A Rapid Method for Differentiating Four Species of the Engraulidae

Article pubs.acs.org/JAFC

A Rapid Method for Differentiating Four Species of the Engraulidae (Anchovy) Family Hicham Chairi† and Laureana Rebordinos* Laboratorio de Genética, Facultad de Ciencias del Mar y Ambientales, CACYTMAR, Universidad de Cádiz, Polígono Río San Pedro, s/n, 11510, Puerto Real, Cádiz, Spain ABSTRACT: The four species of the Engraulidae family: European anchovy (Engraulis encrasicolus), Californian anchovy (Engraulis mordax), Peruvian anchoveta (Engraulis ringens), and Japanese anchovy (Engraulis japonicus) studied in this work are very similar morphologically, and it is very difficult to distinguish between them, especially when frozen or processed. We have used the 5S rDNA as a molecular marker to discriminate these four species and used specific primers designed for each species in the nontranscribed spacers (NTS) of these genes. Multiplex PCR was performed with three pairs of primers, and three different sizes were obtained: 597 bp E. encrasicolus, 598 bp E. japonicus, 380 bp E. mordax, and 250 bp E. ringens. For the species E. encrasicolus and E. japonicus, PCR-RFLP was used as an additional technique to distinguish between them because their NTS sequences showed considerable similarity. KEYWORDS: Engraulidae, species identification, seafood fraud, molecular markers, 5S rDNA

■

istics to DNA analysis.2,3 However, the latter approach has proved to be more stable than that of protein markers which are affected by the various industrial processes applied to many products. In recent years, methods of authentication based of molecular PCR amplification have been developed4−7 and these methods have been successfully applied for the authentication of individual species of anchovy.8−10 Among many nuclear and mitochondrial markers studied so far, the 5S rDNA is of particular interest in the identification of species because its characteristics make it an ideal specific marker for marine species.11−14 In particular, its high degree of conservation means that only universal primers need to be used to amplify it. Further, the flanking of nontranscribed spacers (NTS) between the repeating units of 5S rRNA facilitates amplification and subsequent use as a molecular marker. Fast rates of replacement of the base, together with gene conversion of the NTS, should make 5S rRNA a good candidate for comparing closely related species. In our study to identify and differentiate the four species of Engraulis, the multiplex PCR technique applied to specific fragments of 5S rDNA gene shows whether a DNA sample from an anchovy belongs one or other of four particular species: E. encrasicolus (Linnaeus, 1758), Engraulis mordax (Girard, 1854), Engraulis ringens (Jenyns, 1842), or Engraulis japonicus (Temminck and Schlegel, 1846), although the latter requires additional RFLP. This technique should be of great interest from the marketing perspective because the anchovy fisheries in Europe are suffering overexploitation and continued periods of closure. As a result, we are seeing a significant increase in imports of other anchovy species to alleviate the shortage of supply. These imported products can be frozen or

INTRODUCTION The development of the food industry, and trade in foods generally and in seafood in particular, which includes highly perishable products, has led to the creation of mechanisms for the traceability and quality control of particular food products. Today, food safety is one of the main issues related to the seafood industry and is an essential part of food and nutritional quality in the world. Meeting the requirements set by the authorities for the production and consumption of foods is vitally important for society in all countries and has major economic, social and, in many cases, environmental impacts. The issue of food safety has grown in importance over the past 30 years or more, in parallel with the strong growth of international trade in fishery products. Anchovies represent at least 15% of the 90 million tons of fish caught annually in the world.1 The critical situation of the fisheries of the European anchovy Engraulis encrasicolus due to overfishing and likely climate change has forced the authorities to sound the alarm and propose that this resource should be conserved by means of periods of biological rest or closure to fishing. As a result, attention has turned to foreign fisheries, especially in Latin America. This has involved, inter alia, implementing food safety systems to prevent fraud or mislabeling of fish and anchovy-based foods because species of the Engraulidae family are very similar morphologically. The increasing industrial interest in rapid methods of traceability and food safety has led to the development and application of methods for the detection and identification of substituted species and other ingredients used in food processing. The most recent and innovative techniques are those based on genetics that enable the correct identification of species, thus preventing fraud and ensuring reliability for commercial transactions. In this context, to improve fraud detection in commercial marine products, a number of techniques have been developed, ranging from protein markers and immunological character© 2014 American Chemical Society

Received: Revised: Accepted: Published: 2803

December 18, 2013 March 5, 2014 March 14, 2014 March 14, 2014 dx.doi.org/10.1021/jf405680g | J. Agric. Food Chem. 2014, 62, 2803−2808

Journal of Agricultural and Food Chemistry

Article

Table 1. Size of the PCR Products Using Universal Primers and Species-Specific Primers PCR amplicon with universal primers (bp)

access number

E. encrasicolus

431 643−665

JX070003 JX070004-JX070011

Fw: CCCAAAAAGGTAAGGAGAAAG Rev: TGCAACATTGCAACAAAACTT

597

E. mordax

472

JX070012-JX070023

Fw: TGAAAAGACATTCTCACGTTGTG Rev: ACGGTCCTCCTCTCACAGTC

380

E. ringens

422−454

JX070024-JX070033

Fw: TGAAAAAGGGAATGGGGTTT Rev: CGGTCCTTTTAGGGTTAGGG

250

E. japonicus

443 641−664

KF479206 KF479207-KF479213

Fw: CCCAAAAAGGTAAGGAGAAAG Rev: TGCAACATTGCAACAAAACTT

598

species

species-specific primers

PCR amplicon with species-specific primers (bp)

Figure 1. Amplification products of 5S rDNA using universal primers in three independent individuals of (a) E. encrasocilus, (b) E. mordax, (c) E. ringens, and (d) E. japonicus. In addition to the main amplification product, some secondary bands appeared due to different types of 5 S rDNA. (Macherey-Nagel, Inc., Bethlehem, PA) and cloned using the pGEM cloning kit from T Easy Vector Systems (Promega, Madison, WI). The sequencing was carried out using a sequencing kit (BigDye Terminator v 3.1 Cycle Sequencing Kit, Applied Biosystems). Sequencing peaks were analyzed with Chromas 2.0, and the sequences obtained were aligned using the ClustalW and BioEdit programs Design of Species-Specific Primers of 5S rDNA. Alignment of the 5S rDNA sequences of the four species studied reveals a significant difference in the NTS between E. encrasicolus on the one hand and E. japonicus, E. mordax, and E. ringens on the other and a similarity of 83% between E. encrasicolus and E. Japonicus. Therefore, to differentiate between these species, species-specific primers were designed (Table 1) and located in the NTS using the Primer 3 program. The multiplex PCR for the simultaneous identification of the different species of anchovy was performed in a final volume of 50 μL containing 2 μL of DNA (80−100 ng), 0.2 μM of each primer, 3 mM MgCl2, 200 mM dNTP, 2 units of the Taq polymerase enzyme, and appropriate buffer for the enzyme. The reaction was carried out under the same conditions as those described above. PCR products were purified and directly sequenced to verify that the amplified products are the same as previously designed. These primers not only indicate the presence or absence of amplification but also allow the product size to be differentiated, which also facilitates the reading of the results. Sequences of E. encrasicolus and E. japonicus showed a high degree of similarity, which hinders identification using specific primers. We used the same pair of primers for the two species and were able to distinguish between them using the RFLP restriction enzyme BspLU11I. The digestion reaction was carried out in a final volume of 20 μL with 2 μL of PCR product, 1 μL of enzyme, and 2 μL of the appropriate buffer.

processed, and this presents additional difficulty for morphological identification. The results of this study should ensure the traceability of products to prevent fraud, improve food safety, and assist in implementing initiatives such as appellations of origin.

■

MATERIALS AND METHODS

Chemicals. The DNA extraction kit was purchased from Bio101 (Vista, CA, USA) and the DNA purification kit from Macherey-Nagel (Bethlehem, PA, USA). The PCR reagents and restriction enzyme were obtained from Fermentas (Massachusetts, USA) and Euro-Clone (Milano, Italy). Clonation DNA was purchased from Promega (Madison, WI, USA). The chemicals were purchased from SigmaAldrich (St. Louis, MO, USA) and Bio-Rad (Hercules, CA, USA). Animal Sampling and DNA Isolation. For the analysis of the 5S rDNA multigene family in the four species of the Engraulidae family, the following were used: fresh samples of Engraulis encrasicolus from the Gulf of Cadiz, samples of Engraulis mordax from Baja California in Mexico, Engraulis ringens from Valparaiso in Chile, and Engraulis japonicus from the Sea of Japan. All samples were collected and preserved in absolute ethanol. Total genomic DNA was extracted from 150 mg of muscle sections with FastDNA kit for 40 s, at a speed of 5 m/s, in a FP120 Fastprep instrument (Bio101, Inc., Vista, CA). PCR Amplification, Cloning, and Sequencing. The 5S rDNA gene was amplified with the two universal primers 5S1F (5′TACGCCCGATCTCGTCCGATC-3 ′) and 5S2R (5′-CAGGCTGGTATGGCCGTAAGC-3′).15 PCR was performed in a final volume of 50 μL containing 4 μL of genomic DNA, 3 mM MgCl2, 200 μM dNTP (Fermentas), 0.2 μM of each primer, 2 units of Taq polymerase (EuroClone, Italy), and the appropriate buffer for the enzyme. The reaction was carried out using an initial cycle of 5 min at 94 °C and 35 cycles of 45 s at 94 °C, 45 s at 59 °C, and 1 min at 72 °C and a final extension of 10 min at 72 °C. Products were visualized by agarose gel 2% with ethidium bromide (0.5 μg/mL) after electrophoresis. The PCR products obtained were purified using the NucleoSpin extraction kit

■

RESULTS In eukaryotes, rDNA (rDNA) is generally arranged in two different gene clusters (multigene families), each composed of 2804

dx.doi.org/10.1021/jf405680g | J. Agric. Food Chem. 2014, 62, 2803−2808


Article

Figure 2. Alignment of the 5S consensus sequences of the four species of Engraulis. Consensus sequence were obtained from three individuals of each species (E. encrasicolus nine clones, E. japonicus eight clones, E. ringens 10 clones, and E. mordax 12 clones). Sequences of each clone are deposited in GenBank with an access number shown in Table 1. Universal primers (described in Table 1) are framed, and species-specific primers (Table 1) are shaded (Fw sequences shaded in black and Rev sequences shaded in gray).

hundreds to thousands of gene copies, one the major cluster (45S rDNA) and the other the minor cluster (5S rDNA). The

5S rRNA gene consists of one highly conserved sequence of 120 base pairs (bp), which is separated from the next unit by a 2805



Article

BspLU11I, whereas E. japonicus has one allele with a unique restriction site (Figure 4).

nontranscribed spacer (NTS). Although the 5S rRNA gene is highly conserved, the NTSs are variable both in length and in sequence. The fast rate of base substitution, together with gene conversion, should make NTS sequences candidates as markers for species identification. The aim of this study is to differentiate between four very similar species of the Engraulidae family: E. encrasocilus, E. mordax, E. ringens, and E. japonicus, which are of considerable commercial interest in Europe, Asia, and Latin America; reliable differentiation should help to prevent fraud and labeling errors. Repeat units of 5S rDNA were amplified using universal primers.15 Several products were obtained among them, which varied depending on the length of the NTS. The coding region of 120 bp showed a high degree of conservation among the four species. We found many products of 5S rDNA which differed, for example, between E. encrasocilus, E. ringens, and E. japonicus by the length of their NTS, mainly due to the presence of several repeated sequences of poly A, poly C, and poly G or due to fouling by pseudogenes (Figure 1, Table 1). However, because of the presence of many products and dimer bands, 5S rDNA amplification is not sufficient to differentiate reliably between these species. The high degree of polymorphism observed between the NTS sequences of these four species of Engraulis, after aligning their 5S rDNA sequences, means that this characteristic could be useful for differentiating between the species, therefore species-specific primers were designed for the zones of variability (Figure 2, Table 1). Multiplex PCR was performed with the four pairs of primers designed to discriminate rapidly the four species of Engraulis. The results obtained show that these primers indicate not only presence or absence of amplification but also the difference in size of the amplification product, which facilitates reading (Figure 3, Table 1).

Figure 4. Electrophoretic patterns of digestion with restriction enzyme BspLU11I of the PCR products with species-specific primers for E. encrasicolus (from 1 to 5) and E. japonicus (from 6 to 9). The arrow indicates the differential band. Each lane is from an independent individual.

■

DISCUSSION In this paper, we study the identification of four species of anchovy: one European (E. encrasicolus), which is in great demand for the European market and for which there has been a significant decrease in the fishing grounds, another Japanese (E. japonicus) which is marketed in much of Asia, and two species from the Americas (E. mordax and E. ringens) that are being imported into Europe in order to increase supply to match the high demand. Consumers in all markets of the world increasingly expect the seafood industry to devise and implement measures for the safety and traceability of food products to ensure that these products are of sufficient quality, authentic, and properly labeled with all the necessary information. The industry is therefore increasingly seeking fast and reliable techniques for controlling seafood safety and preventing fraud, especially with respect to species of fish that are morphologically similar but very different in commercial value, such as anchovies. The European anchovy E. encrasicolus has been the target of identification studies using PCR-RFLP of cytochrome b, versus Sardinella aurita,8 in semipreserved products and in paste.10 A phylogenetic study has also been made of the Engraulidae family in which the genetic distances between various species is highlighted.9 In this study, the repeating units of 5S rDNA have been used as a molecular marker to differentiate rapidly the four species of the Engraulidae family by multiplex PCR . These repeating units showed a 5S rRNA with 120 bp, which is highly conserved among many taxa, separated by NTS noncoding segments of rDNA which evolve much faster than the coding region, and appear to be specific for each species. The 5S rDNA has been widely used as a molecular marker to differentiate closely related species due to the peculiarity of its structure and organization. Thus, in several studies it has been used as a marker to discriminate fish species16−19 and in one study linked to other genes such U snRNA.20 The variations found between the NTS of the different species studied are due to insertions/deletions, repeats, and pseudogenes that have been the main source of variation in the size of 5S rDNA units. These have been characterized in several other organisms and appear to be very useful as markers in the

Figure 3. Electrophoretic patterns of multiplex PCR with speciesspecific primers as described in Table 1 in four independent individuals of each of the four species of Engraulis: (1−4) E. encrasicolus, (5−8) E. mordax, (9−12) E. japonicus, and (13−16) E. ringens..

In the case of E. encrasicolus and E. japonicus, it was difficult to design specific primers for each of the species because their sequences are very similar and there were areas where polymorphism is present in the form of sequences of poly A and poly T; consequently, the only solution was to use a restriction enzyme. By analyzing the sequences of all the specific primer clones of the two species, it was found that the enzyme BspLU11I allows differentiation to be made between these two species because two different banding patterns were obtained. E. encrasicolus has two different alleles for the enzyme 2806



Article

characterization of species.21−23 Precise species-specific primers have also been designed for the four species of Engraulis which showed considerable differences in the size of the gene (Table 1). In the four species, amplification with the universal primers gave more than one product; this is probably because the particular organization of this gene appears to be very common in fish. This means that the genes are in different genomic locations and must be independently assessed.17,24,25 As in most tandemly repeated multigene families under concerted evolution, our results also revealed homogeneity of the 5S rDNA, but in both E. encrasicolus and E. japonicus, the elements homogenized by repetition are two widely divergent units, one short NTS I (about 450 bp) and a long NTS II (about 640 bp). Also in E. encrasicolus and E. japonicus, the duplication observed in NTS II, with base substitutions and insertions/deletions represents most of the difference in length between the two types of NTS. A similar situation has also been described in other genera including Coregonus, Brycon, and Leporinus.26−28 However, unlike in other fish species that also have several size classes of 5S rDNA, the comparison between the two classes of NTS revealed that the sequence identity is extremely low in the spacer region.29 Unexpectedly, the NTS sequences of the two species E. encrasicolus and E. japonicus maintain a very high degree of conservation (91% for NTS I and 89% for NTS II) as a result of some particular homogenization mechanism such as gene conversion or unequal crossing;30 similar results have been found in NTS sequences between two species of shark.12 The closeness of the genetic distance observed between these two species has also been described by analysis of cytochrome b nucleotide divergence, showing values of 0.04, whereas in our study we have obtained a value of 0.045.31 The presence of several types of product of 5S rDNA is not sufficient to identify conclusively each species; it can even lead to confusing results. Therefore it was decided to design speciesspecific primers to give reliable results. Ultimately, these results should be of great interest for product traceability in the marketing of these species, given the overexploitation of anchovy fisheries in Europe and the continued periods of closure imposed. Imports of other anchovy species have been increasing significantly as suppliers try to alleviate this shortage. These imported products may be frozen or processed, which presents additional difficulties for morphological identification. In conclusion, these results allow anchovy products to be reliably traced, with the object of preventing fraud, improving food safety, and implementing initiatives such as appellations of origin.

■

Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) The State of World Fisheries and Aquaculture; FAO Fisheries and Aquaculture Department: Rome, 2012. (2) Rasmussen, R. S.; Morrissey, M. T. DNA-based methods for the identification of commercial fish and seafood species. Comp. Rev. Food Sci. Food Saf. 2008, 7, 280−295. (3) Garcia-Vazquez, E.; Perez, J.; Martinez, J. L.; Pardiñas, A. F.; Lopez, B.; Karaiskou, N.; Casa, M. F.; Machado-Schiaffino, G.; Triantafyllidis, A. High level of mislabeling in Spanish and Greek hake markets suggests the fraudulent introduction of African species. J. Agric. Food Chem. 2001, 59, 475−480. (4) Chuang, P. S.; Chen, M. I.; Shiao, J. C. Identification of tuna species by a real-time polymerase chain reaction technique. Food Chem. 2012, 133, 1055−1061. (5) Pascoal, A.; Ortea, I.; Gallardo, J. M.; Cañas, B.; BarrosVelázquez, J.; Calo-Mata, P. Species identification of the Northern shrimp (Pandalus borealis) by polymerase chain reaction−restriction fragment length polymorphism and proteomic analysis. Anal. Biochem. 2012, 421, 56−67. (6) Li, X.; Li, J.; Zhang, S.; He, Y.; Pan, L. Novel Real-Time PCR Method Based on Growth Hormone Gene for Identification of Salmonidae Ingredient in Food. J. Agric. Food Chem. 2013, 61, 5170− 5177. (7) Prado, M.; Boix, A.; Von Holst, C. Development of a real-time PCR method for the simultaneous detection of mackerel and horse mackerel. Food Control 2013, 34, 19−23. (8) Sebastio, P.; Zanelli, P.; Neri, T. M. Identification of Anchovy (Engraulis encrasicholus L.) and Gilt Sardine (Sardinella aurita) by Polymerase Chain Reaction, Sequence of Their Mitochondrial Cytochrome b Gene, and Restriction Analysis of Polymerase Chain Reaction Products in Semipreserves. J. Agric. Food Chem. 2001, 49, 1194−1199. (9) Santaclara, F. J.; Cabado, A. G.; Vieites, J. M. Development of a method for genetic identification of four species of anchovies, E. encrasicolus, E. anchoita, E. ringens and E. japonicus. Eur. Food Res. Technol. 2006, 223, 609−614. (10) Rea, S.; Storani, G.; Mascaro, N.; Stocchi, R.; Loschi, A. R. Species identification in anchovy pastes from the market by PCRRFLP technique. Food Control 2009, 20, 515−520. (11) Cross, I.; Rebordinos, L. Species identification of Crassostrea and Ostrea oysters by polymerase chain reaction amplification of 5S rRNA gene. AOAC Int. 2006, 89, 144−148. (12) Pinhal, D.; Gadig, O. B. F.; Martins, C. Genetic identification of the sharks Rhizoprionodon porosus and R. lalandii by PCR-RFLP and nucleotide sequence analyses of 5S rDNA. Conserv. Genet. Resour. 2009, 1, 35−38, DOI: 10.1007/s12686-009-9008-9. (13) Tognoli, C.; Saroglia, M.; Terova, G.; Gornati, R.; Bernardini, G. Identification of fish species by 5S rRNA gene amplification. Food Chem. 2011, 129, 1860−1864. (14) Fernandez-Tajes, J.; Méndez, J. Identification of the razor clam species Ensis arcuatus, E. siliqua, E. directus, E. macha, and Solen marginatus using PCR-RFLP analysis of the 5S rDNA region. J. Agric. Food Chem. 2007, 55, 7278−7282. (15) Pendás, A.; Morán, P.; Freije, J.; García-Vázquez, E. Chromosomal mapping and nucleotide sequence of two tandem repeats of Atlantic salmon 5S rDNA. Cytogenet. Cell Genet. 1994, 67, 31−36. (16) Campo, D.; Machado-Schiaffino, G.; Perez, J.; Garcia-Vazquez, E. Phylogeny of the genus Merluccius based on mitochondrial and nuclear genes. Gene 2007, 406, 171−179. (17) Morescalchi, M. A.; Liguori, I.; Rocco, L.; Archimandritis, A.; Stingo, V. Karyotypic characterization and genomic organization of the 5S rDNA in Polypterus senegalus (Osteichthyes, Polypteridae). Genetica 2008, 132, 179−186. (18) Merlo, M. A.; Cross, I.; Chairi, H.; Manchado, M.; Rebordinos, L. Analysis of three multigene families as useful tools in character-

AUTHOR INFORMATION

Corresponding Author

*Phone: +34956016181. Fax: +34956016448. E-mail: laureana. [email protected]. Present Address †

H.C.: Laboratoire Pluridisciplinaire, Université Abdelmalek Essâadi, Faculté Polydisciplinaire, B.P. 745, Poste Principale 92004, Larache, Morocco. Funding

This work was supported by grants from the Junta de Andaluciá (Spain) to the PAI BIO-219 group. 2807



Article

ization of two closely related species, Dicentrarchus labrax, Dicentrarchus punctatus and their hybrids. Genes Genet. Syst. 2010, 85, 341−349. (19) Rojo-Bartolomé, I.; Diaz de Cerio, O.; Cancio, I. 5S rRNA in gonads, a powerful marker for the identification of sex in fish. Comp. Biochem. Physiol., Part A 2012, 163, S55−S60. (20) Manchado, M.; Rebordinos, L.; Infante, C. U1 and U2 small nuclear RNA genetic linkage: a novel molecular tool for identification of six sole species (Soleidae, Pleuronectiformes). J. Agric. Food Chem. 2006, 54, 3765−3767. (21) Martins, C.; Wasko, A. P.; Oliveira, C.; Porto-Foresti, F.; PariseMaltempi, P. P.; Wright, J. M.; Forestia, F. Dynamics of 5S rDNA in the tilapia (Oreochromis niloticus) genome, repeat units, inverted sequences, pseudogenes and chromosome loci. Cytogenet. Genome Res. 2002, 98, 78−85. (22) Martins, C.; Wasko, A. P. Organization and evolution of 5S ribosomal DNA in the fish genome. In Focus on Genome Research, Williams, C. R., Eds.;Nova Biomedical Books: Hauppauge, NY, 2004; pp 335−363 (23) Pichiri, G.; Nieddu, M.; Manconi, S.; Casu, C.; Coni, P.; Salvadori, S.; Mezzanotte, R. Isolation and characterization of two different 5S rDNA in Anguilla anguilla and in Anguilla rostrata, possible markers of evolutionary divergence. Mol. Ecol. Notes 2006, 6, 638−641. (24) Martins, C.; Galetti, P. M. Two 5S rDNA arrays in Neotropical fish species, is it a general rule for fishes? Genetica 2001, 111, 439− 446. (25) Qin, Q.; He, W.; Liu, S.; Wang, J.; Xiao, J.; Liu, Y. Analysis of 5S rDNA organization and variation in polyploid hybrids from crosses of different fish subfamilies. J. Exp. Zool. 2010, 314, 403−411. (26) Sajdak, S. L.; Reed, K. M.; Phillips, R. B. Intraindividual and interspecies variation in the 5S rDNA of Coregonid fish. J. Mol. Evol. 1998, 46, 680−688. (27) Wasko, A. P.; Martins, C.; Wright, J. M.; Galetti, P. M. Molecular organization of 5S rDNA in fishes of the genus Brycon. Genome 2001, 44, 893−902. (28) Ferreira, I. A.; Oliveira, C.; Venere, P. C.; Galetti, P. M.; Martins, C. 5S rDNA variation and its phylogenetic inference in the genus Leporinus (Characiformes, Anostomidae). Genetica 2007, 129, 253−257. (29) Martins, C.; Wasko, A. P.; Oliveira, C.; Wright, J. M. Nucleotide sequence of 5S rDNA and localization of the ribosomal RNA genes to metaphase chromosomes of the Tilapiine cichlid fish, Oreochromis niloticus. Hereditas 2000, 133, 39−46. (30) Dover, G. A. Linkage disequilibrium and molecular drive in the rDNA gene family. Genetics 1989, 122, 249−252. (31) Jérome, M.; Lemaire, C.; Bautista, J. M.; Fleurence, J. L.; Etienne, M. Molecular phylogeny and species identification of sardines. J. Agric. Food Chem. 2003, 51, 43−50.

2808


A Rapid Method for Differentiating Four Species of the Engraulidae

Recommend Documents