A Neutralized Noncharged Polyethylenimine-Based System for

Nov 17, 2016 - *(Y.L.) Tel +86 (10) 8252-9288; Fax +86 (10) 8252-9288; e-mail [email protected]. ... Paula Ofek , Galia Tiram , Ronit Satchi-Fainaro...
7 downloads 0 Views 5MB Size
Download PDF
Research Article www.acsami.org

A Neutralized Noncharged Polyethylenimine-Based System for Efficient Delivery of siRNA into Heart without Toxicity Fang Wang,† Lu Gao,‡ Liu-Yi Meng,§ Jing-Ming Xie,† Jing-Wei Xiong,‡ and Ying Luo*,† †

Department of Biomedical Engineering, College of Engineering, ‡Institute of Molecular Medicine, Beijing Key Laboratory of Cardiometabolic Molecular Medicine, and State Key Laboratory of Natural and Biomimetic Drugs, and §School of Life Sciences, Peking University, Beijing, China 100871 S Supporting Information *

ABSTRACT: Cationic polymers constitute an important class of materials in development of delivery vehicles for nucleic acid-based therapeutics. Among them, polyethylenimine (PEI) has been a classical cationic carrier intensively studied for therapeutic delivery of DNA, RNA, and short RNA molecules to treat diseases. However, the development of PEI for in vivo applications has been hampered by the inherent problems associated with the material, particularly its cytotoxicity and the instability of the nucleic acid complexation systems formed via electrostatic interactions. Here, we demonstrate a strategy to modify PEI polymers via hydrazidation to create neutralized, stable, and multifunctional system for delivering siRNA molecules. Through substitution of the primary amino groups of PEI with neutral hydrazide groups, cross-linked nanoparticles with surface decorated with a model targeting ligands were generated. The neutral cross-linked siRNA nanoparticles not only showed favorable biocompatibility and cell internalization efficiency in vitro but also allowed for significant tissue uptake and gene silencing efficiency in zebrafish heart in vivo. Our study suggests transformation of conventional branched PEI into a neutral polymer that can lead to a new category of nonviral carriers, and the resulting functional delivery systems may be further explored for development of siRNA therapeutics for treating cardiovascular disease/injury. KEYWORDS: siRNA delivery, polyethylenimine, neutral, gene silencing, zebrafish heart

■

INTRODUCTION Associating through electrostatic forces, cationic polymers and nucleic acids form nanoscale complexes under mild aqueous conditions. The facile, spontaneous process has made cationic polymers a major class of materials in development of nonviral delivery systems for nucleic acid-based therapeutics. Many cationic polymers were intensively investigated in various disease models such as cancer as well as heart and brain diseases.1−6 In particular, polyethylenimine (PEI) has been a cationic vector that has attracted a great deal of interests due to its distinctive efficiency shown in intracellular delivery of DNA molecules in vitro, and the branched PEI with molecular weight of 25 kDa has been considered as the gold standard of nonviral delivery materials.7 The typical PEI polymers used in gene delivery studies are branched chains containing primary, secondary, and tertiary amine groups. Two thirds of the amines could be protonated and positively charged under physiological conditions to enable complexation of PEI with nucleic acids. The delivery efficiency of PEI is thought to be closely linked to the pH buffering capacity of the uncharged amines under acidic conditions, which may prompt the endosome burst and release of nucleic acid cargoes.8,9 Despite the interesting properties and potentials, the clinical application of cationic polymers has been limited. The problem may associate primarily with the cytotoxicity of the cationic © XXXX American Chemical Society

materials. For example, PEI demonstrated toxicity toward a wide range of cells, and it was discovered that the larger molecular weight of PEI, the more severe cytotoxicity of the polymer.10,11 It is also known that the positive charges on nanoparticles may lead to recognition/uptake by macrophage cells and clearance by the reticuloendothelial system (RES).12 Moreover, the association of PEI with nuclei acids could be modified/destructed as the nanocomplexes encounter the in vivo molecular and cellular factors that may present competing/ intervening forces.13,14 To address these limitations, studies have been carried out to enhance the biocompatibility and applicability of PEI-based gene delivery systems. One important approach takes advantage of PEI of low molecular weights for construction of systems containing degradable cross-linking bonds. For example, degradable linkages such as ester, disulfide, imine, carbamate, amide, and ketal linkage were introduced to reduce the toxicity of the carrier polymer.15 However, this approach also compromise the gene transfection efficiency of PEI, which would decrease significantly with the reduced molecular weight of the polymer.10 Besides, the low molecular weight carriers Received: October 18, 2016 Accepted: November 17, 2016 Published: November 17, 2016 A

DOI: 10.1021/acsami.6b13295 ACS Appl. Mater. Interfaces XXXX, XXX, XXX−XXX

Research Article

ACS Applied Materials & Interfaces

at 37 °C for 72 h under stirring before the methanol and unreacted methyl acrylate were removed at 65 °C by rotary evaporation. The product termed PEI-OMe was dissolved in CCl3D for 1H NMR analysis (AV400, Bruker, Switzerland). To further determine the primary amino groups of PEI-OMe, a TNBSA analysis was studied. Briefly, different concentrations of glycine solutions ranging from 20 to 200 μM dissolved in 0.1 M sodium bicarbonate were fabricated for standard curve study. 0.05 mg/ mL of PEI and PEI-OMe dissolved in sodium bicarbonate solution were prepared. 500 μL of glycine solutions with different concentrations, PEI, and PEI-OMe solutions were incubated with 250 μL of 0.05% TNBSA dissolved in sodium bicarbonate solution. The mixed solutions were put on a shaker with a shaking speed of 120 rpm at 37 °C for 2 h. After the incubation, 150 μL of samples was transferred into each well of a 96-well plate. The absorbance intensity of the solution at 350 nm was measured by a SpectraMax M2 microplate reader (Molecular Devices, Sunnyvale, CA). A standard curve showing the relationship between the concentration of glycine and the absorbance intensity was made, and the number of the amino groups of PEI or PEI-OMe was calculated according to the standard curve. To synthesis the neutralized PEI, the PEI-OMe was dissolved in 10 mL of methanol at 50 mg/mL, and the solution was reacted with hydrate hydrazine which was in 10-fold molar excess to the methyl ester groups of PEI-OMe at 55 °C for 48 h. The solvent and the unreacted hydrate hydrazine were removed at 65 °C by rotary evaporation and then dialyzed against deionized water for 72 h. The product PEI-HYD was lyophilized, and the 1H NMR analysis was performed in D2O. To prepare the conjugates modified with CGRGDS peptides, 10 mg of PEI-HYD was dissolved in 1 mL of DPBS. The solution was reacted with 3 mg of SM(PEG)2 dissolved in 200 μL of DMSO for 1 h at room temperature. The solution was purified by ultrafiltration against DPBS using a centrifugal filter with 3000 molecular weight cutoff (MWCO) filter membrane (Millipore, Billerica, MA) under the rotation speed of 5000 rpm for 15 min, and the purification process was repeated four times. The purified solution was reacted with 6 mg of CGRGDS which was dissolved in 1 mL of DPBS, and the reaction was kept on a shaker with a speed of 120 rpm at room temperature for 6 h. The final product, PEI-HYD-RGD, was purified by ultrafiltration with ultrapure water via a filter with 3000 MWCO under 5000 rpm for 15 min, and the purification process was repeated four times. White powder of the product was obtained by lyophilization using a freezedryer (Christ, Osterode, Germany) and stored at −20 °C. For 1H NMR analysis, 5 mg of PEI-HYD-RGD was dissolved in D2O. Complexation of siRNA with PEI, PEI-HYD, and PEI-HYDRGD Polymers. To prepare siRNA-loaded nanocomplexes using neutralized PEI polymers, PEI-HYD or PEI-HYD-RGD was dissolved in a phosphate buffer with pH at 5.0 (0.2 M KH2PO4 in deionized water and the pH was adjusted by 5 M NaOH) solution. To this solution was added with an equal volume of siRNA in the phosphate buffer solution with pH at 5.0 for 30 min at room temperature. The blend of siRNA and PEI-HYD polymers were reacted with the solution of glutaraldehyde with a volume equal to the solution of PEIHYD polymers at 37 °C for 1 h on a shaker rotated at 150 rpm. After the cross-linking reaction, the pH of the solution was adjusted to 7.4 by 5 M NaOH. The excessive glutaraldehyde was removed and crosslinked particles obtained by dialysis against DPBS for 1 h in a dialysis device (Slide-A-Lyzer MINI, 3000 MWCO, Pierce, Rockford, IL). A solution containing ADH in a molar ratio of 1:1 to the glutaraldehyde was added to the nanoparticle solutions to further block any unreacted aldehyde groups of glutaraldehyde in the nanoparticles for 1 h. The final solution was dialyzed against DPBS for 2 h, and the cross-linked siRNA-loaded particles were ready for further use. The PEI complexed siRNA nanoparticles were prepared by direct adding of the siRNA solution in DPBS to the equal volume of the PEI solution in DPBS for 30 min at room temperature. PEI nanocomplexes with different weight ratios were prepared by adding siRNA solution with confirmed concentration to PEI solution with different

may also weaken the electrostatic interaction with short nucleic acids and compromise the stability of the complexes. The degraded PEI derivatives in cellular remain the positive charge which may cause the cytotoxicity through the “mitochondrially mediated apoptotic program”.16 In our previous study, we found that the primary amine groups of positively charged dendrimers could be neutralized with hydrazide groups residing on the periphery.17,18 Targeted delivery systems could be built upon the resulting dendrimers via binding with nucleic acids under the acidic condition followed by a cross-linking process. Here, we hypothesize that the method could be applied to creating a new type of PEIbased carrier, i.e., modified PEI with primary amines substituted with hydrazide groups (PEI-HYD). The PEI-HYD would show the ability to form nanoparticulates with nucleic acids. Moreover, the cross-linked PEI-HYD would enable efficient delivery due to the dissociable cross-linking bonds and inherent “proton sponge” effects maintained by the secondary and tertiary amines of the original PEI. To this end, we carried out experiments by studying the function of neutralized PEI-HYD to deliver small interfering RNA (siRNA) molecules in a heart injury model in zebrafish. As few materials have been specifically developed to understand how to transfect the heart tissue, our study would therefore not only usher in a new category of nontoxic PEI material but also shed light on the siRNA-delivery strategy for treating heart diseases.

■

METHODS

Materials. Polyethylenimine (PEI, 25 kDa), methyl acrylate, adipic acid dihydrazide (ADH), 2,4,6-trinitrobenzenesulfonic acid (TNBSA) solution, and diethyl pyrocarbonate (DEPC) were purchased from Sigma-Aldrich (Milwaukee, WI). The tris-borate, boric acid, and ethylenediamine tetraacetic acid (EDTA) were bought from the Amresco (Solon, OH). Ultrapure water was derived from deionized water though a Milli-Q system (Millipore, America). Hydrazine hydrate was purchased from Alfa Aesar (Ward Hill, MA). The succinimidyl-[(N-maleimidopropionamido)diethylene glycol] ester (SM(PEG)2) and the CGRGDS peptide were bought from Biomatrik Inc. (Jiaxing, China) and GL Biochem (Shanghai, China), respectively. The solvent of CCl3D and the D2O for 1H NMR analysis were purchased from BASF (Ludwigshafen, Germany). GeneFinder nucleic acid stain was obtained from Bio-V (Xiamen, China). The TBE buffer was prepared with 44.5 mM tris-borate, 44.5 mM boric acid, and 0.5 mM ethylenediamine tetraacetic acid (EDTA), and the pH was adjusted by the 10% HCl in deionized water. Solution Cell Activity Assay (MTS) systems were from Promega (Madison, WI). Endothelial cell medium (ECM), fetal bovine serum (FBS), endothelial cell growth supplement (ECGS), penicillin/streptomycin (P/S), and trypsin were purchased from ScienCell (Carlsbad, CA). 4% polyformaldehyde (PFA) was purchased from the BOSTER (Wuhan, China), and 4′,6diamidino-2-phenylindole (DAPI) was obtained from the ThermoFisher (Waltham, MA). siRNAs against the Aldh1a2 gene and the negative control siRNA were synthesized by GenePharma (Shanghai, China). Cy5-labeled negative control siRNA and Cy3-labeled negative control siRNA were synthesized by the RiboBio (Guangzhou, China). The siRNA sequences for Aldh1a2 were 5′-UUCAGGACAACCGUGUUCCTT-3′ (antisense), and the negative control siRNA (siNC) sequences were 5′-ACGUGACACGUUCGGAGAAdTdT-3′ (antisense). The qPCR analysis kit was obtained from TransGen Biotech (Beijing, China). Other chemicals and machines used were specified in each experiment. Synthesis of Neutralized PEI, PEI-HYD, and PEI-HYD-RGD. Substitution of primary amino groups with hydrazides was performed according to a protocol previously established by our lab.17,18 Briefly, 50 mg/mL PEI (branched, Mw ∼ 25 000) was prepared in methanol and reacted with methyl acrylate which was in a 10-fold molar excess compared to the primary amino groups of PEI. The reaction was run B

DOI: 10.1021/acsami.6b13295 ACS Appl. Mater. Interfaces XXXX, XXX, XXX−XXX

Research Article

ACS Applied Materials & Interfaces concentrations. Exact concentration of PEI and siRNA were varied according to the demands of following experiments. Fluorescent Dye Exclusion and Gel Retardation Assay. To investigate the complexation efficiency of PEI-HYD-RGD and siRNA under pH 5, we used a nucleic acid stain, GeneFinder (SBS, Shanghai, China), to quantitatively determine the free siRNA unbound with the PEI-HYD-RGD. Briefly, a standard curve correlating the siRNA concentration with the fluorescence intensity was first established. Then 5 μL of 2 μM siRNA was added into the equal volume of PEIHYD-RGD solutions with different carrier concentrations (0.02, 0.04, 0.1, 0.2, 0.4, 1, and 2 mg/mL) for 30 min. The solution was diluted into 100 μL with the pH 5 phosphate buffer, and the GeneFinder dye was added into the mixture at the 1:10000 volume ratio. After the solutions were transferred to a 96-well plate, the fluorescence signals (excitation: 488 nm; emission: 522 nm) resulting from the GeneFinder intercalating with free siRNA were measured by a microplate reader (SpectraMax M2, Molecular Devices, Sunnyvale, CA). To investigate the optimal concentration of the cross-linking agent, the PEI-HYD- or PEI-HYD-RGD-complexed siRNA solutions at the minimal weight ratio for full complexation of siRNA were prepared. The glutaraldehyde solutions were added so that the cross-linker:polymer weight ratio was varied from 0.125 to 1250. The solution containing cross-linked particles was adjusted to pH 7.4 by 5 M NaOH before mixed with the nucleic acid-loading buffer (SBS, Shanghai, China) in a 5:1 volume ratio. The final solution was loaded in the 3% agarose gel containing 0.01% GeneFinder dye before the gel was soaked in a pH 8.3 TBE buffer. The electrophoresis experiment was conducted under a voltage of 150 mV for 30 min. The gel sample was imaged by a gel documentation system (Tanon-1600, Tanon, Shanghai, China). The electrophoresis of the naked siRNA and the siRNA-PEI-HYD-RGD mixture without the cross-linking agent, glutaraldehyde, were also performed as control groups. Characterization of Particle Size and Zeta Potential. Four formulations of PEI, PEI-HYD, and PEI-HYD-RGD at weight ratios of 7, 14, 35, and 70 were fabricated. 20 μL of 2 μM siRNA solutions was complexed with various dosage of carriers according to the weight ratios. In the neutral cross-linking system, the weight ratio of the glutaraldehyde to the carriers was confirmed at the minimum weight ratio needed for fully siRNA entrapment. After the fabrication of the nanoparticles, all the solutions containing siRNA−polymer complexes were diluted in the ultrapure water to a 1 mL volume. As for the uncross-linked neutral PEI-HYD materials, the polymers were complexed with siRNA and the solutions were diluted to 1 mL with the pH 5.0 buffer. The sizes of the nanoparticles were determined by dynamic light scattering (DLS) experiments at a 90° scattering angle (Zetasizer Nano ZS90, Malvern Instruments, UK). The zeta potential of nanoparticles was analyzed through the electrophoretic light scattering experiments by the Zetasizer instrument. Cytotoxicity and Cellular Uptake of siRNA Nanocomplexes in Vitro. The human umbilical vein endothelial cells (HUVECs) were purchased from ScienCell (Carlsbad, CA), and the cells were cultured at 37 °C in a cell incubator (Thermo Fisher, Cambridge, MA) with a CO2 concentration of 5%. The cytotoxicity of the PEI or neutralized PEI polymers and the PEI/siRNA complexes or the cross-linked systems loaded with siRNA was assessed by the MTS assay using HUVECs. In particular, cells were cultured on a 96-well plate with a density of 10 000 cells per well for 24 h in the complete endothelial cell medium (ECM) containing 5% FBS, 1% ECGS, and 1% PS. The solutions containing the cationic or neutralized polymers or siRNAloaded complexes were mixed with the transfection media which were prepared by the ECM containing 2% FBS and 1% ECGS. To assess the cytotoxicity, 100 μL of solutions of different polymer concentrations or complexes at different weight ratios of polymer: siRNA was added to the HUVEC culture following the removal of the original culture media. After 24 h incubation, the media in each well was replaced with a solution made of 100 μL of complete ECM and 20 μL of MTS reagent. The cells were incubated at 37 °C in the cell incubator for 1 h, and the absorbance was measured at 490 nm by the SpectraMax M2 microplate reader.

To measure the cellular uptake of siRNA or siRNA-loaded complexes, HUVECs were cultured on a 96-well plate at a density of 10 000 cells per well for 24 h. For cellular uptake analysis with different weight ratios of carrier:siRNA, the Cy3-labeled siRNA (siNCCy3) molecules were used. PEI/siNC-Cy3 complexes or neutral crosslinked nanoparticles with indicated weight ratios were prepared as described above. The siRNA solutions were added to the HUVEC culture at a final siRNA concentration of 50 nM and incubated with cells for 12 h. The cells were washed by DPBS to eliminate free nanoparticles in medium. After fixed by 50 μL of 4% polyformaldehyde (PFA) and stained with 50 μL of 4′,6-diamidino-2-phenylindole (DAPI) per well, the cells were imaged by an IX71 fluorescence microscope (Olympus, Japan). SiNC-Cy5 molecules were used for the cellular biodistribution of the nanoparticles in HUVECs. Cells were cultured on an 8-wells Nunc Lab-Tek Chamber Slide system (Thermo Fisher, Cambridge, MA) at the density of 20 000 cells each well for 24 h. After prepared at the weight ratios of polymer: siNC-Cy5 for the maximum transfection efficiency, the nanoparticles were diluted with the transfection medium to a final siRNA concentration of 50 nM and added into the cells for a 12 h incubation. Following washed by DPBS, fixed by 4% PFA and stained with DAPI, the cells were imaged by an A1R-si confocal microscope (Nikon, Japan). The flow cytometry analysis was performed for comparing the maximum cellular uptake efficiency of PEI, PEI-HYD, and PEI-HYDRGD. Briefly, cells were cultured on the 6-well plate with a cell density of 300 000 cells per well, and each group contained four wells. The siNC-Cy5 nanoparticles at the weight ratios of vector:siNC-Cy5 for maximum transfection efficiency were prepared as described above and the solution of nanoparticles were added into the cells with the siNCCy5 concentration of 50 nM. After washed by the DPBS, the cells of each group were detached by the trypsine and collected in a 5 mL tube. The cells were precipitated by a HR220 centrifugal machine (Thermo Fisher, Cambridge, MA) at the speed of 1000 rpm for 5 min, and the supernatants were discarded. After fixed by 4% PFA, the cells were washed by the DPBS and deposited by the centrifugal machine at 1000 rpm for 5 min. The cells were finally collected in 600 mL DPBS for flow cytometry analysis using a BD LSRFortessa (BD, New York), and the data were analyzed by the FlowJo software. Adult Zebrafish Heart Injury Models and Ventricular Resection. All procedures were performed in accordance with the regulations approved by the Institutional Animal Care and Use Committee (IACUC) of Peking University, and zebrafish were raised and handled in a facility that is fully accredited by the AAALAC. Wildtype TL, Tg(flk1:EGFP), and Tg(cmlc2:EGFP) transgenic zebrafish lines at 2−12 months of age were used for heart surgery. The ventricular resection was carried out according to a previously reported protocol.19 Briefly, the zebrafish was placed supinely into the groove of a sponge after anesthesia in tricaine. After removing the surface scales and a small piece of skin by iridectomy scissors, the pericardial sac was opened with the aid of tweezers, and the apex of the ventricle was gently clamped by tweezers and cut with Vannas scissors. The fish was put back into a water tank after the bleeding ceased due to the formation of blood clots. The water was puffed over the gills with a plastic pipet until the zebrafish breathed and swam normally. The surface wound sealed within a few days. Uptake of siRNA Delivery Complexes and the Gene Silencing Effects of the Aldh1a2 siRNA in the Zebrafish Heart. To investigate the zebrafish heart uptake of nanoparticles, siNC-Cy5 molecules were injected intrapleurally alone or through delivery systems. The PEI, PEI-HYD, and PEI-HYD-RGD complexed siNC-Cy5 nanoparticles at the weight ratios of polymer:siRNA for maximum transfection efficiency in vitro were obtained as described before. The siNC-Cy5 without carrier and the DPBS groups were used for control groups. The zebrafish was allowed to recover for 1 day after the resection, and 40 μL of nanoparticles solution was injected into the thoracic cavity with an siRNA dose of 2 mg/kg. Following 24 h of injection, the thoracic cavity of zebrafish was opened with the aid of tweezers. The outflow tract was gripped, and the whole heart was pulled out by the tweezers. The fluorescence intensity of siNC-Cy5 of C

DOI: 10.1021/acsami.6b13295 ACS Appl. Mater. Interfaces XXXX, XXX, XXX−XXX

Research Article

ACS Applied Materials & Interfaces

Scheme 1. Scheme of the Synthesis of PEI-HYD-RGD Material and the Fabrication Process of siRNA-Loaded Nanoparticles for siRNA Delivery in the Adult Zebrafish Heart

Figure 1. Characterization of PEI-HYD and PEI-HYD-RGD and their complexation with siRNA. (a) 1H NMR spectra of PEI, PEI-OMe, PEI-HYD, and PEI-HYD-RGD. (b) PEI-HYD and PEI-HYD-RGD formed complexes with siNC at acidic pH 5.0 while remain uncomplexed at pH 7.4. (c) siNC was entrapped in the complexes at the neutral pH when the cross-linking agent, glutaraldehyde (GA), was introduced at different weight ratios of GA/carrier. (d) Particle size and (e) zeta potential of PEI/siNC and cross-linked PEI-HYD/siNC nanocomplexes. the extracted hearts was detected by an in vivo imaging system (Kodak In-Vivo Imaging System FX Pro, Carestream Health). Three zebrafish were used for each group in the tissue uptake study. The efficacy of PEI-HYD-RGD in vivo was investigated by delivery of siAldh1a2 to the injured zebrafish heart. The DPBS, siAldh1a2 without vector, and the negative control siRNA (siNC) loaded nanoparticle groups were used as control. After the ventricle resection and recovery for 1 day, 40 or 10 μL solutions with the dose of siRNA at 2 or 0.5 mg/kg, respectively, were injected into the thoracic cavity. Another dose of nanoparticles was given following 24 h of the first dose, and the hearts were extracted as described above after 24 h of the second dose. The total RNA of the hearts was extracted by TRIzol

(Invitrogen, Carlsbad, CA) and reverse transcribed with TransScript First-Strand cDNA Synthesis SuperMix (Transgene, Beijing, China). The gene expression levels were analyzed using the SYBR Green realtime PCR kit (Transgene, Beijing, China) and quantified with the BioRad CFX96 real time PCR System (Bio-Rad, Hercules, CA). The Aldh1a2 gene expression levels were normalized to GAPDH values, and the relative expression was measured by the comparative CT method. The mean gene expression level was calculated from three duplicate samples. For the comparison of gene expression levels, all the groups were normalized to the DPBS control group. 5−10 zebrafish were used for each group. The primer sequences of Aldh1a2 and GAPDH were as follows: TGAGCGAGGAGCAGCAGAGA D

DOI: 10.1021/acsami.6b13295 ACS Appl. Mater. Interfaces XXXX, XXX, XXX−XXX

Research Article

ACS Applied Materials & Interfaces

Figure 2. Cytotoxicity and cellular uptake. (a) Cytotoxicity of PEI, PEI-HYD, or PEI-HYD-RGD at different concentrations and (b) the nanocomplexes formed at different polymer:siNC weight ratios or polymer weight concentrations. (c) Flow cytometry analysis of cellular uptake efficiency of siNC-Cy5 and the siNC-Cy5 loaded in nanocomplexes in HUVECs and the (d) quantification analysis of fluorescence intensity. Cells transfected with DPBS or siNC-Cy5 only were used as control groups, and all groups were normalized to the PEI mediated siRNA delivery group (*P < 0.05). (e) Confocal images of cellular uptake of PEI, PEI-HYD, or PEI-HYD-RGD complexed siNC-Cy5 nanoparticles. Scale bars: 25 μm; blue: DAPI nucleus; red: Cy5-labeled siNC molecules. (Aldh1a2-Forward); TCCACGAAGAAGCCTTTAGTAGCA (Aldh1a2-Revese); GATACACGGAGCACCAGGTT (GAPDH-Forward); GCCATCAGGTCACATACACG (GAPDH-Reverse). Distribution of siRNA Delivery Complexes in the Zebrafish Heart. Tg(flk1:EGFP) and Tg(cmlc2:EGFP) transgenic zebrafish were used for studying the biodistribution of the siRNA in the endothelial cells and cardiomyocytes, respectively. 40 μL of 3.75 μM siNC-Cy5 loaded PEI-HYD-RGD nanoparticles was injected into the thoracic cavity of the zebrafish after 1 day of the ventricle resection. Following 24 h of the injection, the hearts were extracted as described above, and the cryosection of the zebrafish heart was performed. Briefly, the heart was washed in PBS gently, placed in the tissue cassettes, embedded in OCT, and frozen on a piece of foam floating on liquid nitrogen until the OCT solidified. The samples were then cut into 5 μm thick sections by a cryosection machine and collected on glass slides. The cryosections were fixed by cold acetone and dyed with DAPI for nucleic staining. After mounted with a permount mounting medium (BOSTER, China) and covered by the coverslip, the glass slide was observed under the confocal microscope (Nikon, Japan). Statistical Analysis. Quantitative results were expressed as mean ± standard deviation. Statistical comparisons were carried out using two tailed Student’s t-test analysis of variance. All statistical tests were conducted using the GraphPad Prism software. P < 0.05 was considered to be statistically significant.

prepare a new form of PEI involves a two-step modification process in which the PEI (25 kDa) amines were first reacted with methyl acrylate through the Michael addition reaction and then an ester exchange reaction with hydrazine hydrate. The materials resulting from a high conversion level, PEI-HYD, contained the original polymeric chain of PEI, with each primary amines extended by two branches in the length of three carbons ended with a hydrazide group which allowed further chemical conjugation. To examine the delivery function of PEIHYD and enhance the cellular internalization, a common model peptide sequence binding to integrin receptors, CGRGDS, was linked to the hydrazide groups of PEI-HYD via SM(PEG)2 cross-linkers, resulting in PEI-HYD-RGD. The PEI-HYD conjugates were used to form nanocomplex with siRNA via a cross-linking process and the system was evaluated in a heart injury model in zebrafish. Figure 1a shows 1H NMR spectra of PEI and the modified PEI products, PEI-OMe, PEI-HYD, and PEI-HYD-RGD. In particular, the assay of primary amino groups (Figure S1) indicated that the Michael addition in the first modification step was efficient, and almost no primary amines could be detected in the adducts of PEI and methyl acrylate, PEI-OMe. While in the second step, all the methyl signals, attributable to the methyl ester initially introduced into PEI, disappeared according to the 1H NMR analysis (Figure 1a). The results suggest that the substitution level of the primary amino groups in PEI with hydrazide in PEI-HYD was nearly 100%. The modification degree of RGD peptide was 2% according to the calculation of arginine residues and hydrazides in the 1H NMR spectra of PEI-HYD-RGD (Figure 1a). The branched PEI polymers usually contain primary, secondary, and tertiary amine groups, with the pKa values spanning the physiological pH range,8 at around 9, 8, and 6−

■

RESULTS Synthesis of Neutralized PEI and Generation of Nanoscale siRNA Delivery Systems. It has been reported that PEI could cause cytotoxicity by compromising the membrane integrity and activating a “mitochondrially mediated apoptotic program”.16 In addition, the positive cations in the polymer may account for the cytotoxicity of PEI, as replacing the amino groups with noncharged hydrophilic molecules such as poly(ethylene glycol) could effectively reduce the polymer’s cytotoxic effects.20 As shown in Scheme 1, our strategy to E

DOI: 10.1021/acsami.6b13295 ACS Appl. Mater. Interfaces XXXX, XXX, XXX−XXX

Research Article

ACS Applied Materials & Interfaces

Figure 3. Tissue uptake of nanocomplexes and the Aldh1a2 gene silencing effect in zebrafish heart. (a) Scheme of the study of tissue uptake efficiency of siNC-Cy5 in zebrafish heart. (b) Cy5 fluorescence image of heart extracted from zebrafish injected with siNC-Cy5 and siNC-Cy5loaded nanocomplexes and (c) the quantification of Cy5 fluorescence intensity. Injections of DPBS or siNC-Cy5 were performed as control groups. (d) Scheme of the investigation on gene silencing effect of Aldh1a2 siRNA. Relative Aldh1a2 gene mRNA expression level in zebrafish hearts injected by nanoparticles with siRNA dose of (e) 0.5 and (f) 2.0 mg/kg were analyzed by q-PCR. (*P < 0.05; dpa: days postamputation).

7,21,22 respectively. After substituting the peripheral primary amines with neutral hydrazide groups, the PEI-HYD could only be pronated through the secondary/tertiary amines under acidic conditions. This led to the pH sensitivity of the PEIHYD, which only supported siRNA complexation at low pH values. In the fluorescent dye exclusion experiments, it was seen that the fluorescent intensity of siRNA kept decreasing due to the binding of the nucleic acids with PEI-HYD or PEI-HYDRGD at pH 5.0; in contrast, the siRNA basically remained free in the solution in the presence of the neutral polymers at pH 7.4 (Figure 1b). The onset of full complexation of siRNA occurred when the polymer:siRNA weight ratio reached 3.5 and 7 for PEI-HYD and PEI-HYD-RGD, corresponding to the polymer:siRNA molar ratio of 0.9 and 1.6, respectively. When the cross-linking agent, glutaraldehyde (GA), was introduced at certain weight ratio of GA:carrier, the siRNA could be entrapped in the cross-linked nanocomplex after the pH was raised to 7.4. This was shown in the gel retardation experiments, in which the movement of the siRNA entrapped in the nanocomplexes was prevented and the free siRNA bands could not be observed in the gel matrix (Figure 1c). To investigate the particles sizes and zeta potentials of the final cross-linked nanoparticles, a series of cross-linked nanoparticles with the carrier:siRNA weight ratio varied between 7 and 70 were prepared. It is shown that the sizes of the neutral cross-linked nanoparticles were round ranging from 150 to 250 nm. The cross-linked particles tended to increase in size compared to the un-cross-linked PEI/siRNA complexes (Figure 1d) and were also larger than the un-crosslinked PEI-HYD/siRNA nanocomplexes formed under pH 5.0 (Figure S2a). Meanwhile, the zeta potentials of the cross-linked particles were basically low or neutral within the range of ±10 mV. In contrast, the zeta potentials of PEI-based (Figure 1e) or the un-cross-linked PEI-HYD-based systems (Figure S2b) were measured positive and in the range of 15−30 mV. Cytotoxicity and Cellular Uptake of Neutral PEI-HYD Materials in Vitro. The cytotoxicity of the modified PEI polymers or the siRNA-loaded nanoparticles was evaluated in

HUVECs. As shown in Figure 2a, the PEI-HYD and PEI-HYDRGD exhibited no cytotoxicity even at high concentration of 100 μg/mL. In comparison, the cell viability was below the normal level with the presence of PEI at all the concentrations tested. Similarly, PEI/siRNA complexes started to cause cytotoxicity at the PEI:siRNA weight ratio of 14 with the PEI weight concentration of 20 μg/mL, while the PEI-HYD-based cross-linked nanoparticles showed no cytotoxicity even at high polymer:siRNA weight ratios (Figure 2b). The siRNA transfection efficiency of different delivery systems was first evaluated through fluorescent microscopic studies. The carrier:siRNA weight ratio was varied, and it was found that PEI, PEI-HYD, and PEI-HYD-RGD allowed the highest level of siRNA uptake at the carrier:siRNA ratio of 7, 35, and 14, respectively (Figure S3). In the following studies, these ratios were used to formulate each type of siRNA-loaded nanoparticles. The flow cytometry analysis was performed to quantify the siRNA uptake by HUVECs. As is shown, the PEIHYD-based nanoparticles allowed the highest cellular uptake level among the three types of systems (Figure 2c,d) according to the analysis of the mean fluorescence intensity of the Cy5labeled siRNA. In the confocal microscopic studies, the three types nanoparticles were internalized and visible in the cytoplasm of HUVECs and mostly in the region surrounding the nucleus. Notably, the internalized siRNA in the cross-linked PEI-HYD tended to aggregate and localize around the nucleus shown in relatively big bright spots. In contrast, the siRNA delivered through PEI and PEI-HYD-RGD systems spread more homogeneously throughout the cytoplasm (Figure 2e). Tissue Uptake and Gene Silencing Effects of PEI-HYDBased siRNA Delivery System in Vivo. The siRNA delivery efficiency of the neutralized PEI was further studied in the zebrafish heart injury model. After about 10% resection of the apex ventricle of the zebrafish heart, nanoparticles carrying indicated siRNAs was injected intrapleurally into the zebrafish. The tissue uptake efficiency was investigated after one dose of nanoparticles carrying siNC-Cy5 molecules was given (Figure F

DOI: 10.1021/acsami.6b13295 ACS Appl. Mater. Interfaces XXXX, XXX, XXX−XXX

Research Article

ACS Applied Materials & Interfaces

Figure 4. Fluorescent images show evident delivery of siNC-Cy5 in the heart tissue, as indicated by the presence of Cy5-labeled siNC in the flk1:EGFP positive endothelial cells (a−c) and cmlc2:EGFP positive myocardium (d−f). The boxed areas in (a) and (d) are magnified as illustrated. Scale bars: 25 μm; white arrows: colocalization of EGFP-expressing cells and siNC-Cy5 signals.

of PEI-HYD-RGD/siNC-Cy5 nanoparticles in the transgenic zebrafish lines. In particular, the flk1:EGFP and cmlc2:EGFP zebrafish, which express EGFP genes specifically in endothelial cells and cardiomyocytes, respectively, were used. The zebrafish hearts were extracted 24 h following the injection of the neutral cross-linked nanoparticles and the heart tissue was cryosectioned and imaged. As shown in Figure 4, individual endothelial cells and cardiomyocytes were identifiable in the confocal microscopic images. On the cellular level, the Cy5 siRNA particles shown in red were found to colocalize with the cells expressing GFP in the injured area. Although it is known that the RGD peptide binds to integrin receptors and has been used to target endothelial cells,24,25 the PEI-HYD-RGD nanoparticles actually displayed a broad biodistribution. In fact, more nanoparticles were found localized within the cardiomyocytes (Figure 4d−f) than the endothelial cells in the tissue slide images (Figure 4a−c). This may be due to the relatively higher number/density of cardiomyocytes in the heart compared to other types of cells. It is also noted that the nanoparticles were only observable in the superficial tissue of the injured heart, approximately 70 μm in thickness. The limited penetration depth may be due to the endothelium barrier.

3a). As shown in Figure 3b,c, the tissue uptake of Cy5-labeled siRNA in the amputated heart was detectable through imaging the whole heart explanted from the zebrafish. The quantitative analysis showed that the siRNA level was highest in the heart tissue injected with PEI-HYD-RGD-based nanoparticles among different test groups. Although the native PEI also enabled a higher level of siRNA delivery compared to the naked uncomplexed siRNA, the uptake of siRNA in the PEI groups was significantly lower compared to PEI-HYD-RGD (P = 0.0249) (Figure 3b,c). The unmodified PEI-HYD without RGD conjugation did not show any effect on improving the tissue uptake in vivo compared to the naked siRNA (Figure 3b,c). The performance of PEI-HYD nanoparticles in vivo was different from the in vitro which may indicate the necessary of the targeting ligand for the siRNA delivery in vivo. The ability of the PEI-HYD-RGD complexes to silence the expression of Aldh1a2 (retinoic acid (RA)-synthesizing enzyme), a gene involved in the regeneration and showing upregulation after the resection injury,23 was studied. Following two doses of siRNA nanoparticles, the Aldh1a2 gene expression was assayed on the homogenized heart tissues (Figure 3d). It was found that the Aldh1a2 mRNA expression level could be knocked down by approximate 50% when using the crosslinked PEI-HYD-RGD as the siAldh1a2 delivery vehicle. The effect is specific as no gene silencing effect was found when the scrambled siRNA was delivered. It was noted that the silencing effect of PEI-HYD-RGD/siAldh1a2 complexes could not be further improved when the siRNA dosage was increased from 0.5 mg/kg (10 μL of nanoparticles injected) to 2.0 mg/kg (40 μL of nanoparticles injected) (Figure 3e,f). It may suggest that 10 μL of the nanoparticles was enough for the efficient siRNA delivery via the intrapleural injection due to the limited space of the thoracic cavity of the zebrafish. To understand the delivery mechanism of the neutral crosslinked nanoparticles, we further studied the cellular distribution

■

DISCUSSION A therapeutic gene, a delivery vector, and a delivery method are three key elements for a successful gene therapy.5 Although viral vectors were mostly investigated for gene delivery in clinical trials,26,27 nonviral vectors such as lipoplex, polyplex, dendrimer, or graphene were also extensively studied with the promise to overcome the immunogenicity and carcinogenecity problems associated with the viral vehicles. Among the synthetic nonviral materials, polyethylenimine (branched PEI, 25 kDa) remains a gold standard of polymeric vehicles,28 and the strategy for delivering nucleic acids into heart also involved G

DOI: 10.1021/acsami.6b13295 ACS Appl. Mater. Interfaces XXXX, XXX, XXX−XXX

Research Article

ACS Applied Materials & Interfaces

through selecting the functional ligand that may enhance the cell uptake and further improve the siRNA transfection level. Cardiovascular disease (CVD) has been the leading cause of morbidity and mortality globally.42−45 Current treatments for the heart failure are mainly based on drugs, devices, or even heart transplantation. Gene therapies, by correcting molecular defects through the cells’ own genetic machinery, have attracted great interest.5,6 Delivery of DNA, mRNA, or siRNA delivery developed for the treatment of cardiac diseases may show advantages of specificity, high potency, low toxicity, and potential complete remission of the disease.43 In particular, small RNA molecules, which initiate RNA interference (RNAi) in the cytoplasm, have great potential due to the target sequence specificity and ease of design and synthesis. As an important and widely used vertebrate model organism, zebrafish heart has the unique regeneration capability even with the amputation up to 10%−20% of the cardiac apex.46 Zebrafish can therefore provide models for elucidation of heart regeneration mechanisms that may benefit the treatment of human CVD. Many gene targets related in the regenerative process of zebrafish heart have been discovered.47−51 It is therefore important to demonstrate how to take advantage of zebrafish heart injury model for studying the kinetic distribution of nanoparticles. In our study, the effectiveness to downregulate the expression of Aldh1a2 proved that the PEI-HYD-RGD polymers provide a useful approach to construct the siRNA delivery system. On the other hand, zebrafish demonstrates to be a convenient model to investigate problems that are hard to carry out in mammals. By taking advantage of the flk1:EGPF and cmlc2:EGFP transgenic lines of zebrafish, we showed the possibility to investigate the distribution of siRNA on the cellular level in vivo. The work may actually open the door for elucidation of nanoparticle mechanisms in the heart and provide insight into how to design suitable vehicles for in vivo applications. It was shown that the nanoparticles were mainly within the area of the injured ventricle apex following the local injection. The uptake of siRNA was observed in both endothelial cells and cardiomyocytes. The results may reflect the pathological characteristics of the injured area, where the inflammatory cells, proliferating epicardial cells, endothelial cells, and cardiomyocytes were recruited to regenerate the heart tissue.52−54 The highly proliferative property of the cells may have enhanced the internalization of nanoparticles.55,56 The altered vascular permeability following injury57 may also facilitate the penetration and retention of nanoparticles in the damaged area.58,59 It is worthy to note that besides the endothelial cells and cardiomyocytes, the uptake of nanoparticles could occur in other types of cells including macrophages and fibroblasts, etc. It is necessary to establish relevant protocols to further profile the spatial distribution and kinetics of the nanoparticles on the cellular level in the heart tissue. This would provide key understandings and pave the way to developing delivery systems that could show cell-targeting behaviora highly desired feature with the potential to improve the treatment of CVD. Despite the advantages and convenience of zebrafish models, it should be noted that the heart of zebrafish has only two chambers and is fully regenerative after injury. This characteristic is typically different from mammalians. Actually, considering the limited proliferation capability of mammalian

using low molecular weight PEIs. For example, the facial amphipathic deoxycholic acid-modified low molecular weight polyethylenimine (DA-PEI) conjugates were reported for carrying DNA or siRNA into the heart in murine models to reduce the apoptotic cell death and infarction size.29,30 Nevertheless, the low molecular weight PEI may still show cytotoxicity due to positive charges, in addition to other issues including reduced condensation efficiency and the difficulty to diffuse through the densely packed anionic extracellular matrix.31,32 In this study, the highly branched positively charged PEI was transformed into a new polymer. As the hydrazide groups are polar and hydrophilic, the new polymers remained soluble in water. The polymer could also reversibly transition between neutral and positively charged states in response to the pH condition, leading to its pH-sensitive behavior to associate with siRNA. It is noted that compared to the conventional polyplex systems, the modified PEI polymer proved to be highly biocompatible, showing no cytotoxicity in the cell culture (Figure 2a). The result indicates that the cytotoxicity in the original PEI may be largely due to the primary amines in the polymer. Although the secondary and tertiary amines remain in the PEI-HYD polymers, these groups are mainly uncharged under the physiological condition and therefore may not bind to membranous structures to cause any cellular damage. On the other hand, the conversion of primary amines should be high, as the PEI with low modification levels may still show cytotoxicity.33−35 Homogenous nanosized particulates were obtained under acidic condition at pH 5 via the condensation with siRNA. As the pKa of the hydrazide groups was around 3.6,36 the protonation of secondary/tertiary amines in the PEI-HYD mostly likely accounted for the pH sensitivity and the siRNA complexation behavior of PEI-HYD. The process is facile and the nanocomplexes could be fixed through the chemical crosslinking process, which may not only entrap the siRNA molecules, but also further allow triggerable release of RNA cargo due to the pH sensitivity of the cross-linking bond hydrazone.37,38 It is speculated that the hydrazone bonds would actually breakdown once the particles were in the acidic endosomes following the cellular uptake. After the release of nanoparticles from the endosomes, siRNA molecules could be released from the nanoparticles due to the incapability of PEIHYD to bind with siRNA in the cytoplasm where the pH is around 7.4. As shown in Figure 2c,d, PEI, PEI-HYD, and PEI-HYD-RGD could all mediate the cellular internalization of siRNA nanocomplexes in HUVECs; PEI-HYD-RGD nanoparticles was the most efficient material among the three to facilitate the uptake of siRNA complexes in zebrafish heart (Figure 3b,c). The RGD ligand seemed to show better effects on improving the cellular uptake in vivo. Indeed, PEI-based systems tended to enter cells through caveolae-mediated endocytosis or micropinocytosis.39 It has been reported that the number of the caveolae expressed in the endothelium in vivo was 10−1000fold of that in vitro.40 As RGD is an adhesive peptide known for high avidity with integrin and have been shown to mediate the caveolae-dependent endocytosis,41 the RGD ligand may therefore facilitate the internalization of PEI-HYD-RGD nanoparticles in the zebrafish heart. Given the siRNA silencing effects observed in zebrafish, it is worthwhile to further understand how to improve the in vivo delivery efficiency H

DOI: 10.1021/acsami.6b13295 ACS Appl. Mater. Interfaces XXXX, XXX, XXX−XXX

Research Article

ACS Applied Materials & Interfaces

to The Central Nervous System: Formulating the Solution. J. Pharm. Sci. 2013, 102, 3469−3484. (5) Mason, D.; Chen, Y. Z.; Krishnan, H. V.; Sant, S. Cardiac Gene Therapy: Recent Advances and Future Directions. J. Controlled Release 2015, 215, 101−111. (6) Li, R. Q.; Wu, Y.; Zhi, Y.; Yang, X.; Li, Y.; Xua, F. J.; Du, J. PGMA-Based Star-Like Polycations with Plentiful Hydroxyl Groups Act as Highly Efficient miRNA Delivery Nanovectors for Effective Applications in Heart Diseases. Adv. Mater. 2016, 28, 7204−7212. (7) Pandey, A. P.; Sawant, K. K. Polyethylenimine: A Versatile, Multifunctional Non-Viral Vector for Nucleic Acid Delivery. Mater. Sci. Eng., C 2016, 68, 904−918. (8) Akinc, A.; Thomas, M.; Klibanov, A. M.; Langer, R. Exploring Polyethylenimine-Mediated DNA Transfection and The Proton Sponge Hypothesis. J. Gene Med. 2005, 7, 657−663. (9) Behr, J.-P. The Proton Sponge a Trick to Enter Cells the Viruses Did Not Exploit. Chimia 1997, 51, 34−36. (10) Fischer, D.; Bieber, T.; Li, Y.; Elsässer, H.-P.; Kissel, T. A Novel Non-Viral Vector for DNA Delivery Based on Low Molecular Weight, Branched Polyethylenimine Effect of Molecular Weight on Transfection Efficiency and Cytotoxicity. Pharm. Res. 1999, 16, 1273−1279. (11) Jager, M.; Schubert, S.; Ochrimenko, S.; Fischer, D.; Schubert, U. S. Branched and Linear Poly(ethylene imine)-Based Conjugates: Synthetic Modification, Characterization, and Application. Chem. Soc. Rev. 2012, 41, 4755−4767. (12) He, C.; Hu, Y.; Yin, L.; Tang, C.; Yin, C. Effects of Particle Size and Surface Charge on Cellular Uptake and Biodistribution of Polymeric Nanoparticles. Biomaterials 2010, 31, 3657−3666. (13) Roger, C.; Adami; Rice, K. G. Metabolic Stability of Glutaraldehyde Cross-Linked Peptide DNA Condensates. J. Pharm. Sci. 1999, 88, 739−746. (14) Adami, R. C.; Collard, W. T.; Gupta, S. A.; Kwok, K. Y.; Bonadio, J.; Rice, K. G. Stability of Peptide-Condensed Plasmid DNA Formulations. J. Pharm. Sci. 1998, 87, 678−683. (15) Islam, M. A.; Park, T. E.; Singh, B.; Maharjan, S.; Firdous, J.; Cho, M. H.; Kang, S. K.; Yun, C. H.; Choi, Y. J.; Cho, C. S. Major Degradable Polycations as Carriers for DNA and siRNA. J. Controlled Release 2014, 193, 74−89. (16) Moghimi, S. M.; Symonds, P.; Murray, J. C.; Hunter, A. C.; Debska, G.; Szewczyk, A. A Two-Stage Poly(ethylenimine)-Mediated Cytotoxicity: Implications for Gene Transfer/Therapy. Mol. Ther. 2005, 11, 990−995. (17) Liu, J.; Zhou, J.; Luo, Y. SiRNA Delivery Systems Based on Neutral Cross-linked Dendrimers. Bioconjugate Chem. 2012, 23, 174− 183. (18) Liu, X.; Liu, J.; Luo, Y. Facile Glycosylation of Dendrimers for Eliciting Specific Cell−Material Interactions. Polym. Chem. 2012, 3, 310−313. (19) Diao, J.; Wang, H.; Chang, N.; Zhou, X. H.; Zhu, X.; Wang, J.; Xiong, J. W. PEG-PLA Nanoparticles Facilitate siRNA Knockdown in Adult Zebrafish Heart. Dev. Biol. 2015, 406, 196−202. (20) Hunter, A. C. Molecular Hurdles in Polyfectin Design and Mechanistic Background to Polycation Induced Cytotoxicity. Adv. Drug Delivery Rev. 2006, 58, 1523−1531. (21) Suh, J.; Lee, Y.; Han, S. Activation and Stabilization of Chymotrypsin in Microdomains of Poly(ethylenimine) Derivatives. A Model of In Vivo Environment. Bioorg. Med. Chem. Lett. 1998, 8, 1331−1336. (22) Godbey, W. T.; Wu, K. K.; Mikos, A. G. Size Matters Molecular Weight Affects the Efficiency of Poly(ethylenimine) as a Gene Delivery Vehicle. J. Biomed. Mater. Res. 1999, 45, 268−275. (23) Kikuchi, K.; Holdway, J. E.; Major, R. J.; Blum, N.; Dahn, R. D.; Begemann, G.; Poss, K. D. Retinoic Acid Production by Endocardium and Epicardium Is an Injury Response Essential for Zebrafish Heart Regeneration. Dev. Cell 2011, 20, 397−404. (24) Temming, K.; Schiffelers, R. M.; Molema, G.; Kok, R. J. RGDBased Strategies for Selective Delivery of Therapeutics and Imaging Agents to the Tumour Vasculature. Drug Resist. Updates 2005, 8, 381− 402.

cells, the uptake of nanoparticles by cardiomyocytes or endothelial cells in mammalian models may not be as high as in zebrafish experiments. Future studies should be also carried out in mammalian models to further understand the properties of nanoparticles in the heart.

■

CONCLUSIONS Through neutralizing the peripheral primary amine groups of a PEI polymer, the original PEI can be transformed into a noncytotoxic polymer material bearing hydrazide for further modification with peptide ligands. The new conjugates demonstrate the capability to produce homogeneous, biocompatible cross-linked nanoparticles suitable for intracellular delivery of siRNA. The delivery of nucleic acids was efficient in the heart tissue in the zebrafish model. The PEI-HYDpeptide may be further developed with functions with advanced targeting and siRNA transfection efficiency for treating cardiac diseases.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsami.6b13295. TNBSA analysis of amino groups of PEI-OMe (Figure S1), sizes and zeta potentials of the un-cross-linked nanoparticles (Figure S2), and fluorescent microscope analysis of cellular uptake efficiency of PEI, PEI-HYD, and PEI-HYD-RGD formulated nanoparticles at different carrier:siRNA ratios (Figure S3) (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*(Y.L.) Tel +86 (10) 8252-9288; Fax +86 (10) 8252-9288; email [email protected]. ORCID

Ying Luo: 0000-0001-9834-9419 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This research was financially supported by the National Natural Science Foundation of China (Project No. 31370955 and 31322021) and the National Key Research and Development Program of China (Project No. 2016YFC1101301). We thank Dr. Zicai Liang, Dr. Yanglong Hou, and Dr. Qiushi Ren for assisting with whole heart imaging, DLS, and lyophilization experiments, respectively.

■

REFERENCES

(1) Draz, M. S.; Fang, B. A.; Zhang, P.; Hu, Z.; Gu, S.; Weng, K. C.; Gray, J. W.; Chen, F. F. Nanoparticle-Mediated Systemic Delivery of siRNA for Treatment of Cancers and Viral Infections. Theranostics 2014, 4, 872−892. (2) Gandhi, N. S.; Tekade, R. K.; Chougule, M. B. Nanocarrier Mediated Delivery of siRNA/miRNA in Combination with Chemotherapeutic Agents for Cancer Therapy: Current Progress and Advances. J. Controlled Release 2014, 194, 238−256. (3) Gomes, M. J.; Martins, S.; Sarmento, B. siRNA as a Tool to Improve the Treatment of Brain Diseases: Mechanism, Targets and Delivery. Ageing Res. Rev. 2015, 21, 43−54. (4) O’Mahony, A. M.; Godinho, B. M.; Cryan, J. F.; O’Driscoll, C. M. Non-Viral Nanosystems for Gene and Small Interfering RNA Delivery I

DOI: 10.1021/acsami.6b13295 ACS Appl. Mater. Interfaces XXXX, XXX, XXX−XXX

Research Article

ACS Applied Materials & Interfaces

Cardiovascular Diseases: Opportunities and Challenges. Clin. Sci. 2014, 127, 351−365. (44) Monaghan, M.; Greiser, U.; Wall, J. G.; O’Brien, T.; Pandit, A. Interference: an AlteRNAtive Therapy Following Acute Myocardial Infarction. Trends Pharmacol. Sci. 2012, 33, 635−645. (45) Raghunathan, S.; Patel, B. M. Therapeutic Implications of Small Interfering RNA in Cardiovascular Diseases. Fundam. Clin. Pharmacol. 2013, 27, 1−20. (46) Poss, K. D.; Wilson, L. G.; Keating, M. T. Heart Regeneration in Zebrafish. Science 2002, 298, 2188−2190. (47) Gemberling, M.; Bailey, T. J.; Hyde, D. R.; Poss, K. D. The Zebrafish as a Model for Complex Tissue Regeneration. Trends Genet. 2013, 29, 611−620. (48) Asnani, A.; Peterson, R. T. The Zebrafish as a Tool to Identify Novel Therapies for Human Cardiovascular Disease. Dis. Models & Mech. 2014, 7, 763−767. (49) Kikuchi, K. Advances in Understanding the Mechanism of Zebrafish Heart Regeneration. Stem Cell Res. 2014, 13, 542−555. (50) Kikuchi, K.; Poss, K. D. Cardiac Regenerative Capacity and Mechanisms. Annu. Rev. Cell Dev. Biol. 2012, 28, 719−741. (51) Rubin, N.; Harrison, M. R.; Krainock, M.; Kim, R.; Lien, C. L. Recent Advancements in Understanding Endogenous Heart Regeneration-Insights from Adult Zebrafish and Neonatal Mice. Semin. Cell Dev. Biol. 2016, 58, 34−40. (52) Raya, A.; Koth, C. M.; Buscher, D.; Kawakami, Y.; Itoh, T.; Raya, R. M.; Sternik, G.; Tsai, H. J.; Rodriguez-Esteban, C.; IzpisuaBelmonte, J. C. Activation of Notch Signaling Pathway Precedes Heart Regeneration in Zebrafish. Proc. Natl. Acad. Sci. U. S. A. 2003, 100, 11889−11895. (53) Gonzalez-Rosa, J. M.; Martin, V.; Peralta, M.; Torres, M.; Mercader, N. Extensive Scar Formation and Regression During Heart Regeneration after Cryoinjury in Zebrafish. Development 2011, 138, 1663−1674. (54) Schnabel, K.; Wu, C. C.; Kurth, T.; Weidinger, G. Regeneration of Cryoinjury Induced Necrotic Heart Lesions in Zebrafish Is Associated with Epicardial Activation and Cardiomyocyte Proliferation. PLoS One 2011, 6, e18503. (55) Kim, J. A.; Aberg, C.; Salvati, A.; Dawson, K. A. Role of Cell Cycle on the Cellular Uptake and Dilution of Nanoparticles in a Cell Population. Nat. Nanotechnol. 2012, 7, 62−68. (56) Serdiuk, T.; Lysenko, V.; Mognetti, B.; Skryshevsky, V.; Geloen, A. Impact of Cell Division on Intracellular Uptake and Nuclear Targeting with Fluorescent SiC-Based Nanoparticles. Journal of Biophotonics 2013, 6, 291−297. (57) Weis, S. M. Vascular Permeability in Cardiovascular Disease and Cancer. Curr. Opin. Hematol. 2008, 15, 243−249. (58) Lundy, D. J.; Chen, K.-H.; Toh, E. K. W.; Hsieh, P. C. H. Distribution of Systemically Administered Nanoparticles Reveals a Size-Dependent Effect Immediately following Cardiac IschaemiaReperfusion Injury. Sci. Rep. 2016, 6, 25613. (59) Paulis, L. E.; Geelen, T.; Kuhlmann, M. T.; Coolen, B. F.; Schafers, M.; Nicolay, K.; Strijkers, G. J. Distribution of Lipid-Based Aanoparticles to Infarcted Myocardium with Potential Application for MRI-Monitored Drug Delivery. J. Controlled Release 2012, 162, 276− 285.

(25) Danhier, F.; Le Breton, A.; Preat, V. RGD-Based Strategies to Target Alpha(v) Beta(3) Integrin in Cancer Therapy and Diagnosis. Mol. Pharmaceutics 2012, 9, 2961−2973. (26) Matkar, P. N.; Leong-Poi, H.; Singh, K. K. Cardiac Gene Therapy: Are We There Yet? Gene Ther. 2016, 23, 635−648. (27) Mullard, A. Gene Therapies Advance Towards Finish Line. Nat. Rev. Drug Discovery 2011, 10, 719−720. (28) Yockman, J. W.; Kastenmeier, A.; Erickson, H. M.; Brumbach, J. G.; Whitten, M. G.; Albanil, A.; Li, D. Y.; Kim, S. W.; Bull, D. A. Novel Polymer Carriers and Gene Constructs for Treatment of Myocardial Ischemia and Infarction. J. Controlled Release 2008, 132, 260−266. (29) Kim, D.; Hong, J.; Moon, H. H.; Nam, H. Y.; Mok, H.; Jeong, J. H.; Kim, S. W.; Choi, D.; Kim, S. H. Anti-Apoptotic Cardioprotective Effects of SHP-1 Gene Silencing Against Ischemia-Reperfusion Injury: Use of Deoxycholic Acid-Modified Low Molecular Weight Polyethyleneimine as a Cardiac siRNA-Carrier. J. Controlled Release 2013, 168, 125−134. (30) Hong, J.; Ku, S. H.; Lee, M. S.; Jeong, J. H.; Mok, H.; Choi, D.; Kim, S. H. Cardiac RNAi Therapy Using RAGE siRNA/Deoxycholic Acid-Modified Polyethylenimine Complexes for Myocardial Infarction. Biomaterials 2014, 35, 7562−7573. (31) Chen, Z.-Y.; Liang, K.; Qiu, R.-X.; Luo, L.-P. Ultrasound- and Liposome Microbubble Mediated Targeted Gene Transfer to Cardiomyocytes In Vivo Accompanied by Polyethylenimine. J. Ultrasound Med. 2011, 30, 1247−1258. (32) Lee, Y.-S. Appraisal of Polyethyleneimine Used as A Tracer for Anionic Sites in Human Cardiac Tissues with A Brief Reference to Anionic Molecular Organization in Altered Basement Membranes. J. Mol. Cell. Cardiol. 1986, 18, 529−539. (33) Creusat, G.; Thomann, J.-S.; Maglott, A.; Pons, B.; Dontenwill, M.; Guérin, E.; Frisch, B.; Zuber, G. Pyridylthiourea-Grafted Polyethylenimine Offers an Effective Assistance to siRNA-Mediated Gene Silencing In Vitro and In Vivo. J. Controlled Release 2012, 157, 418−426. (34) Oskuee, R. K.; Philipp, A.; Dehshahri, A.; Wagner, E.; Ramezani, M. The Impact of Carboxyalkylation of Branched Polyethylenimine on Effectiveness in Small Interfering RNA Delivery. Journal of Gene Medicine 2010, 12, 729−738. (35) Pezzoli, D.; Olimpieri, F.; Malloggi, C.; Bertini, S.; Volonterio, A.; Candiani, G. Chitosan-Graft-Branched Polyethylenimine Copolymers: Influence of Degree of Grafting on Transfection Behavior. PLoS One 2012, 7, e34711. (36) Radushev, A. V.; Chekanova, L. G.; Gusev, V. Y.; Sazonova, E. A. Determination of Hydrazides and 1,2-Diacylhydrazines of Aliphatic Carboxylic Acids by Conductometric Titration. J. Anal. Chem. 2000, 55, 445−448. (37) Rao, N. V.; Mane, S. R.; Kishore, A.; Das Sarma, J.; Shunmugam, R. Norbornene Derived Doxorubicin Copolymers as Drug Carriers with pH Responsive Hydrazone Linker. Biomacromolecules 2012, 13, 221−230. (38) Ding, X.; Liu, Y.; Li, J.; Luo, Z.; Hu, Y.; Zhang, B.; Liu, J.; Zhou, J.; Cai, K. Hydrazone-Bearing PMMA-Functionalized Magnetic Nanocubes as pH-Responsive Drug Carriers for Remotely Targeted Cancer Therapy In Vitro and In Vivo. ACS Appl. Mater. Interfaces 2014, 6, 7395−7407. (39) Singh, B.; Maharjan, S.; Park, T.-E.; Jiang, T.; Kang, S.-K.; Choi, Y.-J.; Cho, C.-S. Tuning the Buffering Capacity of Polyethylenimine with Glycerol Molecules for Efficient Gene Delivery: Staying In or Out of the Endosomes. Macromol. Biosci. 2015, 15, 622−635. (40) Gratton, J. P.; Bernatchez, P.; Sessa, W. C. Caveolae and Caveolins in the Cardiovascular System. Circ. Res. 2004, 94, 1408− 1417. (41) Choi, S. I.; Maeng, Y. S.; Kim, T. I.; Lee, Y.; Kim, Y. S.; Kim, E. K. Lysosomal Trafficking of TGFBIp via Caveolae-Mediated Endocytosis. PLoS One 2015, 10, e0119561. (42) Braunwald, E. The War against Heart Failure: the Lancet Lecture. Lancet 2015, 385, 812−824. (43) Kwekkeboom, R. F.; Lei, Z.; Doevendans, P. A.; Musters, R. J.; Sluijter, J. P. Targeted Delivery of miRNA Therapeutics for J

DOI: 10.1021/acsami.6b13295 ACS Appl. Mater. Interfaces XXXX, XXX, XXX−XXX