Affinity Protein-Based FRET Tools for Cellular Tracking of Chitosan

Article pubs.acs.org/Biomac

Affinity Protein-Based FRET Tools for Cellular Tracking of Chitosan Nanoparticles and Determination of the Polymer Degree of Acetylation J. P. Fuenzalida, T. Weikert, S. Hoffmann, C. Vila-Sanjurjo, B. M. Moerschbacher, F. M. Goycoolea,* and S. Kolkenbrock* IBBP, Westfälische Wilhelms-Universität Münster Schlossgarten 3, 48149, Münster, Germany S Supporting Information *

ABSTRACT: Chitosan (CS) is a family of linear polysaccharides with diverse applications in medicine, agriculture, and industry. Its bioactive properties are determined by parameters such as the degree of acetylation (DA), but current techniques to measure the DA are laborious and require large amounts of substrate and sophisticated equipment. It is also challenging to monitor the fate of chitosan-based nanoparticles (CS-NPs) in vitro because current tools cannot measure their enzymatic or chemical degradation. We have developed a method based on the Förster resonance energy transfer (FRET) that occurs between two independent fluorescent proteins fused to a CS-binding domain, who interact with CS polymers or CS-NPs. We used this approach to calibrate a simple and rapid analytical method that can determine the DA of CS substrates. We showed unequivocally that FRET occurs on the surface of CS-NPs and that the FRET signal is quenched by enzymatic degradation of the CS substrate. Finally, we provide in vitro proof-of-concept that these approaches can be used to label CS-NPs and colocalize them following their interactions with mammalian cells.

■

INTRODUCTION CS is an aminopolysaccharide produced industrially by the chemical deacetylation of chitin from crustacean shell waste and fungal biomass. Chemically, CS is a family of linear heteropolyssaccharide copolymers comprising (1→4)-linked 2-amino-2-deoxy-β-D-glucose (GlcN) and 2-acetamido-2deoxy-β-D-glucose (GlcNAc). The GlcN/GlcNAc ratio is usually >1, and the molar fraction of GlcNAc defines the degree of acetylation (DA), which is often expressed as a percentage. CS has many applications in medicine (e.g., biomaterials for wound healing, drug delivery, etc.), agriculture, and diverse industrial sectors (e.g., cosmetic, food, water treatment, textile, etc.). This is directly the result of its distinct physicochemical and bioactive properties.1 Among these, worth mentioning are the capacity to form gels, films, membranes, or micro- and nanoparticles and the fact of being biodegradable, mucoadhesive, biocompatible, and nontoxic, respectively. These properties are strongly influenced by the DA, which can be measured using techniques such as liquid state 1H NMR2 and infrared spectroscopy.3 These techniques often require the prolonged incubation of large amounts of substrate using expensive equipment, so simple, rapid, and economical alternative methods are required. CS-NPs have recently emerged as a promising platform for drug delivery.4 For example, matrix-type CS-NPs cross-linked by ionic gelation with pentasodium tripolyphosphate (TPP)5 have proven consistently effective for the transmucosal delivery © XXXX American Chemical Society

of biologics, such as insulin, salmon calcitonin, pDNA, and siRNA.6 Nevertheless, it has not been possible to establish the mode of action and cellular fate of these nanocarriers unequivocally. As for other types of nanoparticles, varying in composition, size, shape, and electrical charge, the mechanisms of cellular uptake, trafficking, and cytotoxicity are the current focus of intensive research.7 A chitosanase (CSN) from Bacillus sp. MN was previously used to generate a chitosan biosensor by abolishing its catalytic activity and fusing it to the enhanced green fluorescent protein (eGFP). This chitosan affinity protein (CAP) was used for the in situ staining of cell wall chitosan in a plant pathogenic fungus.8 Here, we exploited this approach to develop a new tool based on Förster resonance energy transfer (FRET) for the quantitative determination of chitosan DA and the labeling of CS-NPs to investigate their enzymatic degradation and colocalization in a model cell culture. We generated different FRET pairs of fluorescent proteins comprising either superfolded blue fluorescent protein (sfBFP) or enhanced green fluorescence protein (eGFP). In each case, the fluorescent proteins were fused to CAP with high affinity for low-DA CS. The biodegradation and ultimate fate of chitosan-based nanoparticles (CS-NPs) is difficult to monitor in vitro and ex Received: March 13, 2014 Revised: May 14, 2014

A

dx.doi.org/10.1021/bm500394v | Biomacromolecules XXXX, XXX, XXX−XXX

Biomacromolecules

Article

(Göttingen, Germany). Nitrocellulose membrane was purchased from GE Healthcare (München, Germany). The chitosan used for nanoparticle studies was a biomedical-grade water-soluble chitosan hydrochloride salt (CS) purchased from Novamatrix (Sandvika, Norway; Protasan CL113 batch No. BP-0806−01; the degree of acetylation was ≈14% and Mw ≈ 119 kDa both as certified by supplier). CellMask Deep Red Plasma membrane stain was purchased from Life Technologies (Darmstadt, Germany). All other chemicals used were of analytical grade and were purchased from Sigma-Aldrich (München, Germany). High purity Milli-Q H2O water filtered through 0.22 μm PES membranes (EMD Millipore, U.S.A.) was used throughout. Bacterial Strains and Plasmids. Escherichia coli DH5α was used as storage strain for recombinant plasmids. E. coli Rosetta 2 (DE3) [pLysSRARE2] used as production strain for recombinant protein synthesis was purchased from Merck KGaA (Darmstadt, Germany). The original vector pET-22b(+) was purchased from Merck (Darmstadt, Germany). The selection of transformants was accomplished in LB at 37 °C. E. coli DH5α harboring pET-22b(+) constructs was grown in the presence of 100 μg/mL ampicillin. E. coli Rosetta 2 (DE3) [pLysSRARE2] harboring pET-22b(+) constructs was grown in the presence of 100 μg/mL ampicillin and 34 μg/mL chloramphenicol. For protein synthesis under autoinducing conditions the medium was supplemented with solutions M (50×, 1.25 M NaH2PO4, 1.25 M KH2PO4, 2.5 M NH4Cl, 0.25 M Na2SO4) and 5052 (50×, 25% (v/v) glycerol, 10% (w/v) α-lactose monohydrate, 2.5% (w/v) D-glucose). The cultures were incubated at 26 °C at mild shaking for at least 48 h. For long-term storage of E. coli strains at −70 °C 0.5× LB was supplemented with 30% (v/v) glycerol. Cloning and Heterologous Expression of CBP-eGFP. A 185 bp part of a Chitinase encoding gene from Bacillus licheniformis DSM13 (GenBank ac. No. AAU21943.2) was amplified with the primer pairs CBD_for (5′-CCCGGAATTCTGACCAAGCCTGTTCATATGAC-3′) and CBD_rev (5′-CCCAAGCTTTTCGCAGCCTCCGATCAG-3′). This part corresponds to the chitin binding module (CBD) of the Chitinase. The amplificate was cloned via EcoRI/HindIII in pET-22b-StrepII-CSN-eGFP-His6,8 resulting in pET-22b-StrepII-CBD-eGFP-His6. Expression was performed in E. coli Rosetta 2 (DE3) [pLysSRARE2], and the gene product was purified on a streptactin matrix according to Nampally et al.8 Cloning and Heterologous Expression of CAP-eBFP and sfGFP/sfBFP Variants of CAP and CBP. To generate an eBFP fusion protein of CAP pET-22b::StrepII-CSN-eGFP-His6, E122Q generated by Nampally et al.8 was used for rolling-circle PCR with the 5′-phosphorylated primers eGFP_Y66H_fwd (5′-Phos-CACGGCGTGCAGTGCTTCAG) and eGFP_Y66H_rev (5-Phos-GGTCAGGGTGGTCACGAGG). The template was digested with DpnI, the amplicon circularized by ligation. The substitution of eGFP for sfGFP (GI: 321437461) was accomplished by amplifying the sfGFP-coding region from the vector pBCA9145-jtK2828::sfGFP24 with the primers sfGFP_fwd_HindIII (CCCAAGCTTATGCGTAAAGGCGAAGAG) and sfGFP_rev_XhoI (CCGCTCGAGTTTGTACAGTTCATCCATACCATGCG) introducing terminal HindIII and XhoI sites. After digestion of the amplicon, pET-22b::StrepII-CSN-eGFP-His6 E122Q and pET-22b::StrepII-CBD-eGFP-His6 with HindIII and XhoI the sfGFP-coding fragment and vector backbones were ligated. To establish the Y66H substitution in sfGFP to gain sfBFP variants pET22b::StrepII-CSN-sfGFP-His6 E122Q and pET-22b::StrepII-CBDsfGFP-His6 were used for rolling-circle PCR using the 5′phosphorylated primers sfGFP_Y66H_fwd (5′-Phos-CATGGTGTTCAGTGCTTTGCTCG) and sfGFP_Y66H_rev (5′-Phos- AGTCAGCGTCGTTACCAGAG). Expression of the gene products was performed in E. coli Rosetta 2 (DE3) [pLysSRARE2] and the gene product was purified on a streptactin matrix according to Nampally et al.8 Enzyme Binding Specificity Assay (Dot Blot). To test the binding specificity of purified proteins the same volume (1 μL) of polymeric chitosans of different DAs (10, 20, 37, 50, and 56% and glycol chitin as fully acetylated substrate) were spotted in different amounts (1000, 200, 100, 10, and 1 ng) on a nitrocellulose membrane.

vivo due to the artifacts associated with the diverse analytical methods. One strategy involves loading CS-NPs with labeled reagents such as FITC-BSA or synthetic dyes for confocal laser scanning microscopy (CLSM) or flow cytometry, but this does not distinguish between free and CS-associated labels.9,10 For example, albumin can interact with itself and with human cells11 and interactions between labels and polyelectrolytes can easily be quenched by certain changes, such as ionic strength.12 Fluorescent molecules such as rhodamine B can also be conjugated to one or more components of the nanosystem.13 This structural modification can increase the hydrophobicity of the polymer, and thus promote the cellular uptake of nanoparticles.14 The cell permeability of CS may also increase due to the conjugation of highly permeable molecules such as rhodamine.15,16 The enzymatic and chemical degradation of CS-NPs is difficult to study and the mechanisms are poorly understood because suitable tools are not available. Greater understanding of these phenomena is necessary to achieve the optimal composition of nanosystems and to elucidate their mode of action. Förster resonance energy transfer (FRET) has recently emerged as a powerful nondestructive technique to investigate the proximity of fluorophores in living cells.17 FRET tools have been used to study processes such as protein folding, enzyme activity and cell membrane distension.18−20 They have also been used to investigate how nanoparticles interact with mammalian cells by the absorption of a synthetic lipophilic dye into a hydrophobic core, together with the use of biotinylated silica nanoparticles to study the interaction of macromolecules on cell surfaces.21,22 The trafficking and decondensation of biopolymer NPs can also be investigated by FRET although most such studies have relied on the chemical modification of a given substrate.23 The differential affinity of CBP and CAP for CS substrates with varying DA resulted in a direct linear relationship between the FRET capacity of sfBFP/eGFP and the DA of the CS substrate. It was therefore possible to calibrate a new analytical method to determine the DA of CS. In a second part of this work, we aimed to study the binding of the fusion proteins on the surface of CS-TPP NPs compared with free CS in solution and to test if the FRET behavior could be used to probe the enzymatic degradation of both substrates and to obtain a proof of principle that this approach could be used to label CS-based nanoparticles and trace them upon interacting with mammalian cells in vitro.

■

MATERIALS AND METHODS

The chitosans used for the FRET-based DA determination were prepared according to Nampally et al. (2012).8 Briefly, a batch of CS (Mathani Chitosan Pvt. Ltd., Veraval, India) was dissolved in an aqueous acetic acid solution and purified by successive filtration and extensive washing steps involving repeated precipitation and centrifugation. Purified CS was subsequently N-acetylated under homogeneous conditions by adding the needed stoichiometric amount of acetic anhydride in 1,2-propanediol so as to afford chitosans of varying average DA values. The degree of acetylation of the CS samples was determined by 1H NMR spectroscopy and, to this end, CS was dissolved in dilute acidic D2O (at pD 3−4), as proposed elsewhere.2 The Mw distribution for the different CS samples was determined by GPC with multidetection (MALLS and DRI). Restriction enzymes and T4 Rapid DNA Ligase were purchased from Thermo Scientific (Schwerte, Germany). Strep-Tactin Superflow Plus Cartridge was purchased from Qiagen (Hilden, Germany). StrepTactin horseradish peroxidase conjugate was purchased from IBA B


Biomacromolecules

Article

After incubating the substrate-loaded membrane for 30 min at 70 °C it was blocked for 1 h with 5% biotin-free bovine serum albumin in 10 mM Tris/HCl pH 7.5 containing 150 mM NaCl (TBS). Subsequently, the membrane was washed for 15 min with TBS. After incubating the membrane for 1 h with 0.1 mg mL−1 in TBS it was washed twice with TBS containing 0.02% (v/v) Tween-20 and twice with TBS. Afterward the signals were detected by chemiluminescence using a Strep-Tactin horseradish peroxidase conjugate according to the manufacturer’s instructions. FRET Analysis. The DA of the glycol chitin and chitosan polymer substrates was determined by measuring the FRET intensities produced by 1.63 μM of each fusion protein of a suitable FRET pair (e.g., CAP-eBFP and CBP-eGFP) and 0.1 mg/mL of substrate following incubation for 1 min at room temperature in 50 μL 40 mM phosphate buffer pH 6.0 or pH 7.0. Afterward the fluorescence was determined with a SpectraMax M2 microplate reader (MTX Lab Systems Inc., U.S.A.) at excitation (λex) and emission (λem) wavelengths of 385 and 510 nm, respectively. As blank, a substratefree sample was prepared. The relative FRET was calculated as factor of the increased emission intensity of the substrate-containing samples compared to the blank. To evaluate the differential binding between CS and CS NPs and substrate degradation, the FRET signal was measured by adding free CS and NPs to CAP-protein solutions. The changes in fluorescence were documented and compared to control scans without substrate. FRET measurements were conducted on a JASCO FP-6500 Fluorometer (Groß-Umstadt, Germany) connected to a ThermoHaake D8 thermoregulator (Karlsruhe, Germany) set to 30 °C. For the fluorescence emission scans the λex was set to 385 nm. The final concentration of each CAP-sfBFP and CAP-eGFP was 0.15 μM in isotonic buffer (pH 6.0, 40 mM NaH2PO4/Na2HPO4, 195 mM mannitol, 5.50 mM glucose, 5 mM KCl, 2.13 mM MgCl2, 1.32 mM CaCl2). Aliquots of either CS in solution or CS in the form of NPs were added to the cuvette to reach final CS concentrations of 0.021, 0.043, 0.064, and 0.086 mg/mL, and incubated for 5 min before each scan. Nanoparticles Preparation. CS nanoparticles (NPs) were prepared by the ionotropic gelation technique using pentasodium tripolyphosphate (TPP) and according with the protocol established by Calvo et al.5 with minor modifications. Briefly, for the preparation of a 30 mL batch of CS/TPP NPs 18.75 mL of CS solution (2 mg/mL w/w in 85 mM NaCl) were placed in a 100 mL plastic beaker under magnetic stirring (500 rpm, 1 cm magnet, room temperature) and 11.25 mL of TPP solution (1 mg/mL in 85 mM NaCl) were added uninterruptedly from a 20 mL plastic syringe. All solutions were filtered through 0.22 μm PES membranes (EMD Millipore, U.S.A.) prior to preparation. The NPs were prepared under laminar air flow in a microbiologically clean bench so as to obtain sterile NPs for cell assays. When necessary, NPs were isolated by centrifugation (40 min, 10000g, 25 °C) in 1.5 mL vials containing a glycerol bed and the pellets were resuspended in 100 μL of water. Physical Characterization. Nanoparticle size distribution was analyzed in water by dynamic light scattering with noninvasive back scattering (DLS-NIBS) at an angle of 173° with automatic attenuator setting, and the zeta potential (ζ) was determined in 1 mM KCl by mixed laser Doppler electrophoresis and phase analysis light scattering (M3-PALS). Both measurements were conducted in a Malvern Zetasizer NANO-ZS (Malvern Instruments, Worcestershire, U.K.) equipped with a 4 mW He/Ne laser beam operating at λ = 633 nm. All measurements were performed at 25 ± 0.2 °C. Nanoparticle CAP Protein Binding Efficiency. The CAP-eGFP binding efficiency was determined by adding an aliquot of NPs to a 0.15 μM solution of CAP-eGFP to a final concentration of 0.0428 mg/ mL CS. After 5 min incubation, the dispersions were centrifuged for 45 min at 10000g using a Mikro 220R centrifuge (Andreas Hettich GmbH, Tüttlingen, Germany). Supernatants were carefully removed, and their fluorescence was measured (λex = 470 nm, λem = 510 nm) in a Safire Tecan Microplate reader (Crailsheim, Germany). The amount of bound protein was estimated using a calibration curve of CAP eGFP in isotonic buffer (pH 6.0, 40 mM NaH2PO4/Na2HPO4, 195 mM

mannitol, 5.50 mM glucose, 5 mM KCl, 2.13 mM MgCl2, 1.32 mM CaCl2) up to a concentration of 0.15 μM. Degradation of Chitosan and Chitosan Nanoparticles with Chitosanase. For the enzymatic degradation experiments CS in solution or in CS NPs (0.086 mg/mL) were first incubated with CAPsfBFP and CAP-eGFP (0.15 μM). A control fluorescence scan was recorded and an active CSN (11.8 μg/mL) was added after 7.5 min incubation, emission scans were taken every 2.5 min during 25 min for the enzymatic degradation assay. The relative FRET was calculated as a factor of the increased emission intensity of the substrate-containing samples compared to the blank. Cell Culture. Madin-Darby canine kidney cells (MDCK-C7) were grown in sterile minimal essential medium (MEM) with Earle’s salts (PAA, Austria; additionally added: 10% (v/v) fetal calf serum; 1% (v/ v) penicillin/streptomycin; 1% (v/v) L-glutamine) that was changed daily. Cell culture plates (6 well, SPL Life Sciences, Korea) were kept in a cell incubator at 37 °C in 5% CO2. Nanoparticle−Cell Interaction by Confocal Laser Scanning Microscopy (CLSM). CLSM was performed using a Leica TCS SP2 mounted on a Leica DM IRES inverted microscope. The experiments were performed by removing the cell culture medium and washing the cell culture plates with isotonic buffer (see above) once. Afterward, the buffer was exchanged with the samples and the cells were incubated for 1 h at 37 °C at 5% CO2 environment. Afterward samples were removed and replaced with fresh buffer for direct observation of the cells under the microscope, or by CellMask Deep Red plasma membrane staining solution, when cell staining was required. Staining was carried out according to the supplied protocol.

■

RESULTS AND DISCUSSION The fluorescent chitosan-binding fusion proteins show preferential affinity for chitosan substrates, determined by their degree of acetylation. The first hypothesis we investigated was whether the engineered fluorescent chitin/CS-binding proteins had a high binding affinity and preference for chitin and CS substrates varying in DA. The chitin-binding domain from Bacillus licheniformis DSM13 Chitinase was therefore Nterminally fused to eGFP. Like the CAP,8 CBP also contains Nterminal StrepII and C-terminal His6 tags for purification and detection. The gene construct design and the SDS-PAGE gels confirming the purity of the obtained fusion proteins are both shown in Supporting Information (Figures SI 1 and SI 2, respectively). The site-mutated chitosanase used in the CAP is proposed to contain binding sites for six sugar monomers each establishing at least one hydrogen bond or stacking interaction with the polymer. The chitin-binding domain of B. licheniformis DSM13 Chitinase is homologous to ChiC CBD of Streptomyces griseus HUT6037.25 The affinities of CAP and CBP were tested in a dot blot assay (Figure 1A) in which each showed reciprocal binding specificities toward soluble CS polymers of varying DA (up to DA ∼60%). Whereas CAP showed increasing affinity as the DA of the substrate declined, CBP showed higher affinity for more acetylated CS. However, CBP was less strictly DAdependent compared to CAP, reflecting the presence of fewer binding sites with the capacity to discriminate between GlcN and GlcNAc. This may be due to the nature of the chitinbinding domain, which is proposed to establish two stacking interactions with two hexose rings and two hydrogen bonds with GlcNAc. Additionally, the hydrogen bonds formed by type A platform-like CBMs (such as ChiC CBD) do not substantially influence substrate affinity.26 Competitive binding at overlapping binding sites may also displace an incumbent CBP. Therefore, the stable DA-dependent arrangement of the FRET donor appears possible only using CAP. CBP then fills up acetylated regions with interspersed FRET acceptors. C


Biomacromolecules

Article

CAP-fluorescent FRET-pair proteins associate efficiently and without destabilizing chitosan-TPP NPs during incubation. Having demonstrated that the CAP-fluorescent fusion proteins have a higher affinity for low-DA CS (DA ≤ ∼20%), we chose ∼16% DA CS as an appropriate ligand for the fluorescent FRET proteins. Therefore, all subsequent studies were carried out with CAP-sfBFP as the donor and CAP-eGFP as the acceptor. Table 1 shows the characteristics of the resulting CSTable 1. Characteristics of Native and Isolated ChitosanTPP Nanoparticles (Mean Values ± SD; n = 3)

a

nanoparticles

size (d·nm)

PdIa

zeta potential (mV)

native isolated

205 ± 14 262 ± 11

0.159 0.122

+31.9 ± 4.5

Polydispersity index.

TPP NPs, which had an average size, polydispersity index (PDI) and zeta potential concordant with those found in previous studies using the same type of chitosan hydrochloride salt, Protasan 113 CL.27 The affinity of each protein for the substrate was not affected by the protein concentration but protein retention increased at higher particle concentrations (Figure 2A), a phenomenon

Figure 1. (A) Binding specificity of CAP (left) and CBP (right) tested via Dot Blot Assay.23 (B) Correlation between the FRET-behavior of CAP-eBFP and CBP-eGFP and the DA of the substrates. Equimolar amounts (1.63 μM) of the two affinity proteins were incubated with 0.1 mg/mL of substrate. FRET intensities (λex = 380 nm, λem = 510 nm) of different DAs relative to substrate-free controls (mean values ± SD, n = 3).

To investigate the FRET behavior of the CAP and CBP variants during binding to chitosans with different DAs (10, 20, 37, 50 and 61%; Mw ≈ 166 to 262 kDa as determined by GPCDRI-MALLS8), CAP-eBFP, and CBP-eGFP fusion proteins were studied. A linear correlation between the observed relative FRET and the substrate DA (Figure 1B) was observed. This correlation was also consistent at pH 6.0 when one or both improved fluorophores (sfGFP and sfBFP) were used instead. The maximum fluorescence intensity of the improved fluorophores was higher, but the correlation between FRET and DA was no better. Interestingly, when the FRET donor (eBFP) is attached to CAP the linear correlation can be extended until DA 100% (soluble glycolchitin), instead the use of CAP-eGFP and CBP-eBFP produced nonlinear correlations (Figure SI 3 in Supporting Information). The smaller size of CBP would also be advantageous for this function. Yet another characteristic of CS potentially affecting the overall performance of the system could be the pattern of acetylation (PA). A more blockwise arrangement of GlcN and GlcNAc units could lead to the disproportional binding of high-affinity proteins, producing a lower FRET signal than random PAs and, thus, predicting a higher DA. Thus far, all commercial chitosan polymers have a random PA, so the effect should be negligible. Two polymeric test chitosans of DA 60.8 ± 5.0 and 32.4 ± 5.0% (DA values determined by 1H NMR) were used to check the accuracy of the FRET-based method. The polymers were incubated at pH 6.0 with CAP-eBFP and CBP-eGFP, yielding DAs of 55.3 ± 4.2 and 29.6 ± 2.7%, respectively, thus, agreeing closely with the values determined by 1H NMR. The standard deviation for both methods was also comparable (≤5%). Like 1 H NMR, the limitation of our method is that the substrate must be in solution, thus, the applicable range of DAs is ≤60%. Even so, because sample preparation requires only that the substrate is dissolved, this method is simple, rapid, and only a few micrograms of substrate are required (compared to milligrams for 1H NMR). Although the improved fluorophore variants do not increase sensitivity, they are more stable and also less prone to photobleaching.24

Figure 2. (A) Protein retention at different CS-TPP nanoparticle concentration; (B) Evolution of the average size, polydispersity index (PDI), and derived count rate (DCR) during incubation of CS-TPP nanoparticles with the fusion proteins (gray circles) and corresponding pristine CS-TPP nanoparticles (black boxes; chitosan concentration in both was 0.043 mg/mL); the amount of added fusion proteins was identical in both experiments: 0.15 μM CAP-sfBFP and CAP-eGFP (isotonic buffer pH 6.0, see Materials and Methods; 30 °C, mean values ± SD; n = 3).

typically seen in enzyme−substrate interactions.28 The overall NP size depended on the duration of incubation (Figure 2B). Note that the size of the NPs with FRET proteins declines more rapidly over time compared to the unmodified NPs. This behavior may reflect the influence of the pH of the buffer (pH ≈ 6.0) because this would neutralize the charged −NH3+ groups in the CS GlcN residues, so quenching the weak electrostatic interaction between TPP and CS.29 A nanoparticle shell comprising neutralized stretches of CS chains is likely to adopt a more compact conformation because electrostatic repulsion between charged amino groups would be screened. However, this does not explain the difference in size between NPs incubated with CAP-fluorescent protein and unmodified NPs. The CAP-fluorescent proteins may exert a destabilizing effect on the NPs, consistent with the 70% reduction in the absolute derived count rate values (i.e., proportional to the number of scattering particles detected by DLS). It is possible that the CAP-fluorescent proteins may displace TPP from the NP matrix because the binding constant of CAP for CS would D


Biomacromolecules

Article

Figure 3. Fluorescence emission spectra of CAP-sfBFP and CAP-eGFP fusion proteins in the presence of (A) chitosan (Protasan CL 113) in solution and (B) CS-TPP nanoparticles (from chitosan Protasan CL 113). The amount of added CAP-sfBFP and CAP-eGFP fusion proteins was 0.15 μM. Key: black line, free protein; red-line CS, 0.021 mg/mL; blue line CS, 0.043 mg/mL; green line CS, 0.064 mg/mL; gray line CS, 0.086 mg/ mL. λex = 380 nm both after 5 min incubation time (isotonic buffer pH 6.0, see Materials and Methods; 30 °C).

Figure 4. (A) Evolution of FRET index variation (%) for chitosan in solution (triangles) and chitosan-TPP NPs (circles) in the absence (red traces) or presence of chitosanase (blue traces). The chitosanase (11 μg/mL) in both cases was added after the first time point measurement (5.5 min). A negative control is included (black boxes) comprising the two CAP-sfBFP and CAP-eGFP FRET fusion proteins in the absence of substrate (chitosan or chitosan-TPP nanoparticles) and incubated in identical conditions as those used during the enzymatic degradation assays. Fluorescence spectra for FRET index determinations were registered at 5 min time intervals (λex = 380 nm). (B) Evolution of the average diameter size (gray traces) and relative DCR(%) (red traces) of CS-TPP NPs in the absence (circles) and presence (boxes) of chitosanase (0.17 mg/mL); the amount of added CAP-sfBFP and CAP-eGFP fusion proteins was each 0.15 μM. The concentration of chitosan was 0.043 mg/mL throughout the two experiments (isotonic buffer pH 6.0, see Materials and Methods; 30 °C, mean values ± min and max; n = 2).

FRET eGFP enhancement.32,33 All these methods confirmed that FRET occurred on both substrates (Table SI 1 in Supporting Information). Figure 3 shows a clear increase in donor quenching as the concentration of CS increased (from −3.7 to −10%) but no such effect for CS-TPP NPs, where the values fluctuated around −4.4%. It was not possible to demonstrate a clear concentration-dependent response for the GFP enhancement effect, but the CS-TPP NPs achieved a 2fold enhancement compared to CS in solution as it is observed in the inset of Figure 3B. We also analyzed the FRET index expressed as the ratio between acceptor enhancement and donor quenching. CS in solution showed a consistent concentration-dependent increase in the FRET index, whereas the CS-TPP NPs achieved a maximum value at 0.064 mg/mL and the overall values were somewhat greater than those observed for CS solutions. These differences may reflect the overall distribution and availability of binding sites on the CS substrate, which are likely to differ when comparing a fluctuating random coil polymeric chain to a more constrained NP surface. The greater surface-to-volume ratio, spherical shape, number of exposed sites, and their restricted mobility at the surface may all account for the lower donor quenching and higher acceptor enhancement effects in the NPs, thus, suggesting that a greater proportion of acceptor species are excited per donor unit. Calculated absolute FRET values that account for any crosstalk and bleed-through the fluorophores32 did not reveal any difference between the two substrates, but only a significant change in signal intensity with

be high enough to exceed that of the binding interaction between CS and TPP.30 The fraction of NPs surviving this disintegration process would therefore tend toward a constant diameter of ∼170−180 nm, ∼60 nm less than the unmodified NPs. The binding of CAP-fluorescent proteins to NPs causes the contraction of the CS shell surrounding the particle. The PDI of the NPs (representing the particle size distribution) also increased during the incubation period, whereas that of the unmodified particles did not change significantly. The optimal incubation conditions for CS-TPP NPs and the CAP-fusion proteins were an achievement of enormous practical relevance. FRET occurs in the context of chitosan in solution and on the surface of CS-TPP NPs. Having confirmed that CAP-eGFP adsorbed to the surface of CS-TPP NPs without changing the colloidal properties of the system, we investigated FRET behavior when the two CAP-fluorescent proteins were incubated simultaneously with CS in solution and CS-TPP NPs. Figure 3 shows the fluorescence emission spectra after exciting the donor (sfBFP, λ = 380 nm) as a function of different amounts of either CS in solution (Figure 3A) or CSTPP NPs (Figure 3B). Quenching of the donor was observed at λ = 442 nm, and the acceptor (eGFP) was enhanced at λ = 510 nm. The effect of scattering in these experiments was assumed to be negligible because the absorbance of both samples at the excitation wavelength was always 5.5 nm, the reported R0 value (i.e., 50% of donor quenching) for the BFP-GFP FRET pair.34 FRET is lost after the enzymatic degradation of labeled CS in solution or labeled CS-TPP NPs. FRET occurs when the CAPsfBFP and CAP-eGFP bind in close proximity on the same CS substrate, thus, degradation of the substrate should therefore extinguish the FRET signal as indicated by the experiment shown in Figure 4. The enzymatic degradation of CS polymers and CS-TPP NPs using a chitosanase with a preference for lowDA substrates35 resulted in the progressive loss of the FRET signal (Figure 4A). Untreated control CS-TPP NPs showed that the FRET index reaches a maximum after 5 min of incubation, possibly because the binding sites for CAPfluorescent proteins on the CS-TPP NP surface are less accessible than those on a dissolved polymer, such that it takes longer to reach equilibration.36 A negative control was also tested consisting of the two CAP-sfBFP and CAP-eGFP FRET fusion proteins measured in the absence of CS polymer in solution nor CS-TPP NPs incubated under identical conditions as those used during the enzymatic degradation assays. Notice that the FRET values remained essentially unchanged during the timespan of the assay, diagnostic that FRET does not occur in the absence of the CS substrates.

DLS analysis under identical conditions confirmed that the CS-TPP NPs are degraded by chitosanase acting on the CS substrate, as shown by the declining relative DCR values (Figure 4B). Furthermore, the kinetics of degradation can be described by an exponential decay function until a steady state is achieved with relative DCR values of ∼20% compared to the starting point, which is similar to the profile of the FRET signal. Although relative DCR values also declined in the control treatment (CS-TPP NPs without enzyme), the magnitude of the change was ∼50% of that seen when the enzyme was present, and the profile was distinct. Together, these experiments suggest that the degradation of CS on the surface of CSTPP NPs results in the loss of FRET due to the separation of the CAP-fluorescent proteins. Surprisingly, the enzymatic degradation of the CS-TPP NPs caused only a marginal reduction in the bulk average size of the fraction of NPs that survived the enzymatic process. However, this was also observed in the control samples suggesting that the change in particle size is unrelated to the loss of FRET and scattering by NPs. This may reflect the observation that the contribution of larger particles to scattering intensity is often overestimated in DLS.37 Nevertheless, the monotonic decrease in size (first sharp decrease followed by discrete increase) can be also associated with a beginning of a aggregation induced by the free TPP released from the degradation of the smallest particles, as is observed in the enzymatic degradation of other CS-based NPs.38 F


Biomacromolecules

Article

chemical affinity of CAP. In addition, FRET was exploited to probe the integrity of the CS polymer or the CS-NP surface, given that enzymatic degradation of both substrates led to irreversible loss of FRET. Our approach could therefore be used to label all CS NPs and presumably other CS-based nanostructures such as nanofibers and nanoscaffolds. The loss of FRET could also be used to determine the fate of NPs interacting with mammalian cells, for example, monitoring the interactions by CLSM, FACS, or fluorescence spectroscopy. We have shown in principle that interactions between MDCK cells and CS-TPP-NPs or CS can be monitored by CLSM, revealing that CS-TPP-NPs are embedded in the cell membrane, and refinement of the technique could allow the integrity of CS-NPs to be determined following internalization. In the future, other bioactive macromolecules, such as enzymes, monoclonal antibodies, and hormones, could be fused with CAP domains to functionalize the surface of nanomaterials, for example, for drug targeting.

CAP-fluorescent proteins can be used to label and trace CSbased NPs when they interact with mammalian cells. Having established that the CAP-fluorescent proteins bind CS in solution and CS-TPP NPs and that such interactions can be monitored by FRET, we investigated whether this approach could be used to monitor the interaction of CS-based nanomaterials with mammalian cells by CLSM. Figure 5 presents representative overlay CLSM images of the bright field and green channel (λex = 405 nm) for MDCK-C7 cells following a 1 h incubation with either free CAP-fluorescent proteins (Figure 5A), CS in solution (Figure 5B), or CS-TPP NPs (Figure 5C), in each case without washing before fixing the cells in cold ethanol. Incubating cells with the free CAPfluorescent proteins (without substrate) led to the formation of protein aggregates that were randomly distributed on the cell membrane and in the interstices between the cells (Figure 5A). In contrast, the labeled CS was distributed across the cell membrane (Figure 5B), whereas labeled CS-TPP NPs accumulate as large and intensely fluorescent aggregates on the membrane (Figure 5C). Having demonstrated that CS-TPP NPs can be labeled with the CAP-fluorescent proteins, we reduced the overall concentration of the CAP-fluorescent proteins by 10-fold and introduced a wash step to remove excess label and colocalize the labeled NPs with the cell membranes. Figure 6 shows representative CLSM overlay images of the bright field, with the cell membrane in red (λex = 610 nm) and the CS-TPP NPs in green (λex = 405 nm). The free CAP-fluorescent proteins and labeled CS polymer did not yield a green signal, indicating that in both cases the proteins and CS were washed away (Figure 6A). In contrast the labeled CS-TPP NPs can be distinguished as clusters of green fluorescence that colocalize with the cell membrane (white arrows) but are not found within the cell, or as green clusters that are clearly embedded in the cell membrane after incubation during 60 min (Figure 6B,C) or 120 min (Figure 6D). Similarly, membrane retention and cell surface interaction was also observed for particles of highmolecular-weight chitosan.39 In contrast, there is evidence that cationic PEG-derived NPs are taken up via transcytosis into MDCK cells, leading to the accumulation of particles in the lateral plasma membrane after 45 min.40 However, other studies using different cell lines indicate the cellular uptake and lysosomal transit of chitosan.23

■

ASSOCIATED CONTENT

S Supporting Information *

The gene construct design of the fusion protein chitin binding protein (CBP) and the fluorescent protein variants (eGFP/ sfGFP or eBFP/sfBFP); SDS-PAGE gels and Western blots of the different synthesized fusion proteins; a plot showing the dependence of the relative FRET and the degree of acetylation of the CS substrates; a table of FRET parameters for fusion proteins after incremental addition of CS in solution or CSTPP NPs. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected] (F.M.G.). *E-mail: [email protected] (S.K.). Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We thank Susana M. Pereira for her valuable help in the cell culture studies, Prof. Mariá J. Alonso, Dr. Antón Vila Sanjurjo, and Dr. Richard M. Twyman for critically reading the manuscript. We are indebted to Dr. Mariana Leguia, from Anderson Lab UC Berkeley, for providing the plasmid pBCa9145-jtk2828::sfGFP; and to Prof. Dr. Antje von Schaewen and Prof. Susane Fetzner for the generous access to CLSM and to fluorescence spectroscopy instruments, respectively. We acknowledge funding support from the DFG (Project GRK 1549 IRTG “Molecular and Cellular GlycoSciences”) and the Danish Agency for Science, Technology and Innovation (FENAMI Project 10-093456).

■

CONCLUSIONS This study introduced a novel method to determine the DA of CS based on the preferential affinity of two chitin/chitosanbinding proteins, namely, CBP and CAP, fused to a pair of fluorescent proteins known to interact via FRET in close proximity. This allowed the development of fusion proteins sharing the same CAP domain, with the highest affinity to lowDA CS, the most widely available CS for research and downstream applications. Well-characterized NPs, harnessed by the ionotropic gelation of CS and TPP, were shown to associate with the CAP-fluorescent proteins in a concentration-dependent manner, with an efficiency of ∼20%. Optimal conditions were also established that preserved the colloidal stability of the NPs during incubation with the CAP-fluorescent proteins. The FRET signal was induced by the concomitant binding of the two CAP-fluorescent proteins on the NP surface or to the same CS polymer in solution, confirming that the CAP-fluorescent proteins bound to both types of CS substrates and could be conceived as a noncovalent labeling strategy based only on the

■

REFERENCES

(1) Rinaudo, M. Chitin and chitosan: Properties and applications. Prog. Polym. Sci. 2006, 31, 603−632. (2) Hirai, A.; Odani, H.; Nakajima, A. Determination of degree of deacetylation of chitosan by 1H NMR spectroscopy. Polym. Bull. 1991, 26, 87−94. (3) Brugnerotto, J.; Lizardi, J.; Goycoolea, F. M.; Argüelles-Monal, W.; Desbrières, J.; Rinaudo, M. An infrared investigation in relation with chitin and chitosan characterization. Polymer 2001, 42, 3569− 3580.

G


Biomacromolecules

Article

(4) Prego, C.; Goycoolea, F. M., Nanostructures Overcoming the Nasal Barrier: Protein and Peptide Delivery Strategies. In Nanostructured Biomaterials for Overcoming Biological Barriers; The Royal Society of Chemistry: London, U.K., 2012; Chapter 3.2, pp 133−155. (5) Calvo, P.; Remuñań -López, C.; Vila-Jato, J. L.; Alonso, M. J. Novel hydrophilic chitosan-polyethylene oxide nanoparticles as protein carriers. J. Appl. Polym. Sci. 1997, 63, 125−132. (6) Garcia-Fuentes, M.; Alonso, M. J. Chitosan-based drug nanocarriers: where do we stand? J. Controlled Release 2012, 161, 496−504. (7) Sahay, G.; Alakhova, D. Y.; Kabanov, A. V. Endocytosis of nanomedicines. J. Controlled Release 2010, 145, 182−195. (8) Nampally, M.; Moerschbacher, B. M.; Kolkenbrock, S. Fusion of a novel genetically engineered chitosan affinity protein and green fluorescent protein for specific detection of chitosan in vitro and in situ. Appl. Environ. Microbiol. 2012, 78, 3114−9. (9) Hu, C. S.; Chiang, C. H.; Hong, P. D.; Yeh, M. K. Influence of charge on FITC-BSA-loaded chondroitin sulfate-chitosan nanoparticles upon cell uptake in human Caco-2 cell monolayers. Int. J. Nanomed. 2012, 7, 4861−4872. (10) Essa, S.; Rabanel, J. M.; Hildgen, P. Characterization of rhodamine loaded PEG-g-PLA nanoparticles (NPs): Effect of poly(ethylene glycol) grafting density. Int. J. Pharm. 2011, 411, 178−187. (11) Frei, E. Albumin binding ligands and albumin conjugate uptake by cancer cells. Diabetol. Metab. Syndr. 2011, 3, 11. (12) Moreno-Villoslada, I.; Fuenzalida, J. P.; Tripailaf, G.; ArayaHermosilla, R.; Pizarro, G. D. C.; Marambio, O. G.; Nishide, H. Comparative study of the self-aggregation of rhodamine 6G in the presence of poly(sodium 4-styrenesulfonate), poly(N-phenylmaleimide-co-acrylic acid), poly(styrene-alt-maleic acid), and poly(sodium acrylate). J. Phys. Chem. B 2010, 114, 11983−11992. (13) Ma, O.; Lavertu, M.; Sun, J.; Nguyen, S.; Buschmann, M. D.; Winnik, F. M.; Hoemann, C. D. Precise derivatization of structurally distinct chitosans with rhodamine B isothiocyanate. Carbohydr. Polym. 2008, 72, 616−624. (14) Yue, Z.-G.; Wei, W.; Lv, P.-P.; Yue, H.; Wang, L.-Y.; Su, Z.-G.; Ma, G.-H. Surface charge affects cellular uptake and intracellular trafficking of chitosan-based nanoparticles. Biomacromolecules 2011, 12, 2440−2446. (15) Fernandez-Suarez, M.; Ting, A. Y. Fluorescent probes for superresolution imaging in living cells. Nat. Rev. Mol. Cell Biol. 2008, 9, 929−943. (16) Meng, Q.; He, C.; Su, W.; Zhang, X.; Duan, C. A new rhodamine−chitosan fluorescent material for the selective detection of Hg2+ in living cells and efficient adsorption of Hg2+ in natural water. Sens. Actuators, B 2012, 174, 312−317. (17) Chhabra, D.; dos Remedios, C. G., Fluorescence Resonance Energy Transfer. eLS; John Wiley and Sons, Ltd: New York, 2005. (18) Nesmelov, Y. E.; Agafonov, R. V.; Negrashov, I. V.; Blakely, S. E.; Titus, M. A.; Thomas, D. D. Structural kinetics of myosin by transient time-resolved FRET. Proc. Natl. Acad. Sci. U.S.A. 2011, 108, 1891−1896. (19) Kohl, T.; Heinze, K. G.; Kuhlemann, R.; Koltermann, A.; Schwille, P. A protease assay for two-photon crosscorrelation and FRET analysis based solely on fluorescent proteins. Proc. Natl. Acad. Sci. U.S.A. 2002, 99, 12161−12166. (20) Wong, A. P.; Groves, J. T. Molecular topography imaging by intermembrane fluorescence resonance energy transfer. Proc. Natl. Acad. Sci. U.S.A. 2002, 99, 14147−14152. (21) Wagh, A.; Qian, S. Y.; Law, B. Development of biocompatible polymeric nanoparticles for in vivo NIR and FRET imaging. Bioconjugate Chem. 2012, 23, 981−992. (22) Saleh, S.; Müller, R.; Mader, H.; Duerkop, A.; Wolfbeis, O. Novel multicolor fluorescently labeled silica nanoparticles for interface fluorescence resonance energy transfer to and from labeled avidin. Anal. Bioanal. Chem. 2010, 398, 1615−1623.

(23) Thibault, M.; Nimesh, S.; Lavertu, M.; Buschmann, M. D. Intracellular trafficking and decondensation kinetics of chitosan-pDNA polyplexes. Mol. Ther. 2010, 18, 1787−1795. (24) Pedelacq, J. D.; Cabantous, S.; Tran, T.; Terwilliger, T. C.; Waldo, G. S. Engineering and characterization of a superfolder green fluorescent protein. Nat. Biotechnol. 2006, 24, 1170−1170. (25) Kezuka, Y.; Ohishi, M.; Itoh, Y.; Watanabe, J.; Mitsutomi, M.; Watanabe, T.; Nonaka, T. Structural studies of a two-domain chitinase from Streptomyces griseus HUT6037. J. Mol. Biol. 2006, 358, 472−484. (26) McLean, B. W.; Bray, M. R.; Boraston, A. B.; Gilkes, N. R.; Haynes, C. A.; Kilburn, D. G. Analysis of binding of the family 2a carbohydrate-binding module from Cellulomonas fimi xylanase 10A to cellulose: specificity and identification of functionally important amino acid residues. Protein Eng. 2000, 13, 801−809. (27) Goycoolea, F. M.; Lollo, G.; Remuñań -López, C.; Quaglia, F.; Alonso, M. a. J. Chitosan-alginate blended nanoparticles as carriers for the transmucosal delivery of macromolecules. Biomacromolecules 2009, 10, 1736−1743. (28) Alberts, B. J. A.; Lewis, J, et al. In Mol. Biol. Cell, 4th ed.; Anderson, M. G. B., Ed.; Garland Science: New York, 2002. (29) Lopez-Leon, T.; Carvalho, E. L. S.; Seijo, B.; Ortega-Vinuesa, J. L.; Bastos-Gonzalez, D. Physicochemical characterization of chitosan nanoparticles: electrokinetic and stability behavior. J. Colloid Interface Sci. 2005, 283, 344−351. (30) Ball, V.; Maechling, C. Isothermal microcalorimetry to investigate nonspecific interactions in biophysical chemistry. Int. J. Mol. Sci. 2009, 10, 3283−3315. (31) Valeur, B.; Berberan-Santos, M. N. Steady-State Spectrofluorometry. In Molecular Fluorescence; Wiley-VCH Verlag GmbH and Co. KGaA: New York, 2012; pp 263−283. (32) Takanishi, C. L.; Bykova, E. A.; Cheng, W.; Zheng, J. GFP-based FRET analysis in live cells. Brain Res. 2006, 1091, 132−9. (33) Liu, Y.; Song, Y.; Jiang, L.; Liao, J. Quantitative analysis of FRET assay in biology: New developments in protein interaction affinity and protease kinetics determinations in the SUMOylation cascade. Front. Biol. (Beijing, China) 2012, 7, 57−64. (34) Hink, M. A.; Visser, N. V.; Borst, J. W.; van Hoek, A.; Visser, A. J. W. G. Practical use of corrected fluorescence excitation and emission spectra of fluorescent proteins in Förster resonance energy transfer (FRET) studies. J. Fluoresc. 2003, 13, 185−188. (35) Adachi, W.; Sakihama, Y.; Shimizu, S.; Sunami, T.; Fukazawa, T.; Suzuki, M.; Yatsunami, R.; Nakamura, S.; Takenaka, A. Crystal structure of family GH-8 chitosanase with subclass II specificity from Bacillus sp K17. J. Mol. Biol. 2004, 343, 785−795. (36) Hennig, A.; Borcherding, H.; Jaeger, C.; Hatami, S.; Würth, C.; Hoffmann, A.; Hoffmann, K.; Thiele, T.; Schedler, U.; Resch-Genger, U. Scope and limitations of surface functional group quantification methods: exploratory study with poly(acrylic acid)-grafted micro- and nanoparticles. J. Am. Chem. Soc. 2012, 134, 8268−8276. (37) Filipe, V.; Hawe, A.; Jiskoot, W. Critical evaluation of Nanoparticle Tracking Analysis (NTA) by NanoSight for the measurement of nanoparticles and protein aggregates. Pharm. Res. 2010, 27, 796−810. (38) Brunel, F.; El Gueddari, N. E.; Moerschbacher, B. M. Complexation of copper(II) with chitosan nanogels: Toward control of microbial growth. Carbohydr. Polym. 2013, 92, 1348−1356. (39) Garaiova, Z.; Strand, S. P.; Reitan, N. K.; Lélu, S.; Størset, S. Ø.; Berg, K.; Malmo, J.; Folasire, O.; Bjørkøy, A.; de L. Davies, C. Cellular uptake of DNA−chitosan nanoparticles: The role of clathrin- and caveolae-mediated pathways. Int. J. Biol. Macromol. 2012, 51, 1043− 1051. (40) Harush-Frenkel, O.; Rozentur, E.; Benita, S.; Altschuler, Y. Surface charge of nanoparticles determines their endocytic and transcytotic pathway in polarized MDCK cells. Biomacromolecules 2008, 9, 435−443.

H


Affinity Protein-Based FRET Tools for Cellular Tracking of Chitosan

Recommend Documents