Active Intermediates of Polyhydroxyalkanoate Synthase from

Subscriber access provided by University Libraries, University of Memphis

Communication

Active Intermediates of Polyhydroxyalkanoate Synthase from Aeromonas caviae in Polymerization Reaction Keiji Numata, Yoko Motoda, satoru watanabe, Naoya Tochio, Takanori Kigawa, and Yoshiharu Doi Biomacromolecules, Just Accepted Manuscript • Publication Date (Web): 07 Oct 2012 Downloaded from http://pubs.acs.org on October 11, 2012

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biomacromolecules is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 22

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Communication Re-Revised for Biomacromolecules

Active Intermediates of Polyhydroxyalkanoate Synthase from Aeromonas caviae in Polymerization Reaction Keiji Numata,*,† Yoko Motoda,† Satoru Watanabe,‡ Naoya Tochio,‡ Takanori Kigawa,‡ and Yoshiharu Doi§ Enzyme Research Team, RIKEN Biomass Engineering Program, RIKEN, 2-1 Hirosawa, Wako-shi, Saitama 351-0198, Japan; NMR Pipeline Methodology Research Team, RIKEN Systems and Structural Biology Center, RIKEN, 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama 230-0045, Japan; and RIKEN Research Cluster for Innovation, RIKEN, 2-1 Hirosawa, Wako-shi, Saitama 351-0198, Japan. Email: [email protected] RECEIVED DATE (to be automatically inserted after your manuscript is accepted if required according to the journal that you are submitting your paper to) TITLE RUNNING HEAD: PHA Synthase from Aeromonas caviae. CORRESPONDING AUTHOR FOOTNOTE *To whom correspondence should be addressed: RIKEN, 2-1 Hirosawa, Wako-shi, Saitama, 351-0198, Japan. Phone: +81-48-467-9525, Fax: +81-48-462-4664, E-mail: [email protected]

ACS Paragon Plus Environment

1

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 22

ABSTRACT

Polyhydroxyalkanoate (PHA) synthase from Aeromonas caviae FA440 (PhaCAc, BAA21815) is one of the most valuable PHA synthase, because of its function to synthesize a practical bioplastic, poly[(R)-3hydroxybutyrate-co-(R)-3-hydroxyhexanoate] [P(3HB-co-3HHx)]. However, biochemical activity and active intermediates of PhaCAc have not been clarified until now. In the present study, a gene of PhaCAc was cloned and overexpressed by a cell-free protein expression system. Both, the polymerization activity and oligomerization behavior of the purified PhaCAc were characterized in order to clarify the active intermediates of PhaCAc based on the hydrodynamic diameters and specific activities of PhaCAc. The influences of a substrate, (R)-3-hydroxybutyryl-CoA (3HB-CoA), on the oligomerization of PhaCAc (7.5 µM) were also investigated, and then the Hill coefficient (n = 2.6 ± 0.4) and the microscopic dissociation constant (Km = 77 ± 5 µM) were determined. Based on the results, the active intermediate of PhaCAc was concluded to be the dimeric PhaCAc containing 3HB-CoA as an activator for its dimerization. This information is critical for revealing the relationships between its dimerization and function in PHA synthesis. KEYWORDS. polyhydroxyalkanoate (PHA), PHA synthase, enzymatic polymerization.


2

Page 3 of 22

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

INTRODUCTION Polyhydroxyalkanoate (PHA) is a biological polyester synthesized from various microorganisms for the intercellular storage of carbon and energy needed for their survival. It is also an attractive bio-based plastic that can be used instead of petroleum-based plastics in order to reduce carbon dioxide emissions. However, it has been difficult to elucidate the polymerization mechanism of PHA synthase (PhaC), especially the active intermediates in the polymerization reaction of PhaC, since the rate of elongation is much faster than the rate of initiation of the polymerization.1, 2 Here, an active intermediate of PhaC is defined as an active form to polymerize substrates. Therefore, the modification of biocatalysts to synthesize next-generation bioplastics has been limited. Stubbe and coworkers have worked on the mechanisms of initiation, elongation, granule formation, and termination for over a decade using poly[(R)-3-hydroxybutyrate] [P(3HB)] synthase from Ralstonia eutropha (R. eutropha) H16 and Allochromatium vinosum (A. vinosum) as prototypes of the class I and class III PHA synthases.1-10 The synthase is also considered to be an !,"-hydrolase superfamily member with the active site nucleophile at the elbow of a strand-turn-helix, suggesting that two active sites (thiol groups of Cys) from each PhaC monomer could generate the required active site at their interface.2,11 The mutant PhaC, Cys149Ser, which catalyzes polymer formation at 1/2200 of the rate of the wild-type PhaC was used to investigate the mechanism involving Cys149 of PhaC from A. vinosum and covalent and noncovalent 3HB-CoA intermediates.9 These studies provide direct evidence of the importance of covalent and noncovalent catalysis in the polymerization reaction catalyzed synthase from R. eutropha H16 and A. vinosum. Further, two Cys319 in the homodimeric PhaC from R. eutropha H16 were thought to provide two thiol groups that polymerize (R)-3-hydroxybutyryl-CoA (3HB-CoA).11, 12 However, there has been no conclusive evidence of this; for example, hydrodynamic diameters of the active intermediate as well as the positive Hill coefficient to support cooperative relationship between PhaC and the substrate have not been obtained.


3

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 22

PHA synthase from Aeromonas caviae (A. caviae) FA440 (PhaCAc, BAA21815) shows a wide range of substrate specificity and catalyzes the polymerization of 3HB-CoA (C4-CoA) and 3hydroxyhexanoyl-CoA (3HHx-CoA, C6-CoA) to a biopolyester with a molecular weight of over 105 Da, resulting in poly[(R)-3-hydroxybutyrate-co-(R)-3-hydroxyhexanoate] [P(3HB-co-3HHx)]; this is a PHA with improved mechanical and thermal properties in comparison to P(3HB) homopolymer.13 Although the PHA synthase from A. caviae (66.3 kDa) is one of the most valuable biocatalysts for PHA production, the biochemical activity and active intermediates of PhaCAc have not been clarified due to the difficulty of its expression and purification using recombinant Escherichia coli (E. coli).14 In the present study, a gene of PhaCAc was successfully cloned and synthesized by a cell-free protein expression system.15, 16 The purified PhaCAc’s polymerization activity and oligomerization behavior were characterized with and without a substrate in order to clarify the active intermediates of PhaCAc in the polymerization reaction.

MATERIALS AND METHODS Cloning of PhaCAc. Genomic DNA of A. caviae was isolated by a standard procedure.17 PhaCAc was cloned by two-step polymerase chain reaction (PCR), according to a previous report.18 Briefly, the first PCR was carried out in a reaction mixture (20 µL) with 3 µL of 50-fold diluted buffer of the genomic DNA as the template, 50 nM each of forward (FW) and reverse (RV) unique primers for PhaCAc, 0.2 mM of each deoxyribonucleotide triphosphate (dNTP), 1 x Expand Hi-Fi buffer (Roche, Basel, Switzerland), and 0.5 U Expand Hi-Fi enzyme (Roche) with a hot start. The forward and reverse primer sequences were 5'-ACTGAGAACCTGTACTTCCAGGGAATGAGCCAACCATCTTATGG-3' and 5'GGGCGGGGATCAATCAATCATTATGCGGCGTCCTCCTCTGTT-3'. The PCR program began with a 2 min denaturation step at 94 ºC. This step was followed by 40 cycles of denaturation at 94 ºC for 30 s, annealing at 60 ºC for 30 s, and extension at 72 ºC for 1 min (after the 20th cycle, the extension duration was prolonged for 5 s per cycle). The last step was an incubation at 72 ºC for 7 min. The ACS Paragon Plus Environment

4

Page 5 of 22

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

resultant product was immediately cooled to 10 ºC. The second PCR was carried out in a reaction mixture (20 !L) with 5 !L of 5-fold diluted first PCR product, 50 pM T7P fragment (GCTCTTGTCATTGTGCTTCGCATGATTACGAATTCAGATCTCGATCCCGCGAAATTAATAC GACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGA AGGAGATATACATATGAAAGATCATCTCATCCACAATCATCACAAACATGAGCACGCTCAT GCCGAACATACTGAGAACCTGTACTTCCAGGG),

50

pM

T7T

fragment

(AATGATTGATTGATCCCCGCCCAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGC ATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATA TCCGGATAACCTCGAGCTGCAGGCATGCAAGCTTGGCGAAGCACAATGACAAGAGC), 1 !M U2 universal primer (GCTCTTGTCATTGTGCTTCG), 0.2 mM of each dNTP, 1x Expand Hi-Fi buffer (Roche), and 0.5 U Expand Hi-Fi Enzyme (Roche) with a hot start. The PCR program began with a 2 min denaturation step at 94 ºC. This step was followed by 30 cycles of denaturation at 94 ºC for 30 s, annealing at 60 ºC for 30 s, and extension at 72 ºC for 2 min for the N11-tag (ATGAAAGATCATCTCATCCACAATCATCACAAACATGAGCACGCTCATGCC), 3 min for the TrxAH6-tag (ATGAGCGATAAAATTATTCACCTGACTGACGACAGTTTTGACACGGATGTACTCAAAGCG GACGGGGCGATCCTCGTCGATTTCTGGGCAGAGTGGTGCGGTCCGTGCAAAATGATCGCCC CGATTCTGGATGAAATCGCTGACGAATATCAGGGCAAACTGACCGTTGCAAAACTGAACA TCGATCAAAACCCTGGCACTGCGCCGAAATATGGCATCCGTGGTATCCCGACTCTGCTGCT GTTCAAAAACGGTGAAGTGGCGGCAACCAAAGTGGGTGCACTGTCTAAAGGTCAGTTGAA AGAGTTCCTCGACGCTAACCTGGCCTCCAGCGGCAGCTCTGGTCATCACCATCACCATCAC), and 4 min for the N11-SUMO-tag (N11-SUMO).19, 20 The N11 tag is a modifed version of the Natural poly-histidine tag.18 TrxAH6 tag is a thioredoxin A tag with a linker region containing six histidine residues. N11-SUMO tag is a tandem tag of N11 and small ubiquitin modifying protein (SUMO) tags.19, 20

These three tags have been used for cell-free synthesis in our gourp. A tobacco etch virus (TEV)


5

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 22

protease recognition sequence was inserted to cleave the target PhaCAc from the partner protein in N11 and TrxAH6 tag constructs.21 The tags used in the present study are listed in Table S1. After the 10th cycle, the annealing temperature was changed to 64 ºC and the extension duration was prolonged for 5 s per cycle. The last step was incubation at 72 ºC for 7 min. The resultant product was immediately cooled to 10ºC. Its concentration was determined with a PicoGreen dsDNA quantification kit (Invitrogen, Carlsbad, CA). All of the dilution steps in the two-step PCR protocol were carried out using dilution buffer [1 mM Tris–HCl, 0.01 mM ethylenediaminetetraacetic acid (EDTA), pH 8.0]. Cell-Free Protein Synthesis. The dialysis-mode cell-free protein synthesis method was used in this study, according to the literature.22 The internal solution (3 mL) was composed of the buffers, substrates, template DNA, and enzymes required for transcription and translation, namely, 55 mM HEPES-KOH buffer (pH 7.5) containing 1.7 mM dithiothreitol, 1.2 mM Adenosine-5'-triphosphate (pH 7.0), 0.8 mM each of cytidine triphosphate (pH 7.0), guanosine-5'-triphosphate (pH 7.0), and uridine-5'-triphosphate (pH 7.0), 80 mM creatine phosphate, 250 !g/ml creatine kinase, 4.0 % polyethleneglycol (average molecular weight 8,000), 0.64 mM 3',5'-cyclic adenosine monophosphate, 68 !M L(–)-5-formyl5,6,7,8-tetrahydrofolic acid, 0.05% sodium azide, 175 !g/ml E. coli total tRNA, 210 mM potassium glutamate, 27.5 mM ammonium acetate, 10.7 mM magnesium acetate, 1.0 mM of each of the 20 amino acids, 6.7 !g/ ml of the pK7-CAT plasmid, 93 !g/ml T7 RNA polymerase, and 9.0 !l S30 extract. The S30 extract was prepared from the E. coli BL21 codon-plus RIL strain (Stratagene, La Jolla, CA), as described previously.15 Briefly, a cell-free giant-scale dialysis using a dialysis membrane with a molecular weight cutoff (MWCO) of 15 kDa (Pierce, Rockford, IL) was performed, and 9 mL of the internal solution was dialyzed against 90 mL of the external solution. The reaction mixture was incubated at 37 ºC for 1 h. The external solution (30 ml) contained the components of the internal solution except for creatine kinase, the plasmid vector, the T7 RNA polymerase E. coli total tRNA, and the S30 extract. The enzyme was synthesized by the modified cell-free protein expression system reported by Kigawa et al.15, 16 The internal solution was dialyzed in a dialysis tube (Spectra/Por 7


6

Page 7 of 22

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

MWCO:15,000, Spectrum) against the external solution at 23 °C for 16 h with shaking.22 Purification of Proteins. From 9 mL of the internal solution, the tagged protein was purified by AKTA Express (GE Healthcare, Little Chalfont, UK) as follows. The internal solution was centrifuged at 3,000 # g for 30 min, and the supernatant was mixed with 18 mL of buffer A [20 mM Tris-HCl buffer (pH 8.0) containing 300 mM sodium chloride, 20 mM imidazole, and 1 mM Tris (2-carboxyethyl) phosphine hydrochloride (TCEP, Hampton Research, Aliso Viejo, CA)]. The protein solution was loaded into HisTrap (5 mL, GE Healthcare) and the resins were washed with buffer A. The proteins were eluted with buffer B (20 mM Tris-HCl buffer [pH 8.0] containing 300 mM sodium chloride, 500 mM imidazole, and 1 mM TCEP). To remove the tags, TEV protease was added to the eluted fraction of the protein at a final concentration of 10 µg/ml.18 The TEV protease used in this study was produced by cell-free synthesis based on a previous method.18 The solutions were incubated at 4 ºC for 16 h to cleave the tags and loaded into HiPrep 26/10 Desalting (GE Healthcare) and HisTrap (1 mL, GE Healthcare) with buffer A. The protein in the flow-through fraction was collected and loaded into HiPrep 26/10 Desalting and HiTrapQ HP (1 mL, GE Healthcare) with buffer C (20 mM Tris-HCl buffer [pH 8.0] containing 50 mM sodium chloride, and 1 mM TCEP). The purified protein was eluted with buffer D (20 mM Tris-HCl buffer [pH 8.0] containing 1 M sodium chloride, and 1 mM TCEP) and further loaded onto HiLoad 16/60 Superdex 75 (GE Healthcare) with buffer E (20 mM NaPi [pH 7.0] containing 400 mM sodium sulfate) to concentrate the purified protein. The yield of the purified protein was determined by the Bradford method, using a Bio-Rad Protein Assay kit (Bio-Rad, Hercules, CA). Bovine serum albumin was used as the protein standard. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed using 15-20% precast Tris-HCl gels (DRC Co Ltd., Kyoto, Japan). The gel was stained with Coomassie brilliant blue. Determination of Enzyme Activity. The specific activity of PhaCAc was determined by the method of Gerngross et al.1 Briefly, Coenzyme A released during the PHA synthase catalyzed reaction can be measured using Ellman’s reagent, 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB).23 The assay mixture (360


7

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 22

µL) contained 100 mM sodium phosphate (pH 7.5), an appropriate amount of 3HB-CoA, and variable amounts of the purified PhaC. 3HHx-CoA was prepared by previous method.24 The reactions were started by the addition of enzyme after equilibration of 3HB-CoA for 10 min at 25 ºC. The reaction mixtures were then incubated for 30 min. Aliquots (40 µL) were removed at timed intervals and stopped by the addition of 100 µL of 5% trichloroacetic acid. The precipitated protein was collected by centrifugation for 10 min, and an aliquot (125 µL) of the supernatant was added to 675 µL of 500 mM KPi (pH 7.5). Dithionitrobenzoic acid (DTNB) was added to the mixture and incubated for 2 min at 25 ºC. The absorbance at 405 nm was measured. One Unit (U) was defined as the amount of the enzyme that catalyzes the conversion of 1 micro mole of substrate per minute. The specific activity was determined from the CoA release raging from 0 to 1 min of the reaction, because of no obvious lag phase in the reaction. The Hill coefficients and the microscopic dissociation constant were calculated from the sigmoidal curve fitting of the present data, according to the manufacture’s instruction (IGOR Pro 6.12, WaveMetrics, Portland, OR). The fitting of the specific activity to the Hill equation (Eq. 1) was performed by IGOR. y = Kbase + (Kmax-Kbase)/[1 + (Km/x)n]

(1)

where y is specific activity as function of x, x is a concentration of the substrate, 3HB-CoA, Kbase is the smallest y, Kmax is the maximum of y, n sets the rise rate, namely, the Hill coefficient and Km sets the x value at which y is at the half of Kmax. Matrix-Assisted Lased Desorption/Ionization Time-of-Flight (MALDI-TOF). MALDI-TOF mass spectra data were acquired using Voyager DE-STR MALDI-TOF spectrophotometer (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA) operating in reflection mode. Accelerating voltage of 25 kV was employed. Alpha-cyano-4-hydroxycinnamic acid used as a matrix was dissolved in a mixture of containing 0.3% trifluoroacetic acid, 50% acetonitrile, and water. The reaction mixture was mixed with matrix at a 1:1 ratio. 2 !L of prepared sample was spotted on target plate and then allowed to air dry at 25 ºC temperature. The acquired data were analyzed by FLEX analysis software


8

Page 9 of 22

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

(Bruker). Dynamic Light Scattering (DLS). DLS was performed using a 633 nm laser at 4 ºC with a scattering angle of 90o, and the hydrodynamic diameter and distribution of samples were determined using Dynamic Light Scattering software (Malvern Instruments, Worcestershire, UK). The sample solution containing PhaCAc, 3HB-CoA, and 100 mM sodium phosphate (pH 7.5) was centrifuged at 17,000 # g for 10 min and then analyzed by DLS. Gel Filtration Chromatography. The reaction mixture contained PhaCAc, the substrate (3HB-CoA or 3HHx-CoA), and 100 mM sodium phosphate (pH 7.5) in a final volume of 10 !L. It was incubated for 15 min at 25 ºC and then loaded onto a TSKgel G2000 SWXL column (TOSOH, Tokyo, Japan) equilibrated with 20 mM NaPi (pH 7.0) containing 200 mM Na2SO4 at 25 ºC. The synthase was eluted with the same buffer at a flow rate of 1 mL/min at 25 ºC. The dimeric and monomeric PhaCAc were eluted at 7.35 and 8.41 min, respectively. The molecular weight was determined on the basis of a calibration curve prepared using the following molecular weight standards: alcohol dehydrogenase (150 kDa, 7.40 min), bovine serum albumin (BSA, 66 kDa, 8.09 min), ovalbumin (44 kDa, 8.81 min) and C2(13C/15N) (16 kDa, 10.49 min). The molecular weights and elution time of the standards are listed in Table S2. A calibration curve based on relationship between the molecular weights and elution time of the standards was calculated (Figure S1).

RESULTS The expression levels of PhaCAc with three types of tags namely a modified version of the Natural poly-histidine tag (N11), a thioredoxin A tag with a linker region containing six histidine residues (TrxAH6), and a tandem tag of N11 and small ubiquitin modifying protein tags (N11-SUMO) by cellfree synthesis were measured efficiently to deterimine the best tag providing the highest expression level and revealed no differences among the three tags based on SDS-PAGE (Figure S2).18-20 The


9

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 22

expression system with the N11 tag was therefore used in the present study. After the TEV treatment and purification of the PhaCAc with the N11 tag, the purified PhaCAc was concentrated to approximately 30 µM, and the yield of the purified PhaCAc was approximately 150 mg out of 1L-scale reaction (Figure S3). The specific activity of PhaCAc as a function of its concentration (Figure 1A) was calculated based on Figure S4, which shows the time courses of CoA release from 3HB-CoA catalyzed by the PhaCAc of concentrations ranging from 0.038 to 7.5 µM. The specific activities of PhaCAc significantly increased from the concentration of 0.15 µM and then reached a plateau, approximately 0.9 U/mg, at 1.5 µM and 7.5 µM. The specific activity of PhaCAc (7.5 µM) as a function of substrate (3HB-CoA) concentration ranging up to 50-fold (750 µM) excess against PhaCAc was also characterized (Figures 1B and S5), displaying sigmoidal kinetics. Cooperativity between PhaCAc (7.5 µM) and the substrate was estimated by the Hill coefficient (n = 2.6 ± 0.4) and the microscopic dissociation constant (Km = 77 ± 5 µM) on the basis of the Hill plot. The Hill coefficient denotes the degree of cooperativeness of substrate binding to enzyme. In case that the Hill coefficient is more than one (n > 1), the enzyme show the positive cooperative binding to the substrate. The microscopic dissociation constant indicates the equilibrium constant for dissociation of the enzyme from the substrate. PhaCAc catalyzes the polymerization of 3HHx-CoA in addition to 3HB-CoA. 3HHx-CoA was therefore used as a substrate to characterize the specific activity of PhaCAc (Figure 1B and S6A). The specific activity of PhaCAc for 3HHx-CoA (7.5 µM) was much lower in comparison to that for 3HBCoA (Figure 1B). Even though the concentration of PhaCAc increased to 37.5, 75 and 150 µM, the specific activities of PhaCAc were less than 0.1 U/mg (Figure S6B). To investigate the initiation of the reaction, the reaction mixture of PhaCAc and 3HB-CoA was characterized by MALDI-TOF (Figure 2). The peak corresponding to PhaCAc up to 5 min was shifted to higher molecular weight regions and broadened, which indicates that MALDI-TOF detected the polymerization of 3HB-CoA by PhaCAc. After 1 min of the reaction, the peak corresponding to single


10

Page 11 of 22

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

PhaCAc before the reaction was still detected (Figure 2B), whereas there were almost no peaks for the single PhaCAc but PhaCAc with polymerized 3HB monomers at 3 min and 5 min (Figures 2C and D). The multimerization of PhaCAc was also characterized quantitatively by size exclusion chromatography (Figure 3). The PhaCAc at various concentrations of 0.75, 7.5, and 15 µM without 3HBCoA was examined, revealing a predominance of monomer over dimer formation independent from the concentration of PhaCAc without 3HB-CoA (Figure 3A). In addition, the mixtures of PhaCAc (7.5 µM) and 3HB-CoA at various concentrations, ranging from 5-fold (37.5 µM) to 100-fold excess (750 µM) against PhaCAc, exhibited predominant dimeric PhaCAc, according to alcohol dehydrogenase (150 kDa, 7.40 min) and bovine serum albumin (BSA, 66 kDa, 8.09 min) as molecular weight markers (Figure 3B). The amount of dimeric PhaCAc was constant at the 3HB-CoA concentrations ranging from 281 to 750 µM based on the size exclusion chromatography data (Figure S7). We also characterized 3HB-CoA without PhaCAc by gel filtration chromatography (Figure S8). Comparison between Figures 2B and S8 demonstrates that more than 90% of CoA were eluted as free CoA or 3HB-CoA. Therefore, we recovered more than 90% of CoA after the gel filtration chromatography. On the other hand, the rest of 3HB-CoA (less than 10% of the loaded 3HB-CoA) could bind and be eluted with PhaCAc. The PhaCAc with 3HHx-CoA was also characterized quantitatively by size exclusion chromatography (Figure 3C and Figure S9). The amount of dimeric PhaCAc with 3HHx-CoA was much less than that of monomeric PhaCAc. The size exclusion chromatography was not capable of monitoring the dimerization in real time due to the non-uniform loading, whereas DLS was considered to monitor it in real time because of more uniform loading in comparison to the other methods.25, 26 The hydrodynamic diameters of active intermediates of PhaCAc at a concentration of 7.5 µM were measured by DLS to investigate the real-time multimerization of PhaCAc (Figure 4). This is because size exclusion chromatography is not considered to monitor real-time dimerization due to its columnchromatography character. On the other hand, DLS is capable of monitoring the dimerization in real time in the same condition as the polymerization. The PhaCAc concentration of 7.5 µM was the


11

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 22

minimum value to allow characterization by DLS.

DISCUSSION A lag phase for polyester formation by PHA synthase, which has been investigated for over a decade, was considered to be the result of the requirement of the dimeric formation of PHA synthase for activity, initiating the reaction, and/or PHA granule formation.1, 27 Also, the lag phase was reported to depend on the concentration of PhaC.1, 5, 12 To clarify mechanism of the lag phase, “artificial primers” such as a saturated trimer of 3HB-CoA, were used to ensure uniform loading of PhaC, rapid dimer formation of PhaC and shorten the lag phase.10 In the present study, the polymerization of 3HB-CoA by PhaCAc seemed to be initiated homogeneously within 3 min, based on the MALDI-TOF mass spectra (Figure 2). Also, the specific activity of the present purified PhaCAc was significantly higher than that of crude PhaCAc, which was reported to be approximately 0.016 U/mg.28 Therefore, no observation of significant lag phase for the reaction of PhaCAc and 3HB-CoA was because the concentrations of PhaCAc were relatively higher than the previous studies and initiation of the reaction was fast enough to hide the lag phase. The positive Hill coefficient (more than one) demonstrated positive cooperativity of PhaCAc interacting with 3HB-CoA, which means that the presence of 3HB-CoA bound to PhaCAc further induces an affinity for multimerization of PhaCAc as an active intermediate (Figure 1B). The Hill equation was used to characterize the initial reaction of the polymerization catalyzed by PhaCAc; hence the polymers binding to PhaCAc was not considered to influence significantly on the Hill equation. The Km of Ralstonia eutropha P(3HB) synthase (PhaCRe), class I PHA synthase, for 3HB-CoA was reported previously to be 103 µM (the final concentration of the enzyme was not described. The lag phase was eliminated by adding multihydroxyl compounds.),12 while the Km for granule-bound PhaCRe with 3HB-CoA was 680 µM.29 Even though the Km of PhaC depends on their concentration based on the present results, the Km of PhaCAc determined in this study seems similar to that of PhaCRe for 3HB-CoA.


12

Page 13 of 22

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

The average hydrodynamic diameter of PhaCAc without 3HB-CoA was 9.6 ± 2.6 nm, indicating the PhaCAc without 3HB-CoA was mainly a homomonomer, taking into consideration the predominant existence of monomeric PhaCAc (7.5 µM) without 3HB-CoA (Figure 3A). The PhaCAc with 3HB-CoA at different concentrations exhibited dimerization at relatively high concentrations (up to 1500 µM) of 3HB-CoA based on their diameters (approximately 20 nm). The hydrodynamic diameter of PhaCAc with the substrate further supports the induction of PhaCAc dimerization by the presence of 3HB-CoA as well as the positive cooperativity between PhaCAc and the substrate. Moreover, the amount of the dimer was independent of the 3HB-CoA concentrations over 750 µM, according to the DLS results (Figure 4). The specific activities of PhaCAc (7.5 µM) with 3HB-CoA of 37.5, 103 and 450 µM were approximately 0.2, 0.7, and 1.0 U/mg (Figure 1B), indicating that the presence of 3HB-CoA not only induces the dimer formation of PhaCAc but also enhances its specific activity when the concentration of 3HB-CoA was relatively low, namely, below 750 µM. This agrees with the present result on the positive Hill coefficient showing that the binding of 3HB-CoA to PhaCAc further induces the affinity for dimerization of PhaCAc as an active intermediate. We therefore suggest that PhaCAc functions as a dimer to polymerize 3HB-CoA and that PhaCAc exists in an equilibrium between monomer and dimer, with the equilibrium favoring dimerization upon the binding of 3HB-CoA. The specific activity of PhaCAc (less than 0.1 U/mg) for 3HHx-CoA (7.5 µM) was much lower in comparison to that for 3HB-CoA (Figure 1B). This difference between 3HB-CoA and 3HHx-CoA was not due to different turnover numbers of the reaction by PhaCAc, because the specific activities of PhaCAc were still low at relatively high concetrations such as 37.5, 75 and 150 µM (Figure S6B). Further, the dimerization of PhaCAc with 3HHx-CoA was analyzed by DLS, suggesting almost no dimerization of PhaCAc (Figure 4). The result by size exclusion chromatography also showed that the amount of dimeric PhaCAc with 3HHx-CoA was much less than that of monomeric PhaCAc (Figure 3C and S9). These results indicate that the presence of 3HHx-CoA does not induce dimerization of PhaCAc, in contrast to the case of 3HB-CoA, which is identical to a previous report that 3HB-CoA is needed for


13

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 22

PHA synthase to start polymerization.30 Based on the present data, 3HB-CoA is necessary for the dimerization of PhaC to catalyze the polymerization of 3HB-CoA and the other substrates including 3HHx-CoA. In conclusion, this report is the first to show and discuss the positive Hill coefficient of PhaCAc (n = 2.6 ± 0.4) as well as the significant increase in specific activity with dimerization of PhaCAc at the presence of 3HB-CoA (Figures 1B and 4), which indicates that the dimeric PhaCAc with 3HB-CoA is an active intermediate of PhaCAc to catalyze polymerization of 3HB-CoA. In contrast to the case of 3HB-CoA, the presence of 3HHx-CoA does not induce dimerization of PhaCAc. Also, the present results concerning PhaCAc imply that the class I PhaC forms predominantly dimers as an active intermediate. The present findings, based on in vitro experiments, illustrate how in vivo PHA synthase and its related proteins and monomers can be optimized to improve the efficient production of next-generation bioplastics.

ACKNOWLEDGMENT This work has been supported by the RIKEN Biomass Engineering Program. Supporting Information Available. The additional data (Tables S1 and S2, Figures S1-S9) are available free of charge via the Internet at http://pubs.acs.org.

FIGURE CAPTIONS Figure 1. Specific activities of PhaCAc as functions of changes in its concentration (A) and the substrate (3HB-CoA and 3HHx-CoA) concentration (B). (A) The concentration of 3HB-CoA was 450 µM. (B) The concentration of PhaCAc was 7.5 µM. Figure 2. MALDI-TOF mass spectra of PhaCAc with and without 3HB-CoA. The concentrations of PhaCAc and 3HB-CoA were 7.5 and 450 µM, respectively. (A) PhaCAc without 3HB-CoA; (B-D) PhaCAc reacted with 3HB-CoA for 1 min (B), 3 min (C) and 5 min (D).


14

Page 15 of 22

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Figure 3. Size exclusion chromatography profiles of PhaCAc without 3HB-CoA (A), with 3HB-CoA (B) and with 3HHx-CoA (C). (A) The concentrations of PhaCAc were 0.75, 7.5, and 15 µM. (B) The concentration of PhaC was 7.5 µM, and those of 3HB-CoA were 37.5 µM, 137.5 µM, and 281 µM. (C) The concentration of PhaC was 7.5 µM, and those of 3HHx-CoA were 22.5 µM, 75 µM, and 188 µM. Peak (1); dimeric PhaCAc, peak (2); monomeric PhaCAc, and peak (3); 3HB-CoA or 3HHx-CoA. Figure 4. Hydrodynamic diameters of PhaCAc as a function of the substrate (3HB-CoA and 3HHx-CoA) concentrations. Mean hydrodynamic diameters were determined by DLS (n=3). Error bars indicate distribution of the hydrodynamic diamters.

REFERENCES (1)

Gerngross, T. U.; Snell, K. D.; Peoples, O. P.; Sinskey, A. J.; Csuhai, E.; Masamune, S.; Stubbe,

J., Biochemistry 1994, 33, 9311-9320. (2)

Tian, J.; Sinskey, A. J.; Stubbe, J., Biochemistry 2005, 44, 8369-8377.

(3)

Muh, U.; Sinskey, A. J.; Kirby, D. P.; Lane, W. S.; Stubbe, J., Biochemistry 1999, 38, 826-837.

(4)

Jia, Y.; Kappock, T. J.; Frick, T.; Sinskey, A. J.; Stubbe, J., Biochemistry 2000, 39, 3927-3936.

(5)

Jia, Y.; Yuan, W.; Wodzinska, J.; Park, C.; Sinskey, A. J.; Stubbe, J., Biochemistry 2001, 40,

1011-1019. (6)

Stubbe, J.; Tian, J., Nat. Prod. Rep. 2003, 20, 445-457.

(7)

Lawrence, A. G.; Choi, J.; Rha, C.; Stubbe, J.; Sinskey, A. J., Biomacromolecules 2005, 6, 2113-

2119. (8)

Tian, J.; Sinskey, A. J.; Stubbe, J., Biochemistry 2005, 44, 1495-1503.

(9)

Li, P.; Chakraborty, S.; Stubbe, J., Biochemistry 2009, 48, 9202-9211.


15

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(10)

Page 16 of 22

Wodzinska, J.; Snell, K. D.; Rhomberg, A.; Sinskey, A. J.; Biemann, K.; Stubbe, J., J. Am. Chem.

Soc. 1996, 118, 6319-6320. (11)

Rehm, B. H.; Steinbüchel, A., Int. J. Biol. Macromol. 1999, 25, 3-19.

(12)

Zhang, S.; Yasuo, T.; Lenz, R. W.; Goodwin, S., Biomacromolecules 2000, 1, 244-251.

(13)

Doi, Y.; Kitamura, S.; Abe, H., Macromolecules 1995, 28, 4822-4828.

(14)

Fukui, T.; Doi, Y., J. Bacteriol. 1997, 179, 4821-4830.

(15)

Kigawa, T.; Yabuki, T.; Matsuda, N.; Matsuda, T.; Nakajima, R.; Tanaka, A.; Yokoyama, S., J.

Struct. Funct. Genomics 2004, 5, 63-68. (16)

Kigawa, T.; Yabuki, T.; Yoshida, Y.; Tsutsui, M.; Ito, Y.; Shibata, T.; Yokoyama, S., FEBS Lett.

1999, 442, 15-19. (17)

Maniatis, T.; Fritsch, E. F.; Sambrook, J., Molecular cloning : a laboratory manual. Cold Spring

Harbor Laboratory: Cold Spring Harbor, N.Y., 1982; 545 p. (18)

Yabuki, T.; Motoda, Y.; Hanada, K.; Nunokawa, E.; Saito, M.; Seki, E.; Inoue, M.; Kigawa, T.;

Yokoyama, S., J. Struct. Funct. Genomics 2007, 8, 173-191. (19)

Butt, T. R.; Edavettal, S. C.; Hall, J. P.; Mattern, M. R., Protein Expr. Purif. 2005, 43, 1-9.

(20)

Malakhov, M. P.; Mattern, M. R.; Malakhova, O. A.; Drinker, M.; Weeks, S. D.; Butt, T. R., J.

Struct. Funct. Genomics 2004, 5, 75-86. (21)

Dougherty, W. G.; Cary, S. M.; Parks, T. D., Virology 1989, 171, 356-364.

(22)

Spirin, A. S.; Baranov, V. I.; Ryabova, L. A.; Ovodov, S. Y.; Alakhov, Y. B., Science 1988, 242,

1162-1164. (23)

Ellman, G. L., Arch. Biochem. Biophys. 1959, 82, 70-77.

(24)

Sato, S.; Ono, Y.; Mochiyama, Y.; Sivaniah, E.; Kikkawa, Y.; Sudesh, K.; Hiraishi, T.; Doi, Y.;

Abe, H.; Tsuge, T., Biomacromolecules 2008, 9, 2811-2818. (25)

Nobbmann, U.; Connah, M.; Fish, B.; Varley, P.; Gee, C.; Mulot, S.; Chen, J.; Zhou, L.; Lu, Y.;

Shen, F.; Yi, J.; Harding, S. E., Biotechnol. Genet. Eng. Rev. 2007, 24, 117-128.


16

Page 17 of 22

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

(26)

Philo, J. S., AAPS J. 2006, 8, E564-E571.

(27)

Gerngross, T. U.; Martin, D. P., Proc. Natl. Acad. Sci. U.S.A. 1995, 92, 6279-6283.

(28)

Kichise, T.; Taguchi, S.; Doi, Y., Appl. Environ. Microb. 2002, 68, 2411-2419.

(29)

Haywood, G. W.; Anderson, A. J.; Dawes, E. A., FEMS. Microbiol. Lett. 1989, 57, 1-6.

(30)

Taguchi, S.; Yamada, M.; Matsumoto, K.; Tajima, K.; Satoh, Y.; Munekata, M.; Ohno, K.;

Kohda, K.; Shimamura, T.; Kambe, H.; Obata, S., Proc. Natl. Acad. Sci. U.S.A. 2008, 105, 17323-17327.


17

Biomacromolecules

FIGURES

A!

Speciﬁc activity, Unit/mg

�� 1.0

�� 0.8

�� 0.6

�� 0.4

�� 0.2

�� 0.0

4! 6! 8!�� 0.1! �

1.0

Speciﬁc activity, Unit/mg

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 22

�

� � � �

2! 2! 4! 6! 8! � 1! Conc. of PhaCAc, "M! �

�

�

�

� � � �

�

�

4! 6! �

�

� �

B!

0.8 0.6 0.4 0.2 0.0

0!

100

200! 300 Conc. of substrates, "M!

400!

Numata et al. Figure 1


18

Page 19 of 22

PhaC only 100

A

1min 100

B

3min 100

C

5min 100

90

90

80

80

80

80

70

70

70

70

50 40

60 50 40

60 50 40

D

90

% Intensity

60

% Intensity

90

% Intensity

% Intensity

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

60 50 40

30

30

30

30

20

20

20

20

10

10

10

10

0 0 0 0 48k 67k 86k 48k 67k 86k 48k 67k 86k 48k 67k 86k Mass, m/z Mass, m/z Mass, m/z Mass, m/z



19

Biomacromolecules

140 OD at 215nm

120

��

2

A

100

�

80 60

1

40 20 0 4

60 OD at 215nm

50

6

8 10 Time, min

�� 1 ��

12 3

2

14

B

40 30 20 10 0 4

6

8 10 Time, min

80

12 3

��

OD at 215nm �

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 22

2

��

14

C

60 40

1

20 0 4

6

8 10 Time, min

12

14



20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Hydrodynamic diameter, nm

Page 21 of 22

40 30 20 10 0 0

500 1000 1500 2000 Conc. of substrate, µM



21

Biomacromolecules

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 22

SYNOPSIS TOC

NH2 O S OH

O

N H

O

O N H

N

O

O P O P O !

OH

O

N

O

O!

O

N N

OH

O P O! !

O

!"#$%&

!"#$%&


22

Active Intermediates of Polyhydroxyalkanoate Synthase from

Recommend Documents