Agarose as

Subscriber access provided by Imperial College London | Library

Article

Three Dimensionally N-doped Graphene-Hydroxyapatite/Agarose as an Osteoinductive Scaffold for Enhancing Bone Regeneration Fenglei Gao, Jianjun Luo, Xing Zhang, Jeremiah Ong’achwa Machuki, Chengbai Dai, Yang Li, and Kaijin Guo ACS Appl. Bio Mater., Just Accepted Manuscript • DOI: 10.1021/acsabm.8b00599 • Publication Date (Web): 07 Dec 2018 Downloaded from http://pubs.acs.org on December 8, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Bio Materials

Three Dimensionally N-doped Graphene-Hydroxyapatite/Agarose as an Osteoinductive Scaffold for Enhancing Bone Regeneration Jianjun Luoa,b,1, Xing Zhanga,b,1, Jeremiah Ong’achwa Machukia, Chengbai Daia,b, Yang Lia,b, Kaijin Guob,*, and Fenglei Gaoa,b,* a. Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, School of Pharmacy, Xuzhou Medical University, 221004, Xuzhou, China. b. Department of Orthopedics, Affiliated Hospital of Xuzhou Medical University, 99 Huaihai Road, Xuzhou 221002, Jiangsu, China.

______________________________ *Corresponding

author. Tel./Fax: +86-516-83262138.

Email: [email protected] (F. Gao), [email protected] (K. Guo). 1

ACS Paragon Plus Environment

ACS Applied Bio Materials 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract Composite biomaterials with hierarchical structures have emerged as new approaches for bone tissue engineering. In this study, a biomimetic, osteoconductive tri-composite scaffold made of N-doped graphene-hydroxyapatite (NG-HA) hybrids blended with agarose (AG) matrix was prepared via a facile hydrothermal/cross-linking/freezedrying method. The structure and composition of AG/NG-HA were examined by SEM, XPS, XRD, FTIR, Raman and TGA. The as-prepared scaffolds showed hierarchical pore architecture and an organic-inorganic composition, which simulated the composition and structure of natural bone tissue. The effect of AG/NG-HA on bone mesenchymal stem cells (MSCs) osteoblast proliferation, differentiation and mineralization was tested in vitro. The expression of osteogenic-related genes was determined by RT-PCR. Our results showed that introduction of N-graphene into the hybrid scaffold significantly improved its mechanical properties, an effect that promoted the proliferation and viability of MSCs. Moreover, the scaffolds triggered selective differentiation of MSCs to osteogenic lineage, while conferring good cell adhesion, enhanced alkaline phosphatase activity and mineralization. A distal femoral condyle critical size defect in rabbit was used as a platform to confirm the effect of AG/NG-HA on bone regeneration in vivo. Our experiments show that the AG/NG-HA hybrid scaffolds provided a favorable environment for new bone formation. The results presented in this study suggest that the AG/NG-HA hybrid scaffolds have the potential in bone tissue regeneration engineering.

Keywords: agarose; bone tissue engineering; N-doped graphene; hydroxyapatite.

2


Page 2 of 54

Page 3 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. Introduction Bone tissue engineering is a growing interdisciplinary field that combines the basic principles and techniques of material science, biology, and manufacturing, with the intention of designing various biologically compliant materials that promote the regeneration of damaged bones1-4. Therapies based on implantation of artificial scaffolds to repair bone defects is a segment of bone tissue engineering that has shown high therapeutic value as it meets the criteria of promoting osteogenesis of damaged bone. An ideal scaffold should be analogous to the natural bone and should provide a favorable microenvironment for cell growth5-6. Thus, the composition and structure of tissue engineering scaffolds should be intentionally designed to mimic the natural bone. Moreover, the scaffold should present high biocompatibility and good mechanical properties. The natural bone is composed of organic matter, mainly enriched with collagen, and hydroxyapatite (HA) crystals derived from inorganic substances7-8. In order to imitate the composition of natural bone, emerging material technologies have been used to create organic-inorganic composite materials for bone tissue engineering. Therefore, the right macromolecules are selected as the organic substrates and HA as the inorganic phase, and mixed in appropriate proportions to mimic the organic-inorganic composition of bone tissue. For example, biocompatible composites have been created by combining the toughness of chitosan and the rigidity of HA using techniques such as simple blending and in-situ precipitation, which have exhibited increased bone 3



regeneration capability9. Agarose (AG) is a natural linear polysaccharide found in marine red algae10. The linearity of its structure is a function of repeated units of alternating 1,3-linked β-Dgalactose and 1,4-linked 3,6-anhydro-α-L-galactose11. It is based on this special structure that AG is capable of forming a thermo reversible gel through physical crosslinking. As compared with chitosan and cellulose-based gels, notable advantages of using agarose are that no chemical catalyst is required nor is any crosslinking agent required for gelation12-13. Furthermore, the stiffness of AG hydrogels is controllable which allows manipulation of the mechanical properties of the scaffold11. Hence, considering its low cost, malleable mechanical properties, good biocompatibility and relatively inert properties, agarose is suitable as an alternative organic matrix14-15. As the main inorganic component in the natural bone matrix, hydroxyapatite (Ca10(PO4)6(OH)2) is a popularly used material in bone tissue engineering16. It exhibits positive osteogenic activity and osteointegration, in addition to its outstanding biocompatibility and biodegradability, and good cell adhesiveness. In humans and vertebrates, HA is enriched in osseous and hard tissues17. When introduced to osteoblast cells, the biological response to HA is dependent on the morphology, particle size, and crystal structure of HA. Nano-HA closely resembles the HA crystals of natural bone, thereby providing faster bone regeneration18. Also, nano-HA can be conjugated with organic polymers to form an organic-inorganic composite19. Many techniques have been used to create composites including electrospinning20, co-precipitation21, an 4


Page 4 of 54

Page 5 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


alternate soaking process22, and sol–gel casting23. However, these methods have the limitations of not being able to form nano-sized HA deposits in the composite, and some of the HA are not uniformly dispersed in the composite. Thus, new strategies are required to optimize the preparation of ideal organic-inorganic composite scaffolds. In this study, to achieve a uniform dispersion of nano-sized synthetic HA particles in the organic matrix, N-doped graphene (NG) was chosen as the supportive molecule for HA and as the reinforcement fillers for the composite scaffold. NG is a graphene derivative that is now widely used in biomedical applications due to its unique characteristics including large surface-volume ratio, roughness of its surfaces and edges, excellent water solubility, low toxicity and higher biocompatibility compared with pristine graphene24-25. The unique mechanical properties of NG were found to enhance the physical properties of composites 26. Many studies had shown that the graphene and graphene-based composites are suitable for bone tissue engineering because of their toxicity to human osteoblasts27-28. For instance, Wang et al. biomineralized carboxylated graphene oxide (GO) with HA crystals in simulated body fluid, then blended it with tussah silk fibroin (SF). They found that the resultant scaffolds promoted the proliferation and osteogenic differentiation of mouse bone marrow mesenchymal stem cells8. It has also been shown that NG exhibits higher cell adhesion strength, viability, proliferation and stretching as compared to graphene oxide25. Ideal biomimetic scaffolds for bone tissue engineering are designed to have a porous 5



structure29. The porosity and pore size of three-dimensional scaffolds directly influence the function of scaffolds in biomedical applications. Porosity and three-dimensionality are the basic requirements for tissue engineering scaffolds to accurately simulate the bone matrix, and to provide a suitable microenvironment for bone cell adhesion and proliferation, which guides and promotes new tissue formation30. In addition, high porosity facilitates effective release of bio-factors such as proteins, genes or cells, and provides a good platform for nutrient exchange29. A recent study synthesized 3D porous structure freeze-dried gelatin/laponite hybrids, which demonstrated that the porosity of scaffolds plays an important role in host cell migration and cell distribution in the structure31. Here, we synthesized a novel hierarchical porous AG/NG-HA nanocomposite scaffold by two freeze-drying processes. Firstly, NG and HA were combined followed by formation of small pores through hydro-thermal synthesis and freeze-drying. Then, the nano-composite NG-HA was blended with AG by a simple solvent blending method and then subjected to freezedrying. At the end of the freeze-drying process, large pores with irregular shapes were formed. The morphology and properties of the prepared AG/NG-HA nano-composite were characterized by TEM, SEM, XRD, XPS, Raman, TG and other techniques. Also, the bioactivity of AG/NG-HA scaffold was investigated through cell experiments. The osteoinductive potential of the scaffold was also investigated. At last, the capacity of the material to repair a bone defect in vivo was evaluated using a femoral condyle defect in rabbits. The findings of our study showed that the AG/NG-HA hybrids provides a 6


Page 6 of 54

Page 7 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


platform which supports bone regeneration and hence are suitable for bone tissue engineering.

2. Materials and Methods 2.1. Materials and Reagents N-doped graphene powders were obtained from Nanjing XFNANO Materials Tech Co., Ltd (Nanjing, China). Calcium nitrate tetra hydrate, diammonium hydrogen phosphate and N, N- Dimethylformamide (DMF) were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Tetracycline hydrochloride, Dexamethasone, ascorbic acid, paraformaldehyde, β-glycerophosphate, agarose (Mw=306.26 kDa, gel strength >600 g/cm2), ammonium hydroxide were supplied by Aladdin Chemical Reagent Co., Ltd. (Shanghai, China). 3-(4, 5-dimethylthiazol-2-yl)2, 5 diphenyltetrazolium bromide (MTT), Triton X-100, alkaline phosphatase (ALP) assay kit and BCA Protein assay kit were obtained from Sigma-Aldrich (USA). Alpha Minimum Essential Medium Eagle (α-MEM), fetal bovine serum (FBS), Trypsin– EDTA, penicillin-streptomycin were bought from Gibco (Grand Island, USA). Cell lysis buffer, calcein AM, Live-Dead Cell Staining Kit, 4’, 6-diamidino-2-phenylindole (DAPI), TRIeasy total RNA extraction reagent and Prime-ScriptTM RT reagent kit were obtained from Beyotime Institute of Biotechnology (Shanghai, China). 2.2 Characterization TEM (FEI Tecnai G2 Spirit Twin, Holland) was employed to investigate the morphology of NG and NG-HA. SEM (FEI Teneo Volume Scope, USA) was used to 7



observe the fracture surface structure of AG and its nano-composites. A Raman microprobe (Rhenishaw Instruments, UK) was used to analyze the NG. The crystalline phases of the CaP coatings were examined by an X-ray diffract tometer (XRD; X’ pert PRO, Philips, The Netherlands). The composition of the scaffolds was identified by a Fourier transform infrared spectroscopy (FT-IR; Nicolet 5700, Thermo, USA). The thermal stability of the composites was investigated by thermo-gravimetric analysis (TGA) with a thermo-analyzer (NETSCH, Germany). 2.3 Preparation of NG-HA Nano-composites The NG-HA nano-composites were synthesized using a facile hydrothermal method32. First, NG was sonicated for 30 min in water to form an aqueous dispersion of NG (20 mL of a 1 mg mL−1 solution). Then, 0.5 mM Ca (NO3)2.4H2O was added into the NG suspension, and the solution was mixed with a magnetic rotor at 300 rpm/min to produce a uniform solution. Meanwhile, 30 mL of 0.3 mM (NH4)2HPO4 dissolved in water was added dropwise into the above solution. The ammonium hydroxide solution was used to adjust the pH value of the solution to 10.5. The mixture was stirred for 30 min at 500rpm/min, and then poured into a hydrothermal reaction kettle and heated at 180 ℃ for 12 h. Finally, the reaction products were collected by centrifugation, washed repeatedly with deionized water and ethanol. The final products were freeze-dried, then dried in a vacuum oven at 80 ℃ overnight before further characterization. The resultant NG-HA contained 20 wt.% NG. To validate the design, we prepared two control groups with 10 wt.% NG content and 40 wt.% NG content by adjusting the amount of NG 8


Page 8 of 54

Page 9 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


using the same method. 2.4 Preparation of AG/NG-HA Nano-composites The composite scaffolds were prepared by a simple solvent blending method, followed by creation of a 3D network by the lyophilization method. Briefly, the AG (0.5 g) was dissolved in ultra-purified water (50 mL) at 93 °C and under intense agitation. At the same time, 0.1 g NG-HA were dispersed in 2 mL DMF with the assistance of ultrasound, followed by strong mechanical stirring for several hours until a homogeneous suspension was obtained. Subsequently, the resultant homogeneous suspension was gradually added into 10 mL agarose solution while stirring. Finally, the AG/NG-HA mixture solution was poured into a mold and freeze-dried when the gel was formed. 2.5 Mechanical Properties and Porosity Test To study the mechanical properties and porosity of the scaffold, we fabricated the samples into cylinders, with a diameter of 6 mm and a height of about 10 mm. The compressive strength of the samples was measured by a universal material tester at room temperature. Each sample was tested at least three times. Also, water immersion was employed to study the porosity of the scaffolds. The volume of the cylinder was set as V1, and the weight as M1. Then, the cylinder was soaked in water in a vacuum oven for 12 h, and then the weight was measured as M2. The scaffold porosity was calculated by the following formula. Scaffold porosity = [(𝑀2 ― 𝑀1)/𝜌𝑤𝑎𝑡𝑒𝑟 ]/V1 × 100% where 𝜌𝑤𝑎𝑡𝑒𝑟 represents the water density (1 g/cm3). 9



2.6 Cell Culture In this study, rat (SD) MSC cells purchased from Key Laboratory of Stem Cell Biology Shanghai Institutes for Biological Sciences Chinese Academy of Sciences, were used as the culture model. Herein, rat (SD) MSC cells were cultured in α-MEM which containing 10% FBS (Gibco, USA), 1% penicillin/streptomycin (Gibco, USA) and 1% L-glutamine in a 5% CO2 incubator at 37 °C. The medium was replaced every two days. The cells were then planted on the scaffold after being digested by trypsin. 2.7 Cell Adhesion and Morphology The scaffold was first cut into sections with a diameter of 10 mm and a thickness of 2 mm disc, which were then fixed with a stainless-steel wire. The sterilized scaffold was then put in a 48-well culture plate. For the adhesion test, cells were seeded at a density of 5×104 cells/well. After culturing for 1, 3, 5 and 7 days, the scaffolds were washed with PBS 3 times, and the adherent cells were obtained from the scaffold by addition of 1 mL 0.25% Trypsin-EDTA solution. To assess the adhesion efficiency, a cell counter was used to count the separated cells. For fluorescent staining, 300 μL 500 nM calcein AM dissolved in a growth medium solution were added to each well and then incubated for 1 h. The live cells were visualized by a fluorescence microscope (Olympus, Japan). The morphology of cells obtained from the scaffold was examined by confocal laser scanning microscope (CLSM) and SEM. After incubation for 7 days, cell-seeded on the scaffolds were fixed in 4% paraformaldehyde for 12 min and permeabilized with 0.1% 10


Page 10 of 54

Page 11 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Triton X-100 for additional 5 min. To reduce the background noise, the samples were then blocked with 1% bovine serum albumin for 30 min. Finally, they were stained with Fluorescein isothiocyanate-labeled Phalloidin and DAPI for 30 min and 5 min, respectively. The cells/scaffolds were examined by a laser scanning microscope (FV10i, Olympus, Japan). To perform SEM scanning on the cell morphology on the scaffolds, 4% glutaraldehyde was used to fix the cells cultured on AG/NG-HA composites 12 h at about 4 ℃. Subsequently, the treated cells were dehydrated, washed with PBS, and then dehydrated step by step with graded ethanol series (30, 50, 70, 90, 95, and 100 vol %). After dehydration, the sample was soaked in tert-butanol for 30 min. Finally, the samples were freeze-dried overnight before SEM observation. 2.8 The Biocompatibility and Cell Proliferation Tests To evaluate the biocompatibility of the scaffold, the MTT assay was performed. Briefly, 5000 cells were seeded on each well of a 96-well plate. This was followed by addition of the freeze-dried AG/NG-HA scaffold materials at the indicated concentrations (from 12.5 µg/mL to 125 µg/mL) into the cell culture. After a 24 h incubation, cells were washed and 50 µL of MTT solution was added to each well, followed by a 4 h incubation in a CO2 incubator in darkness. Then, the un-reacted dye was removed, and the intracellular insoluble purple formazan1 was dissolved by addition of 50 µL of DMSO. Finally, the absorbance at 570 nm was measured using a Bio-Rad 680 micro-plate reader (USA) to determine the relative cell viability based on the amount of MTT converted into formazan salt. The cells were planted on the scaffold 11



at a density of 5,000 cells per well, and then the proliferation capacity of the cells on the scaffold was tested in the same manner as the adhesion experiment at 1, 3, 5 and 7 days after implantation. All tests were performed in three parallel groups. 2.9 Alkaline Phosphatase Activity Alkaline phosphatase activity was used to evaluate early bone differentiation ability of rat (SD) MSC cells grown on the composite scaffold. Composite scaffolds were placed in 24-well plates, and then 2 × 104 cells were seeded in each well. The alkaline phosphatase activity was determined by a commercial kit (Jiancheng Bioengineering Institute, Nanjing, China) on day 3, 7 and 14. At each time-point, PBS was used to rinse the cell-seeded disks 3 times, followed by treatment with RIPA lysis buffer (YEASEN, Shanghai, China) for 2 s. After centrifugation, the supernatant was harvested and the pellet was removed. 50 μL aliquot of the supernatant was added to each well of a 96well plate, followed by 50 μL assay buffer and 50 μL p-nitrophenyl phosphate (pNPP) solution. After incubation for 30 min in a 37℃ incubator, 100 μL of termination buffer was added to the sample, and the absorbance was measured using an enzyme marker at 405nm. 2.10 Calcium Depositions Rat (SD) MSC were cultured on the scaffold with an osteogenic medium for 14 and 21 days. Thereafter, the deposition of calcium in form of nodules was observed after staining with tetracycline hydrochloride and alizarin red S. Briefly, 100 mg/mL tetracycline hydrochloride were added to the scaffold and incubated for 1 h. Next, the 12


Page 12 of 54

Page 13 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


appearance of calcium deposits as a yellow fluorescence was measured at 480 nm using CLSM. When stained with alizarin red S (sodium alizarin sulphonate), the mineralized nodules appeared as red spots under the microscope. The procedure for alizarin red S staining was as follows. First, the cells on the scaffolds were put on a glass slide and then fixed in 4% paraformaldehyde for 15 min. The cells were then washed and stained for 8 min. Finally, the residual dye was removed with distilled water. 2.11 Expression of Osteogenic Genes Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR, 7500, Applied Biosystems, Foster City, CA) was used to measure the osteogenic gene expression in the rat (SD) MSC grown on the AG/NG-HA scaffold. After incubation of rat (SD) MSC on AG and AG/NG-HA scaffolds for 0, 3, 7, and 14 days, total RNA was extracted and purified using TRIeasy reagent (Bioteke, Beijing). Its concentration was determined by NanoDrop 2000 c (Thermo Fisher Scientific Inc. U.S.A.). The RNA was then reverse-transcribed into single-stranded cDNA using a Prime-ScriptTM RT reagent kit according to the manufacturer’s instruction. The PrimeScriptTM Rtase has excellent extensibility, allowing rapid cDNA template synthesis. Oligonucleotide primers used in the PCR are listed in Table 1. RT-PCR was performed using a LightCycler480 II instrument with a 96-well plate. The 2-△△Ct method

33

was used to

calculate the relative expression of each target gene. The Ct values of the target genes were normalized to the housekeeping gene, GAPDH and then used to calculate the DCt values. The DCt values of rat (SD) MSC cultured on AG scaffold in the osteogenic 13



medium for 0, 3, 7 and 14 days served as the control group. Table 1 Primer sequences used for PCR amplification. Gene

Primer sequence (forward/reverse)

OCN

5'ACCATCTTTCTGCTCACTCTGCT3'(F) 5'CCTTATTGCCCTCCTGCTTG3'(R)

OPN

5'AGCCATGAGTCAAGTCAGCT3'(F) 5'ACTCGCCTGACTGTCGATAG3'(R)

RunX2

5'CGCCTCACAAACAACCACAG3'(F) 5'TCACTGTGCTGAAGAGGCTG3'(R)

COL-IA1

5'ATGGATTCCAGTTCGAGTAGGC3'(F) 5'CATCGACAGTGACGCTGTAGG3'(R)

GAPDH

5'GAGAGACCCCACTTGCTGCCA3'(F) 5'CTCACACTGCCCCTCCCTGGT3'(R)

2.12 The Capacity of the Scaffolds to Repair Bone Defects All experiments performed in this study conformed to the guidelines for the care and use of experimental animals provided in the approval obtained from the institutional animal care and use committee (IACUC) of Xuzhou Medical University. Before implantation, the composites were adjusted to cylinders with a diameter of 6 mm and a thickness of 10 mm. Three-month-old male New Zealand white rabbits were used for this experiment. The bone defect model was created as previously reported with slight modifications to the procedure. Briefly, the bone was exposed through the lateral femur 14


Page 14 of 54

Page 15 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and a 6.0 mm diameter defect was drilled on the lateral femoral condylar platform with an electric drill. The biomaterials were implanted into the defect site and the incision was sutured. Gentamicin was injected subcutaneously to prevent infection. The untreated bone defect group served as the control group. A CT scan was performed 12 weeks after the operation to monitor the bone defect repair progress. After each CT scan, samples were harvested from the surgical sites and fixed in 10% neutral buffered formalin. The specimens were then decalcified in 0.1 M phosphate buffer containing 10 % EDTA for 2 weeks and dehydrated for 12 h with graded series of alcohols. The sections were then stained with Hematoxylin and Eosin (H&E) for routine histological examination. 2.13 Statistical Analysis Statistical significance was measured using one- or two- way analyses of variance (ANOVA) and Tukey's multiple comparison tests with the SPSS software. Differences between groups were considered significant only if the p < 0.05: *indicates p < 0.05, and ** represent p < 0.01. Quantitative data are presented as the means ± standard deviation (SD).

3. Results and Discussion 3.1 Morphology of AG/NG-HA Scaffolds The preparation process of the scaffolds is shown in Scheme 1. First, the nanohydroxyapatite mono-dispersed on the surface of NG nano-sheets throughout the hydrothermal process to form a NG-HA hybrid32. Fig. 1A shows that, structurally, NG 15



appeared as large curved sheets with a diameter of up to several micrometers. When subjected to hydrothermal reaction, the NG exhibited obvious structural changes. As shown in Fig. 1B and Fig. S1B, numerous nano-HA particles were densely attached to the lower surface of the thin sheet. The HA were randomly and uniformly monodispersed on the surface of N-doped graphene. Moreover, during the hydrothermal process, π ― π interactions between NG nano-sheets were enhanced, whereby HA was physically embedded in the NG network25. Notably, the HA were stable within the NG network and could not be easily released. Also, some thin sheets tightly folded together in the network were observed Fig. 1B. Due to the interactions mediated by π ― π and the good mechanical flexibility of N-doped graphene sheets, the aggregation of HA to form large particles was prevented. More importantly, the hydroxyapatites on the surface of N-doped graphene nanosheets can prevent the N-doped graphene nanosheets from aggregating, which is beneficial to the dispersion of N-doped graphene nanosheets in the polymer matrix34. The ratio of NG and HA in the composite affects the structure of NG-HA8. As shown in Fig. S1A, the NG sheets fold together forming a pleat when the proportion of NG is far more than the amount of HA loaded. In contrast, when the proportion of NG is lower than that of HA, the HA aggregates to form large particles (Fig. S1C). Therefore, we found that a proportion of NG of 20 wt% in the designed NG-HA hybrids was more suitable in the final products. Subsequently, a simple solvent blending method was used to blend the NG-HA with agarose, and then poured into a mold and lyophilized. As shown in Fig. 1C1, D1 and 16


Page 16 of 54

Page 17 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


E1, all scaffold samples show a well interconnected porous morphology. As illustrated in Fig. 1C1 and C2, the morphology of neat AG was composed of pores of approximately 80 μm~150 μm with smooth surface walls. Also, the as-prepared NGHA hybrids contained pores. The pores of NG-HA were smaller than those of neat agarose, with diameters in the range of 300 nm~800 nm (Fig. 1D1 and D2). This micro porosity property provides a large surface area for cell-scaffold interactions2. Thus, the final structure of AG/NG-HA showed a hierarchical architecture, with pores interconnected with each other, and surface of the pore walls were rough. Compared with the AG, the pores of the final AG/NG-HA composites were slightly smaller; with diameters of about 80 μm ~100 μm (Fig. 1F1), but these pores were large enough to allow cell adhesion and bone growth. The pores with large diameters formed in AG/NG-HA are in the suitable pore size range of 70–300 μm for cell culture and neovascularization35. In the magnified image Fig. 1F2, many small pores were formed, which is consistent with the structure of NG-HA. The hierarchical pores in the scaffolds and the roughness of the pore walls play a critical role in regulating the distribution of MSC cells in the scaffold. 3.2 Compositional Analysis and Mechanical Properties of AG/NG-HA Scaffolds In addition to the morphological characterization, the physical and chemical properties of the dispersed AG/NG-HA composite were measured by FTIR, XRD and thermal analysis. Fig. 2A shows the FT-IR of the as-prepared products. We observed typical peaks of AG around 2922 cm-1, which were ascribed to the stretching vibration 17



of methyl. But two distinct bands which were not found on the agarose spectrum appeared on the FTIR spectra of AG/NG-HA nanocomposites, the two unique peaks appeared at 2897 and 2953 cm−1. This may be caused by the interaction between NGHA and agarose molecules. During the simple solvent blending process, the organic matrix and inorganic crystallites combined with each other, which changed the environment for C-H, and thus the asymmetric and symmetric stretching vibrations of methylene showed two new bands in the FTIR spectrum10. In the spectra of NG-HA nano-composites, three characteristic bands at 546, 951, and 1101 cm−1 corresponding to PO43− of HA36 were observed. In addition, the absorption band at 1432 cm-1 was assigned to C=N stretching vibrations in NG; these nitrogen molecules in the graphitic network may stimulate cell growth and proliferation25. The peaks at 1618 and 1039 cm-1 were ascribed to C=C stretching mode of the sp2 network and C-O stretching vibration, respectively37-38. In the spectra of AG/NG-HA nano-composites, characteristic bands belonging to NG-HA and AG were observed, which confirmed the formation of the final products. Given the robust structural integration of the NG nanosheets, the chemical composition and chemical oxidation states of AG/NG-HA were significantly altered, as suggested by the XPS microanalysis. As shown in Fig. 2B, the XPS survey spectra of NG showed only N1s, C1s and O1s peaks without any other impurities. In each scaffold material, three strong peaks at 532.0, 401.1, and 286.1 eV were recorded, which were ascribed to O1s, N1s, and C1s, respectively. The XPS spectra of N1s showed three 18


Page 18 of 54

Page 19 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


fitted peaks at 398.5, 399.5 and 401.3 eV, which were associated with the nitrogen in a pyridine-like, pyrrolic-like and quaternary nitrogen, respectively. It turns out that nitrogen atoms in NG exist in the form of pyridine nitrogen. Following the design of NG-HA nanohybrids by HA mineralization, strong Ca-P correlation peaks were observed at 439 eV (Ca 2s) and 133 eV (P2p), indicating that HA crystals were formed on the surface of NG. Notably, due to the amorphous nature of AG, the AG/NG-HA sample showed a similar diffraction pattern to NG/HA, although the intensity of some bands varied. The chemical composition of the three composite scaffolds was further investigated by XRD. The XRD patterns of all samples are shown in Fig. 2C, and the peak at around 2θ = 24° of NG corresponds to the (001) reflection. The Jade Software revealed that the interlayer distance of NG was 0.37 nm39-40. In the NG-HA material, prominent peaks at 25.9° and 32.0° were observed, which corresponded to the (002) and (211) plane reflections of HA hexagonal phase(JCPDS card, 09−0432), reflecting the ultrafine size of HA particles41. In addition, weak diffraction peaks of HA were also observed at 32.3°, 33.1°, 35.6°, 39.9°, and 49.6°, corresponding to the (112), (300), (202), (310), and (213) planes, respectively42. Interestingly, due to the amorphous nature of AG, the AG/NGHA sample showed a similar diffraction pattern to NG-HA, although the intensity of some bands varied. The Raman spectra analysis was performed to determine the properties of graphene molecules. As shown in Fig. 2D, the Raman spectra of NG, NG-HA and AG/NG-HA 19



exhibited two distinct peaks which are commonly observed in all graphitic structures. The peak located at approximately 1350 cm−1 is attributed to D band (originating from the disorder in aromatic structure or graphene edges), and the peak at 1585 cm−1 to the G band (due to the in-plane vibration of the sp2 carbon atoms)24. Compared with GO (0.80), the ratio of D-band to G-band in NG (0.97) was increased, which indicates that as the size of SP2 domain decreases, the defect increases43. The data from Raman spectra analysis reflected the existence of a single-layer of NG in the composites. Changes in the composition of the materials affect its thermal properties. As shown in Fig. 2E, the thermal characteristics of the composites were reflected by the TGA curves. Since AG is the major component in the nano-composites, the TG curves of AG/NGHA nano-composites were similar to those of neat AG. Moreover, the curves of AG and AG/NG-HA composites displayed two patterns of mass loss. The initial weight loss observed at temperatures below 100 °C is attributed to the loss of adsorbed water. The sharp weight loss around 260 °C can be ascribed to the thermal decomposition of polysaccharide10. Also, it was found that the thermal stability of AG/NG-HA is higher than that of AG, suggesting that the inclusion of NG-HA in AG composites improves its thermal characteristics44. Taken together, the AG/NG-HA nanohybrid sample contained about 33 wt.% of AG and 67 wt.% of NG-HA, which resembles the native bone in terms of structure and composition. An ideal material for bone defect repair should be mechanically able to withstand physiological pressure and provide support for new bone tissue8. Representative 20


Page 20 of 54

Page 21 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


compressive stress-strain curves of the three nano-composites are shown in Fig. 2F. Among them, the AG film had the poorest mechanical properties. The NG-HA hybrids displayed good mechanical properties. Thus, the introduction of NG-HA into AG improved its mechanical properties, which resulted in a steady stress-strain curve with higher breaking elongation rate. Compared with the natural bone, AG/NG-HA composites exhibited superior mechanical properties than cancellous bone (4–12 MPa), which are slightly lower than that of the natural compact bone (130–180 MPa)45-46. 3.3 Cell Adhesion and Morphology In tissue engineering, the scaffold materials are expected to be biocompatible, facilitate cell adhesion and growth, and be non-immunogenic. To characterize the scaffolds in term of the above aspects, the adhesion, proliferation and morphology of cells cultured on the scaffolds were examined36. Cell attachment is the initial step that occurs when the implants make contact with cells. Herein, the attachment of cells to the scaffolds was investigated by the inverted fluorescence microscopy. The results of cell adhesion onto the AG/NG-HA nano-composites as examined at 1, 3, 5 and 7 days after seeding are shown in Fig. 3. After 1-day of culture, we observed adherent cells on the surfaces of all the composites, and the number of cells attached to the scaffolds increased with the culture time. However, at each time-point, the pure AG displayed the lowest cell adhesion capacity, while the AG/NG-HA composites showed the highest cell adhesion capacity. The cells on the AG/NG-HA scaffold showed a clear cytoskeletal organization and fibrous structure with high cell density after 7 days of 21



culture12. Moreover, these cells displayed the highest level of spreading and the most robust actin filaments formation relative to the cells grown on the other materials. It has been demonstrated that the RGO-HA composites have beneficial effects on cell adhesion47. In this study, the NG-HA hybrids showed a superior cell adhesion effect compared to pure AG. Because of its hierarchical pores structure and organic-inorganic composition, the cells grown on AG/NG-HA nano-composites exhibited much greater spreading and many actin filaments than those grown on NG-HA. The cell adhesion ability of AG-HA scaffolds was inferior to that of NG-HA and AG/NG-HA. This observation can be explained by the lack of hierarchical porous structure and the absence of NG in AG-HA scaffolds. Based on these results, we conclude that incorporation of N-graphene to the scaffold enhanced the cell adhesion ability of the scaffold. Thus, the AG/NG-HA nano-composites can support the preferential differentiation of MSCs to osteogenic lineage. To further study the adhesion ability, an equal number of cells were seeded on NGHA and AG/NG-HA scaffolds and cultured for 7 days. Thereafter, the cytoskeleton was stained with fluorescein isothiocyanate-labeled Phalloidin and DAPI, which labels Factins and cell nuclei, respectively, and then the cell morphology was observed by CLSM. Notably, the cells grown on the AG/NG-HA nano-composite scaffolds displayed well-shaped F-actins fibrils and filopodia, indicating the formation of a dense and interconnected network (Fig. 4B1, B2 and B3). In contrast, the cells seeded on the NG-HA nano-composite scaffolds appeared relatively thin and narrow (Fig. 4A1, A2 22


Page 22 of 54

Page 23 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and A3). Based on the number of cells and F-actins fibers, AG/NG-HA composites provided a superior cell adhesion and colonization platform than NG-HA. This indicated that the hierarchical porous structure formed in the organic matrix improved the cell adhesion ability of the scaffolds, an indicator that the large pores and rough surfaces of the composites are beneficial to cell attachment32. In addition, under SEM examination, cells attached to the AG/NG-HA scaffold were distinct and showed prominent filopodia. Based on SEM analysis (Fig. 4D1 and D2), the cells were uniformly spread on the AG/NG-HA composite showing fine filopodia attached to the surface of the material. The elongated morphology of cells grown on AG/NG-HA composite may indicate high signal conduction among osteoblasts. These experimental results proved that the rough surfaces of AG/NG-HA scaffolds offered a platform that allowed adhesion of cells and spreading of MSC. 3.4 The Biocompatibility and Cell Proliferation Effects of the Scaffolds Good biocompatibility and non-toxic or low toxicity to the host are the key requirements for biomaterials used in bone tissue engineering. HA is the main mineral component of human bones and has been recognized to be highly biocompatible. Here, we examined the biocompatibility of NG-HA and AG/NG-HA scaffolds using the live/dead cell staining. Based on the inverted fluorescence microscopy, the live cells appeared green and the dead cells appeared red. As shown in Fig. 5A, after 1 day of incubation, the density of cells on the two scaffolds were similar. The number of MSC on both materials increased with the incubation time. However, the cell density on the 23



AG/NG-HA scaffold was higher than that of the NG-HA scaffold, indicating a higher cell proliferation rate on AG/NG-HA scaffold. Almost no dead cells were found in all materials. In addition, MTT assay was performed to detect the cell proliferation ability on the AG/NG-HA composites. The MTT assay is based on the reduction of mitochondria reductase in living cells. As shown in Fig. 5B ， on the first day, the optical density of the two materials is remarkably low. Overall, the growth and proliferation of cells on all scaffolds increased significantly throughout the cell culture duration. However, AG/NG-HA scaffolds exhibited greater cell growth than NG-HA scaffolds. Therefore, we deduced that the cells cultured on the AG/NG-HA scaffold were more likely to adhere and proliferate compared to those grown on NG-HA scaffold. 3.5 Assessment of ALP Activity and Calcium Deposition Alkaline phosphatase is an enzyme which hydrolyzes phosphate esters. During the early stage of differentiation, alkaline phosphatase is secreted. Alkaline phosphatase plays an important role in bone matrix deposition and mineralization48. Calcium deposition is also an important marker that reflects the late stage of osteogenic differentiation. To test the osteogenic induction ability of the scaffolds, alkaline phosphatase activity and calcium depositions are often used as indexes of osteogenic differentiation36. As displayed in Fig. 5C, the ALP activity of MSC increased over time in both NG-HA and AG/NG-HA scaffolds. However, at any given time-point, the ALP activity of the cells grown on the AG/NG-HA composites was significantly higher compared to the NG-HA composite. This observation showed that AG/NG-HA 24


Page 24 of 54

Page 25 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


composites possessed good osteoinductivity, which accelerated the differentiation of stem cells. In addition, we qualitatively assessed the osteoinductivity of AG/NG-HA by observing the presence of mineralized nodules after culturing cells with osteogenic media for 14 and 21 days. The nodules were observed after staining with tetracycline hydrochloride and alizarin red S. As shown in Fig. 5D, the mineralized nodules appeared as red spots at the center of cell aggregation based on alizarin red S staining. In fact, more mineralized nodules were formed as the osteogenic differentiation time increased. The direct fluorescent staining of the scaffold with tetracycline hydrochloride displayed a yellow color, and this result was in agreement with the alizarin red S staining. Taken together, these results confirmed the ability of AG/NGHA scaffold to induce MSC mineralization. 3.6 Expression of Osteogenic Genes To further explore the osteoinductivity ability of the composites, the expression level of osteogenic marker genes, such as type I collagen (Col-I), osteocalcin (OCN), osteopontin (OPN) and Runt-related transcription factor 2 (Runx2) were evaluated49-50. The gene expression was detected at different time-points (0, 3, 7and 14 days). As shown in Fig. 6A, expression of four marker genes in the MSC grown on AG/NG-HA scaffolds was up-regulated at 7 and 14 days of osteogenic differentiation compared with those grown on NG-HA scaffolds. As markers of late-stage osteogenesis and mineralization, OCN and OPN were not significantly different between AG/NG-HA 25



and NG-HA at 0 and 3 days28. Hence, the expression of OCN and OPN indicated that MSC had matured into osteocytes (Fig. 6B and C). The expression level of Runx2, (a key transcription factor involved in early osteogenesis) was highest at 7 days and decreased at 14 days. (Fig. 6D). These results reinforce the conclusion that AG/NGHA induced differentiation of MSC into osteoblasts more effectively than NG-HA. 3.7 In Vivo Bone Regeneration Capacity of the Scaffold Since the goal of bone tissue engineering scaffolds is to repair bone defects, the capacity of AG/NG-HA scaffolds to repair bone repair defects was evaluated in rabbits as illustrated in Fig. S2. After locating the femoral condyle, a skin incision was made, and then the bone was exposed by the blunt split. Before they were implanted into the defect site, AG/NG-HA scaffolds were shaped to have a diameter of 6.0 mm and a thickness of 1.0 cm (Fig. S2A). Fig. 7A and B. show the reconstructed 3D images obtained by CT scanning of the defect site postoperatively. Notably, 12 weeks after the operation, the bone defect in the AG/NG-HA group was satisfactorily repaired, and the bone defect was no longer visible, indicating that a new bone was formed. In contrast, the defect in the control group was still visible. These results demonstrate that the AG/NG-HA scaffold is an effective platform for osteogenic activity compared to the control group. To quantitatively evaluate the regeneration of new bone after femoral defect, bone volume/tissue volume (BV/TV) and bone mineral density (BMD) were quantitatively analyzed by CT analysis software. As shown in Fig. 7C, at 12 weeks, the BV/TV of AG/NG-HA group (41.44 ± 4.25%) was higher than that in the blank control 26


Page 26 of 54

Page 27 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


group (6.58 ± 0.85%). At the same time, the BMD (Fig. 7D) of the AG/NG-HA group was 332.6 ± 36.4 mg/cm3, which is higher than that of the control group (58.9 ± 2.2 mg/cm3). The results of the histological analysis were consistent with those of the CT scanning, which further confirmed the bone repair capacity of AG/NG-HA scaffold. As shown in Fig. 7E, the level of new bone formation at the bone defect site was lower in the control group compared to the AG/NG-HA scaffold. As shown in Fig. 7F, a new bone was formed into the macropores of the scaffolds at 12 weeks post-implantation, and the new bone successfully integrated to the host bone, thereby eliminating the original boundary of the defects. Also, the quantitative histological analysis of new bone formation in the defect area through H&E staining (Fig. 7G) demonstrated a significant difference between the blank control group and the AG/NG-HA implantation group. These results confirmed that the AG/NG-HA scaffolds markedly enhanced bone regeneration in vivo.

4. Conclusion In this study, we successfully designed AG/NG-HA nano-composites through a facile hydrothermal/cross-linking/freeze-drying method. The nano-HA were uniformly distributed on the surface of NG forming small pores during the hydrothermal process. Then, the NG-HA hybrids were blended with AG by a simple blending process, a process where the compartments of the agarose gel network regulated and controlled the NG-HA nano-particles to form large pores during lyophilization. The final nanocomposites displayed hierarchical pore structures, good cytocompatibility, and 27



favorable osteoinductivity. Compared with pure AG, the mechanical properties of nano-composites were significantly enhanced. Furthermore, cell experiments showed that the AG/NG-HA nano-composites provided a favorable microenvironment for cell adhesion and proliferation, and promoted osteogenic gene expression, and hence osteogenic differentiation. In addition, based on the radiographic images, the AG/NGHA scaffold simulated the composition of natural bones. Its hierarchical porous structure significantly promoted the osteogenesis and repair of a bone defect in vivo. Thus, the bionic scaffold, AG/NG-HA, with good biocompatibility, multiple porosities and high bone defect restoration potential may aid in the regenerative repair of bone tissue.

Associated Content Supporting Information Supplementary data regarding this article are available free of charge via the Internet at http://pubs.acs.org. The experimental procedure contain: TEM images of the NG+HA hybrid with different NG contains (Figure S1), and Photos of AG/NG-HA scaffold; defects created in thigh of rabbit (Figure S2).

Author information Corresponding Author *Email address: [email protected] (F. Gao), Tel.: +86-516-83262138. *Email address: [email protected] (K. Guo), Tel.: +86-516-85805386. 28


Page 28 of 54

Page 29 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Author Contributions 1

J.J. Luo and X. Zhang contributed equally to this work. The manuscript was written

through contributions of all authors. All authors have given approval to the final version of the manuscript. Notes The authors declare no competing financial interest. Acknowledgements This study was supported by the National Natural Science Foundation of China (21565002), Research Project of Jiangsu Provincial Health Department (H201528), the Key Program of Science and Technique Development Foundation in Jiangsu Province (BE2015627). Natural Science Foundation of Jiangsu Province (BK20171174), China Postdoctoral Science Foundation Funded Project (2016M591929) and Jiangsu Postdoctoral Science Foundation (1701045C) partly support.

29



References (1) Burg, K. J.; Porter, S.; Kellam, J. F. Biomaterial Developments for Bone Tissue Engineering. Biomaterials 2000, 21, 2347-2359. (2) Kolanthai, E.; Sindu P, A.; Khajuria, D. K.; Veerla, S. C.; Kuppuswamy, D.; Catalani, L. H.; Mahapatra, D. R. Graphene Oxide–A Tool for Preparation of Chemically Crosslinking Free Alginate-Chitosan-Collagen Scaffold for Bone Tissue Engineering. ACS Appl. Mater. Interfaces 2018, 10, 12441-12452. (3) Yeo, M.; Jung, W. K.; Kim, G. Fabrication, Characterisation and Biological Activity of Phlorotannin-conjugated PCL/Beta-TCP Composite Scaffolds for Bone Tissue Regeneration. J. Mater. Chem. 2012, 22, 3568-3577. (4) Balakrishnan, B.; Banerjee, R. Biopolymer-based Hydrogels for Cartilage Tissue Engineering. Chem. Rev. 2011, 111, 4453-4474. (5) Owen, S. C.; Shoichet, M. S. Design of Three-dimensional Biomimetic Scaffolds. J. Biomed. Mater. Res. A. 2010, 94A, 1321-1331. (6) Kim, T. G.; Shin, H.; Lim, D. W. Biomimetic Scaffolds for Tissue Engineering. Adv. Funct. Mater. 2012, 22, 2446-2468. (7) Li, J. J.; Sun, H.; Sun, D.; Yao, Y. L.; Yao, F. L.; Yao, K. D. Biomimetic Multicomponent Polysaccharide/Nano-Hydroxyapatite Composites for Bone Tissue Engineering. Carbohyd. Polym. 2011, 85, 885-894. (8) Wang, Q.; Chu, Y.; He, J.; Shao, W.; Zhou, Y.; Qi, K.; Wang, L.; Cui, S. A Graded Graphene Oxide-hydroxyapatite/Silk Fibroin Biomimetic Scaffold for Bone Tissue 30


Page 30 of 54

Page 31 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Engineering. Mat. Sci. Eng. C-Mater. 2017, 80, 232-242. (9) Zhang, J.; Nie, J.; Zhang, Q.; Li, Y.; Wang, Z.; Hu, Q. Preparation and Characterization of Bionic Bone Structure Chitosan/Hydroxyapatite Scaffold for Bone Tissue Engineering. J. Biomater. Sci. Polym. Ed. 2014, 25, 61-74. (10) Hu, J.; Zhu, Y.; Tong, H.; Shen, X.; Chen, L.; Ran, J. A Detailed Study of Homogeneous Agarose/Hydroxyapatite Nanocomposites for Load-bearing Bone Tissue. Int J. Biol. Macromol 2016, 82, 134-143. (11) Shin, S.; Ikram, M.; Subhan, F.; Kang, H. Y.; Lim, Y.; Lee, R.; Jin, S.; Jeong, Y. H.; Kwak, J.-Y.; Na, Y.-J.; Yoon, S. Alginate–Marine Collagen–Agarose Composite Hydrogels as Matrices for Biomimetic 3D Cell Spheroid Formation. RSC Adv. 2016, 6, 46952-46965. (12) Hu, J. X.; Ran, J. B.; Chen, S.; Jiang, P.; Shen, X. Y.; Tong, H. Carboxylated Agarose (CA)-Silk Fibroin (SF) Dual Confluent Matrices Containing Oriented Hydroxyapatite (HA) Crystals: Biomimetic Organic/Inorganic Composites for Tibia Repair. Biomacromolecules 2016, 17, 2437-2447. (13) Singh, Y. P.; Bhardwaj, N.; Mandal, B. B. Potential of Agarose/Silk Fibroin Blended Hydrogel for in Vitro Cartilage Tissue Engineering. ACS Appl. Mater. Interfaces 2016, 8, 21236-21249. (14) Zarrintaj, P.; Manouchehri, S.; Ahmadi, Z.; Saeb, M. R.; Urbanska, A. M.; Kaplan, D. L.; Mozafari, M. Agarose-based Biomaterials for Tissue Engineering. Carbohydr. Polym. 2018, 187, 66-84. 31



Page 32 of 54

(15) Khanarian, N. T.; Haney, N. M.; Burga, R. A.; Lu, H. H. A Functional AgaroseHydroxyapatite Scaffold for Osteochondral Interface Regeneration. Biomaterials 2012, 33, 5247-5258. (16) Khajuria, D. K.; Kumar, V. B.; Gigi, D.; Gedanken, A.; Karasik, D. Accelerated Bone

Regeneration

by

Nitrogen-Doped

Carbon

Dots

Functionalized

with

Hydroxyapatite Nanoparticles. ACS Appl. Mater. Interfaces 2018, 10, 19373-19385. (17) Khajuria, D. K.; Vasireddi, R.; Trebbin, M.; Karasik, D.; Razdan, R. Novel Therapeutic Intervention for Osteoporosis Prepared with Strontium Hydroxyapatite and Zoledronic Acid: In Vitro and Pharmacodynamic Evaluation. Mat. Sci. Eng. C-Mater. 2017, 71, 698-708. (18) Khajuria, D. K.; Disha, C.; Vasireddi, R.; Razdan, R.; Mahapatra, D. R. Risedronate/Zinc-Hydroxyapatite Based Nanomedicine for Osteoporosis. Mat. Sci. Eng. C-Mater. 2016, 63, 78-87. (19) Ou, K.-L.; Chung, R.-J.; Tsai, F.-Y.; Liang, P.-Y.; Huang, S.-W.; Chang, S.-Y. Effect of Collagen on the Mechanical Properties of Hydroxyapatite Coatings. J. Biomed. Mater. Res. A. 2011, 4, 618-624. (20) Fu, S.; Ni, P.; Wang, B.; Chu, B.; Peng, J.; Zheng, L.; Zhao, X.; Luo, F.; Wei, Y.; Qian, Z. In Vivo Biocompatibility and Osteogenesis of Electrospun Poly(εcaprolactone)–Poly(ethylene

glycol)–Poly(ε-caprolactone)/Nano-Hydroxyapatite

Composite Scaffold. Biomaterials 2012, 33, 8363-8371. (21) Xia, Z.; Yu, X.; Jiang, X.; Brody, H. D.; Rowe, D. W.; Wei, M. Fabrication and 32


Page 33 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Characterization of Biomimetic Collagen–Apatite Scaffolds with Tunable Structures for Bone Tissue Engineering. Acta. biomater. 2013, 9, 7308-7319. (22) Izawa, H.; Nishino, S.; Maeda, H.; Morita, K.; Ifuku, S.; Morimoto, M.; Saimoto, H.; Kadokawa, J.-i. Mineralization of Hydroxyapatite upon a Unique Xanthan Gum Hydrogel by an Alternate Soaking Process. Carbohyd. Polym. 2014, 102, 846-851. (23) Nellis, B. A.; Satcher, J. H.; Risbud, S. H. Phospholipid Bilayer Formation on Hydroxyapatite Sol–Gel Synthesized Films. Colloid. Surface. B. 2011, 82, 647-650. (24) Qian, Y.; Lu, S. B.; Gao, F. L.Synthesis of Manganese Dioxide/Reduced Graphene Oxide Composites with Excellent Electrocatalytic Activity Toward Reduction of Oxygen. Mater. Lett. 2011, 65, 56-58. (25) Guo, M.; Li, D.; Zhao, M.; Zhang, Y.; Geng, D.; Lushington, A.; Sun, X. Nitrogen Ion Implanted Graphene as Thrombo-Protective Safer and Cytoprotective Alternative for Biomedical Applications. Carbon 2013, 61, 321-328. (26) Yoon, I. K.; Hwang, J. Y.; Seo, J. W.; Jong, W. C.; Kim, H. W.; Shin, U. S. Carbon Nanotube-Gelatin-Hydroxyapatite Nanohybrids with Multilayer Core-Shell Structure for Mimicking Natural Bone. Carbon 2014, 77, 379-389. (27) Wang, M.; Duan, X.; Xu, Y.; Duan, X. Functional Three-Dimensional Graphene/Polymer Composites. ACS Nano 2016, 10, 7231-7247. (28) Shao, W.; He, J.; Wang, Q.; Cui, S.; Ding, B. Biomineralized Poly(l-lactic-coglycolic acid)/Graphene Oxide/Tussah Silk Fibroin Nanofiber Scaffolds with Multiple Orthogonal Layers Enhance Osteoblastic Differentiation of Mesenchymal Stem Cells. 33



ACS Biomater. Sci. Eng. 2017, 3, 1370-1380. (29) Loh, Q. L.; Choong, C. Three-Dimensional Scaffolds for Tissue Engineering Applications: Role of Porosity and Pore Size. Tissue Eng. Part. B Rev. 2013, 19, 485502. (30) Chevalier, E.; Chulia, D.; Pouget, C.; Viana, M. Fabrication of Porous Substrates: A Review of Processes Using Pore Forming Agents in the Biomaterial Field. J. Pharm. Sci. 2008, 97, 1135-1154. (31) Zou, Y.; Qazvini, N. T.; Zane, K.; Sadati, M.; Wei, Q.; Liao, J.; Fan, J.; Song, D.; Liu, J.; Ma, C.; Qu, X.; Chen, L.; Yu, X.; Zhang, Z.; Zhao, C.; Zeng, Z.; Zhang, R.; Yan, S.; Wu, T.; Wu, X.; Shu, Y.; Li, Y.; Zhang, W.; Reid, R. R.; Lee, M. J.; Wolf, J. M.; Tirrell, M.; He, T. C.; de Pablo, J. J.; Deng, Z. L. Gelatin-Derived Graphene-Silicate Hybrid Materials Are Biocompatible and Synergistically Promote BMP9-Induced Osteogenic Differentiation of Mesenchymal Stem Cells. ACS Appl. Mater. Interfaces 2017, 9, 15922-15932. (32) Baradaran, S.; Moghaddam, E.; Basirun, W. J.; Mehrali, M.; Sookhakian, M.; Hamdi, M.; Moghaddam, M. R. N.; Alias, Y. Mechanical Properties and Biomedical Applications of a Nanotube Hydroxyapatite-Reduced Graphene Oxide Composite. Carbon 2014, 69, 32-45. (33) Chen, W.; Liu, J.; Manuchehrabadi, N.; Weir, M. D.; Zhu, Z.; Xu, H. H. Umbilical Cord and Bone Marrow Mesenchymal Stem Cell Seeding on Macroporous Calcium Phosphate for Bone Regeneration in Rat Cranial Defects. Biomaterials 2013, 34


Page 34 of 54

Page 35 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


34, 9917-9925. (34) Zhou, K.; Gao, R.; Jiang, S. Morphology, Thermal and Mechanical Properties of Poly (ε-caprolactone) Biocomposites Reinforced with Nano-Hydroxyapatite Decorated Graphene. J. Colloid Interface Sci. 2017, 496, 334-342. (35) Xiong, G.; Luo, H.; Zuo, G.; Ren, K.; Wan, Y. Novel Porous Graphene Oxide and Hydroxyapatite Nanosheets-Reinforced Sodium Alginate Hybrid Nanocomposites for Medical Applications. Mater. Charact. 2015, 107, 419-425. (36) Marcano, D. C.; Kosynkin, D. V.; Berlin, J. M.; Sinitskii, A.; Sun, Z.; Slesarev, A.; Alemany, L. B.; Lu, W.; Tour, J. M. Improved Synthesis of Graphene Oxide. ACS Nano 2010, 4, 4806-4814. (37) Liu, L.; Li, C.; Bao, C.; Jia, Q.; Xiao, P.; Liu, X.; Zhang, Q. Preparation and Characterization of Chitosan/Graphene Oxide Composites for the Adsorption of Au (III) and Pd (II). Talanta 2012, 93, 350-357. (38) Zhang, X.; Sui, Z.; Xu, B.; Yue, S.; Luo, Y.; Zhan, W.; Liu, B. Mechanically Strong and Highly Conductive Graphene Aerogel and Its Use as Electrodes for Electrochemical Power Sources. J. Mater. Chem. 2011, 21, 6494-6497. (39) Sui, Z. Y.; Meng, Y. N.; Xiao, P. W.; Zhao, Z. Q.; Wei, Z. X.; Han, B. H. Nitrogen-Doped Graphene Aerogels as Efficient Supercapacitor Electrodes and Gas Adsorbents. ACS Appl. Mater. Interfaces 2015, 7, 1431-1438. (40) Diaz, A.; Lopez, T.; Manjarrez, J.; Basaldella, E.; Martinez-Blanes, J. M.; Odriozola, J. A. Growth of Hydroxyapatite in A Biocompatible Mesoporous Ordered 35



Page 36 of 54

Silica. Acta Biomater. 2006, 2, 173-179. (41) Wang, J.; Ouyang, Z.; Ren, Z.; Li, J.; Zhang, P.; Wei, G.; Su, Z. Self-Assembled Peptide Nanofibers on Graphene Oxide as a Novel Nanohybrid for Biomimetic Mineralization of Hydroxyapatite. Carbon 2015, 89, 20-30. (42) Xu, H.; Ma, L.; Jin, Z. Nitrogen-Doped Graphene: Synthesis, Characterizations and Energy Applications. J. Energy. Chem. 2018, 27, 146-160. (43) Zhou, D.; Cheng, Q.-Y.; Han, B.-H. Solvothermal Synthesis of Homogeneous Graphene Dispersion with High Concentration. Carbon 2011, 49, 3920-3927. (44) Thinh Phung, X.; Basavajara, C.; Kim Jin, K.; Huh Do, S. Characterization and Electrical

Properties

of

Honeycomb‐Patterned

Poly(ε‐caprolactone)/Reduced

Graphene Oxide Composite Film. Polym. Composite. 2012, 33, 2159-2168. (45) Nisal, A.; Sayyad, R.; Dhavale, P.; Khude, B.; Deshpande, R.; Mapare, V.; Shukla, S.; Venugopalan, P. Silk fibroin Micro-Particle Scaffolds with Superior Compression Modulus and Slow Bioresorption For Effective Bone Regeneration. Sci. Rep. 2018, 8, 7235-7244. (46) Huang, Q.; Hao, L.; Xie, J.; Gong, T.; Liao, J.; Lin, Y. Tea PolyphenolFunctionalized Graphene/Chitosan as an Experimental Platform with Improved Mechanical Behavior and Bioactivity. ACS Appl. Mater. Interfaces 2015, 7, 2089320901. (47) Nie, W.; Peng, C.; Zhou, X.; Chen, L.; Wang, W.; Zhang, Y.; Ma, P. X.; He, C. Three-Dimensional Porous Scaffold by Self-Assembly of Reduced Graphene Oxide 36


Page 37 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and Nano-Hydroxyapatite Composites for Bone Tissue Engineering. Carbon 2017, 116, 325-337. (48) Tiwari, J. N.; Seo, Y.-K.; Yoon, T.; Lee, W. G.; Cho, W. J.; Yousuf, M.; Harzandi, A. M.; Kang, D.-S.; Kim, K.-Y.; Suh, P.-G.; Kim, K. S. Accelerated Bone Regeneration by Two-Photon Photoactivated Carbon Nitride Nanosheets. ACS Nano 2017, 11, 742751. (49) Babii, O.; Afonin, S.; Berditsch, M.; Reiβer, S.; Mykhailiuk, P. K.; Kubyshkin, V. S.; Steinbrecher, T.; Ulrich, A. S.; Komarov, I. V. Inside Back Cover: Controlling Biological Activity with Light: Diarylethene-Containing Cyclic Peptidomimetics. Angew. Chem., Int. Ed. 2014, 53, 3519-3519. (50) Wu, C.; Xia, L.; Han, P.; Xu, M.; Fang, B.; Wang, J.; Chang, J.; Xiao, Y. Graphene-oxide-modified β-tricalcium Phosphate Bioceramics Stimulate in Vitro and in Vivo Osteogenesis. Carbon 2015, 93, 116-129.

37



Scheme 1: (A) schematic illustration of the mechanism of NG-HA nano-composites formation; (B) schematic illustration of structuring process of AG/NG-HA hydrogel.

38


Page 38 of 54

Page 39 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 1: TEM images of the pure NG (A), and hybrid NG-HA (B); SEM images of pure AG (C1, C2), the hybrid of NG-HA (D1 ， D2), and the nano-composite scaffold AG/NG-HA (F1, F2).

39



Fig. 2: (A) FTIR spectra of AG, NG-HA, and AG/NG-HA; (B) XPS of the NG, NGHA, and AG/NG-HA; (C) XRD patterns of the NG, NG-HA, and AG/NG-HA; (D) Raman spectra of NG, NG-HA, and AG/NG-HA; (E) TG curves of AG, NG-HA, and AG/NG-HA; (F) mechanical properties of AG, NG-HA, and AG/NG-HA.

40


Page 40 of 54

Page 41 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 3: The inverted fluorescence microscopy images of the MSC adherent on the asprepared scaffolds.

41



Fig. 4: CLSM images of cells adhere on the scaffold, the cytoskeleton and cell nuclei were stained by FITC-phalloidin (1), DAPI (2) and the overlay (3). (A1-A3) NG-HA, and (B1-B3) AG/NG-HA; (C1-C3) the magnify CLSM images of cells adhere on the scaffolds AG/NG-HA; (D1-D2) the SEM images of cells adhere on the scaffolds AG/NG-HA.

42


Page 42 of 54

Page 43 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 5: (A) Live/Dead staining of NG-HA, and AG/NG-HA; (B) MTT assay for the biocompatibility on AG/NG-HA; (C) ALP activity at designed time intervals during the osteogenic induction; (D) Mineralized nodule analysis of the MSC grown on AG/NGHA scaffold after 21 days osteogenic induction with Tetracycline and Alizarin red staining. *, p < 0.05 and **, p < 0.01.

43



Fig. 6: Relative expressions of (A) Col1A, (B) OCN, (C) OPN, and (D) RunX2 in cells grown on AG/NG-HA scaffolds for 2 weeks.

44


Page 44 of 54

Page 45 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 7: In vivo bone regeneration capacity of AG/NG-HA scaffold. (A) and (B), CT images of defects implanted with blank and AG/NG-HA scaffolds at 2 days (1) and 12 weeks (2). (C) Bone mineral density (BMD) of the newly formed bone tissue. (D) bone volume/tissue volume (BV/TV). Histological images of the decalcified sections, (E) samples at 12 weeks after operation without scaffold implantation (H&E staining, 10 × ). (F) Samples at 12 weeks after operation with scaffold implantation (H&E staining, 10 × ). (G) Quantitative analysis of new bone formation and scaffold at the implantation site 12 weeks after operation. **p < 0.01.

45



For Table of Contents Use Only

46


Page 46 of 54

Page 47 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Scheme 1: (A) schematic illustration of the mechanism of NG-HA nano-composites formation; (B) schematic illustration of structuring process of AG/NG-HA hydrogel. 145x104mm (300 x 300 DPI)



Fig. 1: TEM images of the pure NG (A), and hybrid NG-HA (B); SEM images of pure AG (C1, C2), the hybrid of NG-HA (D1， D2), and the nano-composite scaffold AG/NG-HA (F1, F2). 206x178mm (300 x 300 DPI)


Page 48 of 54

Page 49 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 2: (A) FTIR spectra of AG, NG-HA, and AG/NG-HA; (B) XPS of the NG, NG-HA, and AG/NG-HA; (C) XRD patterns of the NG, NG-HA, and AG/NG-HA; (D) Raman spectra of NG, NG-HA, and AG/NG-HA; (E) TG curves of AG, NG-HA, and AG/NG-HA; (F) mechanical properties of AG, NG-HA, and AG/NG-HA. 170x194mm (300 x 300 DPI)



Fig. 3: The inverted fluorescence microscopy images of the MSC adherent on the as-prepared scaffolds. 250x164mm (300 x 300 DPI)


Page 50 of 54

Page 51 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 4: CLSM images of cells adhere on the scaffold, the cytoskeleton and cell nuclei were stained by FITCphalloidin (1), DAPI (2) and the overlay (3). (A1-A3) NG-HA, and (B1-B3) AG/NG-HA; (C1-C3) the magnify CLSM images of cells adhere on the scaffolds AG/NG-HA; (D1-D2) the SEM images of cells adhere on the scaffolds AG/NG-HA. 247x136mm (300 x 300 DPI)



Fig. 5: (A) Live/Dead staining of NG-HA, and AG/NG-HA; (B) MTT assay for the biocompatibility on AG/NGHA; (C) ALP activity at designed time intervals during the osteogenic induction; (D) Mineralized nodule analysis of the MSC grown on AG/NG-HA scaffold after 21 days osteogenic induction with Tetracycline and Alizarin red staining. *, p < 0.05 and **, p < 0.01. 272x239mm (300 x 300 DPI)


Page 52 of 54

Page 53 of 54 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 6: Relative expressions of (A) Col1A, (B) OCN, (C) OPN, and (D) RunX2 in cells grown on AG/NG-HA scaffolds for 2 weeks. 190x150mm (300 x 300 DPI)



Fig. 7: In vivo bone regeneration capacity of AG/NG-HA scaffold. (A) and (B), CT images of defects implanted with blank and AG/NG-HA scaffolds at 2 days (1) and 12 weeks (2). (C) Bone mineral density (BMD) of the newly formed bone tissue. (D) bone volume/tissue volume (BV/TV). Histological images of the decalcified sections, (E) samples at 12 weeks after operation without scaffold implantation (H&E staining, 10×). (F) Samples at 12 weeks after operation with scaffold implantation (H&E staining, 10×). (G) Quantitative analysis of new bone formation and scaffold at the implantation site 12 weeks after operation. **p < 0.01. 215x159mm (300 x 300 DPI)


Page 54 of 54

Agarose as

Recommend Documents