Affinity Thermoprecipitation and Recovery of Biotinylated

Biomolecules via a Mutant StreptavidinrSmart Polymer Conjugate ... A high off-rate Ser45Ala (S45A) streptavidin mutant has been covalently conjugated ...
0 downloads 0 Views 105KB Size
Download PDF
Bioconjugate Chem. 2003, 14, 575−580

575

Affinity Thermoprecipitation and Recovery of Biotinylated Biomolecules via a Mutant Streptavidin-Smart Polymer Conjugate Noah Malmstadt, David E. Hyre, Zhongli Ding, Allan S. Hoffman,* and Patrick S. Stayton* Department of Bioengineering, University of Washington, Seattle Washington 98195. Received August 14, 2002

A system has been developed for reversibly binding and thermoprecipitating biotinylated macromolecules. A high off-rate Ser45Ala (S45A) streptavidin mutant has been covalently conjugated to poly(N-isopropylacrylamide) (PNIPAAm), a temperature-responsive polymer. The resulting conjugate is shown to coprecipitate biotinylated immunoglobulin G (IgG) and a biotinylated oligonucleotide in response to a thermal stimulus. Thermally precipitated biotinylated macromolecules can be released from the S45A-PNIPAAm conjugate by simple treatment with excess free biotin. This release step has been shown to be unique to the mutant streptavidin conjugatesa conjugate of wild type (WT) streptavidin and PNIPAAm does not release bound biotinylated molecules upon treatment with excess free biotin. The capture efficiency (fraction of target molecule precipitated from solution) of the S45APNIPAAm conjugate is similar to that of the WT-PNIPAAm conjugate for the biotinylated IgG target molecule (near 100%), but significantly smaller for the biotinylated oligonucleotide target (approximately 60% for the S45A-PNIPAAm conjugate compared to 80% for the WT-PNIPAAm conjugate). The release efficiency (fraction of originally precipitated target molecule released after treatment with free biotin) of the S45A-PNIPAAm conjugate is 70-80% for the biotinylated IgG target and nears 100% for the biotinylated oligonucleotide target. This system demonstrates the use of a high off-rate streptavidin mutant to add reversibility to a system based on smart-polymerstreptavidin conjugates.

INTRODUCTION

Streptavidin is a 53 kDa tetrametic protein produced in nature by the bacterium Streptomyces avidinii (1-3). Each of the four streptavidin monomers binds one molecule of the vitamin biotin with extraordinarily high affinity: one of the strongest known noncovalent interactions in biochemistry, with an association constant (Ka) of 1014-1015 M-1 (3, 4). Because of this high affinity, the capacity of streptavidin to bind multiple biotin molecules, and the ease with which a great variety of molecules can be biotinylated, the biotin-streptavidin system has become a key component of many processes in biotechnology and the biomedical sciences (5, 6). The utility of the biotin-streptavidin system is limited, however, by the difficulty in releasing captured biotinylated targets. The half-life of the binding interaction between wild-type (WT) streptavidin and biotin at 25 °C is over 35 h (7, 8). The potential for utilizing site-directed streptavidin mutants to introduce reversibility has been shown previously by our group (9) and more recently by others (10, 11). In the work presented here, we show that a sitedirected mutant of streptavidin that displays a relatively high biotin off-rate can be used in combination with “smart” polymers to create a reversible molecular separations systems for biotinylated targets. The mutant protein, in which residue 45 has been changed from serine to alanine via recombinant techniques, has a biotin offrate of 0.05 s-1 at 37 °C, corresponding to a binding half* Corresponding authors. A.S.H.: (address) Department of Bioengineering, Box 352255, University of Washington, Seattle, WA 98195; (tel) 206-543-9423; (fax) 206-543-6124; (e-mail) [email protected]. P.S.S.: (address) Department of Bioengineering, Box 351721, University of Washington, Seattle, WA 98195; (tel) 206-685-8148; (fax) 206-685-8256; (e-mail) [email protected].

life of 14 s (12). Hence, when a complex of mutant (termed S45A) streptavidin bound to biotinylated macromolecule is treated with an excess of free biotin, the macromolecule should be completely displaced by the free biotin within minutes. In the work presented here, this capacity for release has been investigated in the context of an affinity thermoprecipitation system, in which a conjugate of S45A streptavidin and thermoresponsive smart polymer serves as a bioseparation agent for a variety of biotinylated macromolecules. Affinity precipitation systemssbioseparation systems in which a target molecule is bound in solution to a species which can later be precipitated from solution along with the targetshave been a subject of much recent interest (13-17). Since binding takes place in solution phase, affinity precipitation systems avoid the mass transport limitations inherent in affinity chromatography. Affinity precipitation technologies also result in smaller product volumes than affinity chromatography, simplifying downstream processing. One approach to affinity precipitation is to conjugate the affinity moiety to a “smart” polymer that undergoes a phase transition upon the application of a specific external stimulus (18-20). After binding to the affinity-modified polymer in solution, the target molecule is precipitated via the phase-change stimulus of the polymer. Here we make use of poly(N-isopropylacrylamide) (PNIPAAm), which is soluble at low temperatures but undergoes a hydrophobic transition, aggregation, and precipitation at temperatures above about a lower critical solution temperature (LCST) that is dependent upon polymer molecular weight and solution conditions (21-23). We have conjugated PNIPAAm to S45A streptavidin to facilitate the affinity thermoprecipitation of various biotinylated biomolecules. This separation was followed by a release

10.1021/bc020055l CCC: $25.00 © 2003 American Chemical Society Published on Web 04/19/2003

576 Bioconjugate Chem., Vol. 14, No. 3, 2003

Figure 1. Diagram of a proposed application of mutant streptavidin-smart polymer thermoprecipitation. A target molecule is incubated with a biotinylated antibody to that molecule. Mutant streptavidin-smart polymer conjugate is added to the mixture (1). The biotinylated antibody, with bound target molecule, binds the streptavidin-smart polymer conjugate (2). The phase transition stimulus of the smart polymer is triggered, and the resulting aggregates are separated from bulk solution (3). Free biotin is added to the complex, releasing the biotinylated antibody. Antibody-target complex is separated from the aggregated streptavidin-smart polymer conjugates (4).

step, in which the target molecule was freed from the PNIPAAm-streptavidin complex by treatment with excess free biotin. This system demonstrates the flexibility that a reversible biotin-streptavidin linkage can add to technologies built on smart polymer-mediated affinity separations and the biotin-streptavidin system. A prospective application of this system to an immunoseparation is shown diagrammatically in Figure 1. MATERIALS AND METHODS

Preparation of PNIPAAm. Linear PNIPAAm containing a single terminal N-hydroxysuccinimidyl (NHS) ester group was synthesized according to a previously published protocol (24). The number-averaged molecular weight (M h n)of this polymer was determined to be 11 028 by vapor pressure osmometry (VPO, device model OSV111, Knauer, Germany). The polymer LCST in pure water was determined to be 32 °C. To generate free (unmodified) PNIPAAm matching the molecular weight distribution of this NHS-terminated polymer, the NHS-terminated polymer was dissolved in deionized water at 3.2 mg/mL and incubated at room temperature for 48 h to allow for hydrolysis of the NHS group. Preparation of S45A and WT streptavidin. The S45A streptavidin gene was constructed from the recombinant WT core streptavidin gene by PCR mutagenesis as described by Hyre et al. (12). Recombinant S45A and WT streptavidin were expressed and purified according to a previously published protocol (25). PNIPAAm-Streptavidin conjugation. A solution of 20-30 mg/mL streptavidin (WT or S45A) in pH 7.6 phosphate buffered saline (PBS, 20mM phosphate, 5mM sodium chloride) was prepared. To this solution 50 µL of 140 mg/mL NHS-PNIPAAm solution in DMF was added. This reaction mixture was incubated with rotation at 4 °C overnight. Following reaction, the PNIPAAm-containing species were thermoprecipitated. Thermoprecipitation proceeded as follow: the reaction mixture was centrifuged for 10 minutes at 14 000 rpm in a microcentrifuge, which had been heated to 37 °C. The pellet was resolubilized by incubation in 150 µL of pH 7.6 PBS (20mM

Malmstadt et al.

phosphate, 5mM sodium chloride) at 4 °C for 1 h followed by vortexing. The supernatant was subjected to heated centrifugation twice more, with resolubilization of each resultant pellet. The resolubilized pellets were pooled, and the supernatant was reserved. The supernatant contained a high concentration of unreacted streptavidins to this solution was added a fresh volume of NHSPNIPAAm solution, and the reaction and thermoprecipitation process was repeated. The reaction was repeated twice more, until most of the streptavidin in the supernatant had been reacted. The resolubilized pellets from each reaction were pooled and subjected to iminobiotin affinity chromatography (26), removing all unreacted polymer (iminobiotin-modified agarose beads were obtained from Pierce, Rockford, IL). Thermoprecipitation was repeated a final time with the resultant conjugate solution, to remove any unreacted streptavidin. Biotinylated IgG and Oligonucleotide Preparation. Immunoglobulin G (IgG) was used as a model protein target molecule. Pooled bovine IgG was obtained from Sigma (St. Louis, MO) and dissolved at 15 mg/mL in pH 7.6 PBS (20 mM phosphate, 5 mM sodium chloride). To 800 µL of this solution was added 20 µL of 9 mg/mL NHS-LC-biotin (Pierce) in DMF. Following incubation on ice for 10 min, the reaction was quenched by the addition of 100 µL 100 mM pH 7.6 Tris buffer. The reaction mixture was then dialyzed overnight across a 10,000 molecular weight cutoff (MWCO) membrane into pH 7.6 PBS, with one buffer exchange. This biotinylated IgG was then fluorescently labeled with Texas Red C2 maleimide (Molecular Probes, Eugene OR), a thiolreactive label. The IgG solution was concentrated to 400 µL, and 40 µL of 20 mM tris(2-carboxyethyl) phosphine hydrochloride (TCEP-HCl, Pierce) solution was added to reduce disufides. To this solution was added 40 µL of 30 mg/mL Texas Red C2 maleimide in DMSO. This reaction mixture was rotated at 4 °C for 4 h and then dialyzed across a 10 000 MWCO membrane into pH 7.6 PBS for 48 h, with two buffer exchanges. Biotinylated, fluorescently labeled oligonucleotide was obtained directly from Integrated DNA Technologies (IDT, Coralville, IA). The single-stranded oligonucleotide had the sequence GGACTCAGGCTTATAGCTGT and contained a 5′ fluorescein modification and a 3′ biotin modification (with a tri-(ethylene glycol) spacer). Analysis of Conjugation Products. The conjugation products were assayed spectrophotometrically using a Hewlett-Packard model 8452A spectrophotometer (HP, Cupertino, CA). To determine the degree of biotinylation of the IgG-biotin conjugate, the 2-(4′-hydroxyazobenzene) benzoic acid (HABA) assay (27) was used. IgG concentration was monitored based on the optical density of the IgG solution at 280 nm, using an extinction coefficient of 210 000 cm-1 M-1. The fluorophore-labeling ratio for the IgG species was determined by measuring the optical density of the solution at 582 nm (the excitation maximum of Texas Red), using an extinction coefficient of 112 000 cm-1 M-1. PNIPAAm-streptavidin conjugation yield was determined by monitoring the optical density of the product solution at 280 nm, based on a streptavidin extinction coefficient of 139 000 cm-1 M-1 for the tetramer. Separation and Recovery of IgG Target. Biotinylated, fluorescently labeled IgG (120 nM) was incubated with a 35× molar excess (based on tetramer concentration) of either S45A-PNIPAAm conjugate or WTPNIPAAm conjugate in 500 µL of pH 7.6 PBS with 20 mM phosphate and 5 mM sodium chloride. To these IgG/ streptavidin-PNIPAAm solutions were added bovine

Mutant Streptavidin−Smart Polymer Conjugate

serum albumin (BSA, Sigma) at 13 µM to block nonspecific interactions and unconjugated 11 kDa PNIPAAm at 30 µM to aid thermoprecipitation. The initial fluorescence of each solution was measured, and thermoprecipitation was performed in triplicate at 37 °C, as described above, with free PNIPAAm (to a concentration of 30 µM) added to the supernatant after each centrifugation. The pellets were resolubilized in PBS and pooled such that the total volume of the pooled pellet solution was equal to the initial sample volume. BSA was added to each resolubilized pooled pellet solution to a concentration of 13 µM. The fluorescence of the pooled resolubilized pellet solution was measured and a 25× molar excess (relative to streptavidin binding sites) of free biotin (Sigma) was added. After incubating this solution at room temperature for 20 min, the thermoprecipitation process was repeated, and the fluorescence of the resulting pooled pellet solution was measured. To this resolubilized pellet solution was added a 25× molar excess of free biotin, and the solution was then incubated at room temperature overnight. Following this incubation, the thermoprecipitation process was repeated a final time, and the fluorescence of the resulting pooled pellet solution was measured. Controls for this experiment included samples containing unconjugated streptavidin rather that streptavidin-PNIPAAm conjugate, samples containing free PNIPAAm but no streptavidin-PNIPAAm conjugate, samples containing neither streptavidin nor PNIPAAm, and samples to which no free biotin was added. All experiments were performed in triplicate. Fluorescence measurements were taken with a Hitachi F-4500 fluorescence spectrophotomer (Hitachi Instruments, Inc., Tokyo, Japan). Separation and Recovery of Oligonucleotide Target. Experiments investigating the separation of the biotinylated oligonucleotide target via the streptavidinPNIPAAm conjugates were performed in the same manner as the experiments investigating the separation of biotinylated IgG, with the following exceptions. Samples were prepared in 250 µL pH 7.6 PBS with 20 mM phosphate and 100 mM sodium chloride. Samples contained a 120 nM concentration of biotinylated, fluorescently labeled oligonucleotide rather than IgG. In addition, samples that were thermoprecipitated at 28 °C contained 250 mM ammonium sulfate, which served to depress the LCST of PNIPAAm. Component concentrations were otherwise as described above. Thermoprecipitations were performed as described above, at either 37 or 28 °C. Biotin additions were as described above, maintaining a molar ratio of 25× excess free biotin relative to available biotin-binding sites. Controls were similar to those described above. Fluorescence measurements for these experiments were performed on a PerkinElmer LS50B fluorescence spectrophotomer (PerkinElmer Instruments, Inc., Shelton, CT). RESULTS AND DISCUSSION

Characterization of Conjugation Products. The HABA assay of the IgG-biotin conjugate revealed an average of 1.5 biotin groups per IgG molecule and the ratio of IgG dye labeling was similar. For the complete streptavidin-PNIPAAm conjugation procedure (four reaction cycles), the overall yield of conjugate was approximately 20%. Similar results were observed for WT and S45A streptavidin. The low yield is likely due to the relative inaccessibility of primary amines on the surface of the streptavidin molecule, as well as hydrolysis of NHS groups during polymer storage.

Bioconjugate Chem., Vol. 14, No. 3, 2003 577

Figure 2. Data for thermoprecipitation and recovery of biotinylated IgG via WT streptavidin-PNIPAAm conjugate. Data are shown for the sample containing 120 nM biotinylated IgG and 4.2 µM thermosensitive streptavidin-polymer conjugate in 500 µL pH 7.6 PBS (labeled “Test”), as well as for four control samples. All data points describe the amount of fluorescence measured in a pellet formed by thermoprecipitation at 37 °C, normalized to the fluorescence measured in the sample prior to any thermoprecipitation. This fraction of initial fluorescence contained in the precipitate is shown for each sample at three points: after an initial thermoprecipitation; after a thermoprecipitation that followed a 20 min incubation with excess free biotin; and after a thermoprecipitation that followed an overnight incubation with excess free biotin. The exception to this is the “no biotin” control, to which no free biotin was added at any point; the three points shown for this sample are from three thermoprecipitations timed similarly to those for the other samples. Error bars are ( 1 standard deviation over three experiments.

Thermoprecipitation and Release of Biotinylated IgG. Figure 2 shows the results of a separation/release experiment with biotinylated IgG and WT-PNIPAAm conjugate. The data shown are the fluorescent intensities of the resolubilized pellets at three points in the experimentsafter an initial thermoprecipitation, after a thermoprecipitation which followed a 20 min incubation with biotin, and after a thermoprecipitation which followed an overnight incubation with biotinsnormalized to the initial fluorescent intensity. The three bars corresponding to the experiment as described are on the far left. Also shown are data corresponding to the following controls: no biotin added in the release steps, no polymer present (only unconjugated streptavidin present), no streptavidin present (only unconjugated polymer present), and neither polymer nor streptavidin present. Error bars are plus and minus one standard deviation over a series of three experiments. Except for a small coprecipitation effect evident with the unconjugated polymer, there was no nonspecific IgG thermoprecipitation observed in the control experiments. The WT-PNIPAAm conjugate was an effective thermoprecipitation agent, capable of separating all initially present biotinylated IgG. Release, however, was not effective. Even after overnight incubation with free biotin, only about 10-20% of the fluorescence was freed from the conjugate. This negligible release effect was comparable to the control in which free biotin has not been added. These results can be contrasted to the excellent reversibility observed for biotinylated IgG and the S45APNIPAAm conjugate, shown in Figure 3. The S45APNIPAAm conjugate proved to be as effective a thermoprecipitation agent as the WT-PNIPAAm complex. However, it did release biotinylated IgG upon treatment with free biotin. 50-60% of the initially precipitated fluorescence was freed after 20 min incubation at 20 °C with biotin and 70-80% of this fluorescence was freed after overnight incubation with biotin. This release effect was not seen in the biotin-free control. Even after overnight incubation with free biotin, some biotinylated

578 Bioconjugate Chem., Vol. 14, No. 3, 2003

Figure 3. Thermoprecipitation and recovery of biotinylated IgG via S45A streptavidin-PNIPAAm conjugate. Samples are as described for Figure 2.

Figure 4. Thermoprecipitation and recovery of biotinylated oligonucleotide via S45A streptavidin-PNIPAAm conjugate at 37 °C. Data are shown for the sample containing 120 nM biotinylated oligonucleotide and 4.2 µM thermosensitive streptavidin-polymer conjugate in 250 µL of pH 7.6 PBS (labeled “Test”), as well as for four control samples. All data points describe the amount of fluorescence measured in a pellet formed by thermoprecipitation at 37 °C, normalized to the fluorescence measured in the sample prior to any thermoprecipitation. Data are organized as in Figure 2.

IgG remained bound to the S45A-PNIPAAm conjugate. This residually bound IgG might be explained by the fact that the IgG population contained some multiply biotinylated protein molecules. If multiple biotin moieties on a single IgG molecule bind to the same streptavidin molecule, an avidity effect is expected. It has been shown (28) that high off-rate streptavidin mutant molecules interacting with a biotinylated surface demonstrate a radically decreased apparent off-rate when allowed to bind bivalently. In the context of these thermoprecipitation experiments, this decreased off-rate was observed as a population of multiply biotinylated IgG molecules that did not dissociate from the S45A-PNIPAAm complex in the same time frame as the majority of the biotinylated IgG. Thermoprecipitation and Release of a Biotinylated Oligonucleotide. To control for this effect, separation and release were investigated for a molecule containing only a single biotin moietysa biotinylated oligonucleotide. The data for separation and release of the oligonucleotide target via the S45A-PNIPAAm conjugate at 37 °C are shown in Figure 4. There are two important features apparent in these data. The release of the biotinylated target after treatment with free biotin was rapid and nearly total, and a much smaller fraction of the initially present target molecule was precipitated than in the case of biotinylated IgG. The complete release demonstrates that a singly biotinylated molecule is not retained by the high off-rate conjugate in the presence of excess free biotin. The smaller fraction of initially precipitated oligonucleotide is indicative of a decrease in the equilibrium affinity of the S45A-PNIPAAm conju-

Malmstadt et al.

Figure 5. Thermoprecipitation and recovery of biotinylated oligonucleotide via S45A streptavidin-PNIPAAm conjugate at 28 °C. Data are shown for the sample containing 120 nM biotinylated oligonucleotide and 4.2 µM thermosensitive streptavidin-polymer conjugate in 250 µL of pH 7.6 PBS with 250 mM ammonium sulfate (labeled “Test”), as well as for four control samples. All data points describe the amount of fluorescence measured in a pellet formed by thermoprecipitation at 28 °C, normalized to the fluorescence measured in the sample prior to any thermoprecipitation. Data are organized as in Figure 2.

gate for biotinylated oligonucleotide relative to that for biotinylated IgG. This is further indicated by the data for the biotin-free control (second cluster of bars from the left, Figure 4), which show only a fraction of the initially precipitated oligonucleotide being captured in the second precipitation. This is consistent with a reequilibration of the streptavidin-biotin binding, at a lower-than-expected affinity, following the initial precipitation and removal of the unbound oligonucleotide in the supernatant. The affinity of biotinylated target will be dependent on the specific type of linker and connecting regions. This is an interesting demonstration of the fact that not all biotinylated targets bind at the same high-affinity, and this represents a challenge to the use of streptavidin or avidin affinity mutants. To improve the separation of biotinylated oligonucleotide, the separation experiments were repeated at a lower temperature (28 °C), in the presence of a moderate concentration of ammonium sulfate, which lowers the LCST of PNIPAAm. Figure 5 shows the data for thermoprecipitation and recovery of a biotinylated oligonucleotide 20-mer via S45A-PNIPAAm conjugate at 28 °C. The fraction of biotin-DNA initially precipitated is higher than at 37 °C, and the biotin-free sample remains bound to a much higher fraction of biotin-DNA throughout the experiment. This indicates that the increase in the biotin-S45A affinity (and decrease in off rate) between 37 °C and 28 °C is large enough to significantly impact the utility of S45A as an affinity ligand. This is expected, given the strong temperature dependence of S45A biotin affinity and off-rate (12). The data for the S45A conjugate can be compared with those for the WT-PNIPAAm conjugate and biotinylated DNA (Figure 6). These data are similar to those for the experiments with WTPNIPAAm and biotinylated IgG, revealing nearly complete and specific thermoprecipitation and no recovery in response to treatment with free biotin. The measured Ka for S45A streptavidin at 37 °C is 4.9 × 109 M-1 (12). At the concentrations of streptavidin and biotinylated DNA used in these experiments, over 99.99% of the biotinylated oligonucleotide originally present in solution should be bound to streptavidin-PNIPAAm conjugate molecules at equilibrium. In order for the binding fraction to decrease to 50% as observed, the Ka of the interaction must decrease by over four orders of magnititude. Since a shift in affinity is observable in the oligonucleotide separation experiments, but not in the IgG separation experiments, this effect is specific to the

Mutant Streptavidin−Smart Polymer Conjugate

Figure 6. Thermoprecipitation and recovery of biotinylated oligonucleotide via WT streptavidin-PNIPAAm conjugate at 28 °C. Samples are as described for Figure 5.

biotinylated oligonucleotide. Similar decreases in the affinity of the biotin-streptavidin system have been observed for various chemical modifications to the biotin tail (29); it is conceivable therefore that the conjugation of an oligonucleotide to biotin would decrease the affinity of the system. A 4-order magnitude decrease in the affinity of WT streptavidin for biotinylated oligonucleotide would not be expected to have as drastic an impact in these experiments, since the affinity of WT for unmodified biotin is nearly 4 orders of magnitude greater than that of S45A. The observed fraction of biotinylated oligonucleotide thermoprecipitated by the WT-PNIPAAm conjugate is therefore consistent with a general large decrease in the affinity of streptavidin for biotin conjugated to an oligonucleotide. CONCLUSIONS

We have demonstrated an affinity precipitation system in which the replacement of WT streptavidin with a high off-rate streptavidin mutant allows for the triggered release of biotinylated macromolecules from the smart polymer affinity precipitation agent. This release is a demonstration of the reversibility that high off-rate streptavidin mutants can impart to systems relying on the biotin-streptavidin interaction. The system developed here also demonstrates some potential pitfalls of relying on high off-rate streptavidin mutants. Binding to multiply biotinylated molecules can partially eliminate the reversibility of the system, and unexpected decreases in the off-rate due to biotin modification can have drastic effects since the baseline off-rate is already unusually high. However, the techniques presented here open a range of new possibilities for biotin-streptavidin technology and demonstrate the power of coupling protein engineering and smart polymer technologies to develop novel conjugate molecules with highly specified properties. ACKNOWLEDGMENT

The NIH (Grant No.53771 and Grant No. DKY9655), the UW Office of Technology Licensing, the Washington Research Foundation, and the Washington Technology Center are gratefully acknowledged for their support of this project. LITERATURE CITED (1) Chaliet, L., Miller, F. W., Tausig, F., and Wolf, F. J. (1963) Antibiotic MSD-235. 2. Separation and purification of synergistic components. Antimicrob. Agents Chemother. 3, 2832. (2) Green, N. M. (1975) Avidin. Adv. Protein Chem. 29, 85133.

Bioconjugate Chem., Vol. 14, No. 3, 2003 579 (3) Green, N. M. (1990) Avidin and streptavidin. Methods Enzymol. 184, 51-67. (4) Green, N. M. (1963) Avidin: 1. The Use of [14C]biotin for kinetic studies and for assay. Biochem. J. 89, 585-591. (5) Diamandis, E. P., and Christopoulos, T. K. (1991) The biotin (strept)avidin system - principles and applications in biotechnology. Clin. Chem. 37, 625-636. (6) Wilchek, M., and Bayer, E. A. (1990) Applications of avidinbiotin technology: literature survey. Methods Enzymol. 184, 14-45. (7) Chilkoti, A., and Stayton, P. S. (1995) Molecular-origins of the slow streptavidin-biotin dissociation kinetics. J. Am. Chem. Soc. 117, 10622-10628. (8) Piran, U., and Riordan, W. J. (1990) Dissociation rate constant of the biotin-streptavidin complex. J. Immunol. Methods. 133, 141-143. (9) Chilkoti, A., Schwartz, B. L., Smith, R. D., Long, C. J., and Stayton, P. S. (1995) Engineered chimeric streptavidin tetramers as novel tools for bioseparations and drug-delivery. Biotechnology 13, 1198-1204. (10) Qureshi, M. H., Yeung, J. C., Wu, S. C., and Wong, S. L. (2001) Development and characterization of a series of soluble tetrameric and monomeric streptavidin muteins with differential biotin binding affinities. J. Biol. Chem. 276, 4642246428. (11) Reznik, G. O., Vajda, S., Sano, T., and Cantor, C. R. (1998) A streptavidin mutant with altered ligand-binding specificity. Proc. Nat. Acad. Sci. U.S.A. 95, 13525-13530. (12) Hyre, D. E., Le Trong, I., Freitag, S., Stenkamp, R. E., and Stayton, P. S. (2000) Ser45 plays an important role in managing both the equilibrium and transition state energetics of the streptavidin-biotin system. Protein Sci. 9, 878885. (13) Eggert, M., Baltes, T., Garret-Flaudy, F., and Freitag, R. (1998) Affinity precipitation - an alternative to fluidized bed adsorption? J. Chrom. A. 827, 269-280. (14) Luong, J. H. T., and Nguyen, A.-L. (1992) Novel separations based on affinity interactions. In Bioseparation (Tsao GT, Belfort G, Eds.) pp 137-158, Springer-Verlag, Berlin. (15) Niederauer, M. Q., and Glatz, C. E. (1992) Selective Precipitation. In Bioseparation (Tsao GT, Belfort G, Eds.) pp 159-188, Springer-Verlag, Berlin. (16) Monji, N., and Hoffman, A. S. (1987) A novel immunoassay system and bioseparation process based on thermal phase separating polymers. Appl. Biochem. Biotech. 14, 107-120. (17) Chen, J. P., and Hoffman, A. S. (1990) Protein conjugates 2. Affinity precipitation of human immuno-gamma-globulin by a poly(N-isopropylacrylamide)-protein-A conjugate. Biomaterials 11, 631-634. (18) Anastase-Ravion, S., Ding, Z., Pelle, A., Hoffman, A. S., and Letourneur, D. (2001) New antibody purification procedure using a thermally responsive poly(N-isopropylacrylamide)-dextran derivative conjugate. J. Chromatogr., B 761, 247-254. (19) Fong, R. B., Ding, Z. L., Long, C. J., Hoffman, A. S., and Stayton, P. S. (1999) Thermoprecipitation of streptavidin via oligonucleotide-mediated self-assembly with poly (N-isopropylacrylamide). Bioconj. Chem. 10, 720-725. (20) Hoffman, A. S., Stayton, P. S., Bulmus, V., Chen, G. H., Chen, J. P., Cheung, C., et al. (2000) Really smart bioconjugates of smart polymers and receptor proteins. J. Biomed. Mater. Res 52, 577-586. (21) Heskins, M., and Guillet, J. E. (1968) Solution properties of poly(N-isopropylacrylamide). J. Macromol. Sci.-Chem. A2, 1441-1455. (22) Hoffman, A. S., and Monji, N. (1987) A novel immunoassay system and bioseparation process based on thermal phase separating polymers. App. Biochem. Biotech. 14, 107-120. (23) Takei, Y., Aoki, T., Sanui, K., Ogata, N., Okano, T., and Sakurai, Y. (1993) Temperature-responsive bioconjugates. 1. Synthesis of temperature-responsive oligomers with reactive end groups and their coupling to biomolecules. Bioconjate Chem. 4, 42-46. (24) Ding, Z. L., Chen, G. H., and Hoffman, A. S. (1996)

580 Bioconjugate Chem., Vol. 14, No. 3, 2003 Synthesis and purification of thermally sensitive oligomerenzyme conjugates of poly(N-isopropylacrylamide)-trypsin. Bioconjate Chem. 7, 121-125. (25) Chilkoti, A., Tan, P. H., and Stayton, P. S. (1995) Sitedirected mutagenesis studies of the high-affinity streptavidin-biotin complexscontributions of tryptophan residue-79, residue-108, and residue-120. Proc. Nat. Acad. Sci. U.S.A. 92, 1754-1758. (26) Heney, G., and Orr, G. A. (1981) The purification of avidin and its derivatives on 2-iminobiotin-6-aminohexyl-Sepharose 4B. Anal. Biochem. 114, 92-96. (27) Green, N. M. (1970) Spectrophotometric determination of avidin and biotin. Methods Enzymol., 18, 418.

Malmstadt et al. (28) Perez-Luna, V. H., O’Brien, M. J., Opperman, K. A., Hampton, P. D., Lopez, G. P., Klumb, L. A., et al. (1999) Molecular recognition between genetically engineered streptavidin and surface-bound biotin. J. Am. Chem. Soc. 121, 64696478. (29) Wilbur, D. S., Chyan, M. K., Pathare, P. M., Hamlin, D. K., Frownfelter, M. B., and Kegley, B. B. (2000) Biotin reagents for antibody pretargeting. 4. Selection of biotin conjugates for in vivo application based on their dissociation rate from avidin and streptavidin. Bioconjate Chem. 11, 569-583.

BC020055L