for designing synthetic ribosome binding sites that yields a desired level of protein expression, Bioinformatics 26, 2633-2634. [25] Englund, E., Liang, F., and Lindberg, P. (2016) Evaluation of promoters and ribosome binding sites for biotechnological applications in the unicellular cyanobacterium Synechocystis sp. PCC 6803, Sci. Rep. 6, 36640. [26] Heidorn, T., Camsund, D., Huang, H. H., Lindberg, P., Oliveira, P., Stensjo, K., and Lindblad, P. (2011) Synthetic biology in cyanobacteria engineering and analyzing novel functions, Methods Enzymol. 497, 539-579. [27] Oliver, J. W., Machado, I. M., Yoneda, H., and Atsumi, S. (2014) Combinatorial optimization of cyanobacterial 2,3-butanediol production, Metab. Eng. 22, 76-82. [28] Duhring, U., Axmann, I. M., Hess, W. R., and Wilde, A. (2006) An internal antisense RNA regulates expression of the photosynthesis gene isiA, Proc. Natl. Acad. Sci. U. S. A. 103, 7054-7058. [29] Li, R., and Golden, S. S. (1993) Enhancer activity of light-responsive regulatory elements in the untranslated leader regions of cyanobacterial psbA genes, Proc. Natl. Acad. Sci. U. S. A. 90, 11678-11682. [30] Mitschke, J., Georg, J., Scholz, I., Sharma, C. M., Dienst, D., Bantscheff, J., Voss, B., Steglich, C., Wilde, A., Vogel, J., and Hess, W. R. (2011) An experimentally anchored map of transcriptional start sites in the model cyanobacterium Synechocystis sp. PCC6803, Proc. Natl. Acad. Sci. U. S. A. 108, 2124-2129. [31] Sakurai, I., Stazic, D., Eisenhut, M., Vuorio, E., Steglich, C., Hess, W. R., and Aro, E. M. (2012) Positive regulation of psbA gene expression by cis-encoded antisense RNAs in Synechocystis sp. PCC 6803, Plant Physiol. 160, 1000-1010. [32] Eckert, C., Xu, W., Xiong, W., Lynch, S., Ungerer, J., Tao, L., Gill, R., Maness, P. C., and Yu, J. (2014) Ethylene-forming enzyme and bioethylene production, Biotechnol Biofuels 7, 33. [33] Fukuda, H., Ogawa, T., Tazaki, M., Nagahama, K., Fujii, T., Tanase, S., and Morino, Y. (1992) Two reactions are simultaneously catalyzed by a single enzyme: the arginine-dependent simultaneous formation of two products, ethylene and succinate, from 2-oxoglutarate by an enzyme from Pseudomonas syringae, Biochem. Biophys. Res. Commun. 188, 483-489. [34] Zhang, Z., Smart, T. J., Choi, H., Hardy, F., Lohans, C. T., Abboud, M. I., Richardson, M. S. W., Paton, R. S., McDonough, M. A., and Schofield, C. J. (2017) Structural and stereoelectronic insights into oxygenasecatalyzed formation of ethylene from 2-oxoglutarate, Proc. Natl. Acad. Sci. U. S. A. 114, 4667-4672. [35] Martinez, S., Fellner, M., Herr, C. Q., Ritchie, A., Hu, J., and Hausinger, R. P. (2017) Structures and mechanisms of the non-heme Fe(II)- and 2-oxoglutarate-dependent ethylene-forming enzyme: substrate binding creates a twist, J. Am. Chem. Soc. [36] Sakai, M., Ogawa, T., Matsuoka, M., Fukuda, H. (1997) Photosynthetic conversion of carbon dioxide to ethylene by the recombinant cyanobacterium, Synechococcus sp. PCC 7942, which harbors a gene for the ethylene-forming enzyme of Pseudomonas syringae, J. Ferment. Bioeng. 84, 434-443. 27 ACS Paragon Plus Environment


565 566 567 568 569 570 571 572 573 574 575 576

[37] Elhai, J. (1993) Strong and regulated promoters in the cyanobacterium Anabaena PCC 7120, FEMS Microbiol. Lett. 114, 179-184. [38] Brosius, J., Erfle, M., and Storella, J. (1985) Spacing of the -10 and -35 regions in the tac promoter. Effect on its in vivo activity, J. Biol. Chem. 260, 3539-3541. [39] Wolk, C., Elhai, J., Kuritz, T., and Holland, D. (1993) Amplified expression of a transcriptional pattern formed during development of Anabaena, Mol. Microbiol. 7, 441-445. [40] Makrides, S. C. (1996) Strategies for achieving high-level expression of genes in Escherichia coli, Microbiol. Rev. 60, 512-538. [41] Cameron, J. C., Gordon, G. C., and Pfleger, B. F. (2015) Genetic and genomic analysis of RNases in model cyanobacteria, Photosynth. Res. 126, 171-183. [42] Wang, B., Pugh, S., Nielsen, D. R., Zhang, W., and Meldrum, D. R. (2013) Engineering cyanobacteria for photosynthetic production of 3-hydroxybutyrate directly from CO2, Metab Eng 16, 68-77.

577


Page 28 of 35

Page 29 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


84x40mm (300 x 300 DPI)

ACS Paragon Plus Environment


Figure 1. A promoter library for EFE expression in Synechocystis. (A) The schematic structure of EFE expression cassette. (B) The relative EFE expression levels from the promoter library quantified based on SDS-PAGE. (C) The representative SDS-PAGE gel and the western blotting results. Two biological and two technical replicates for each strain. Error bars indicate standard deviation of two biological replicates. 152x160mm (300 x 300 DPI)


Page 30 of 35

Page 31 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. The RBS library for EFE expression in Synechocystis. (A) The schematic structure of EFE expression cassette and the RBS sequences. (B) The relative EFE expression levels from the RBS library quantified based on SDS-PAGE. (C) The representative SDS-PAGE gel and the western blotting results for the RBS library. Two biological and two technical replicates for each strain. Error bars indicate standard deviation of two biological replicates. 144x144mm (300 x 300 DPI)



Figure 3. Comparison of the software-predicted and measured RBS efficiencies. (A) The EFE expression levels from RBSs relative to that from the RBSv4. The red arrow for v35 indicates the EFE expression level was much lower than the most diluted RBSv32/32 sample (7.5% of that of RBSv4) based on the western blotting result in Figure 2C. (B) The overall prediction accuracy was unsatisfactory. Two biological and two technical replicates for each strain. Error bars indicate standard deviation of two biological replicates. 152x63mm (300 x 300 DPI)


Page 32 of 35

Page 33 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Quantification of the relative EFE abundance in the total soluble protein of the Synechocystis. Rep I, technical replicate 1; Rep II, technical replicate 2; both were loaded with 1.0 µg total soluble protein. WT, wild-type Synechocystis 6803 strain. v32, Synechocystis strain PB752 (RBSv32). v33, Synechocystis strain PB753 (RBSv33). The amounts of purified EFE loaded were indicated on top of each lane. The quantification was based on the fluorescent signal from the EFE protein on SDS-PAGE gel (see details in the section of METHODS). 84x50mm (300 x 300 DPI)



Figure 5. In vitro enzyme activity assay for EFE. v16, v13, v4, v9, v32 indicate strains having EFE translated using RBSv16, v13, v4, v9, and v32. All the relative EFE levels were normalized to that of RBSv4. Error bars indicate standard deviation of two biological replicates for the relative EFE level and standard deviation of three biological replicates for the relative ethylene productivity. 63x50mm (300 x 300 DPI)


Page 34 of 35

Page 35 of 35 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. Ethylene productivities endowed by the in vivo EFE enzyme activity in five representative Synechocystis strains. v16, v13, v4, v9, v32 indicate strains having EFE translated using RBSv16, v13, v4, v9, and v32. All the relative EFE levels were normalized to that of RBSv4. The relative ethylene productivity was measured in nmol/mL/h/OD730. Error bars indicate standard deviation of two biological replicates for the relative EFE level and standard deviation of three biological replicates for the relative ethylene productivity. 63x50mm (300 x 300 DPI)


A Genetic Toolbox for Modulating the Expression of Heterologous

Recommend Documents