4634
Biochemistry 1993, 32, 4634-4640
Aggregation of Phospholipid Vesicles by a Chimeric Protein with the N-Terminus of Annexin I and the Core of Annexin Vt Harry A. M. Andree,* George M. Willems,t Rudolf Hauptmann,e Ingrid Maurer-Fogy,$ Marc C. A. Stuart,ll Wim Th. Hermens,' Peter M. Frederik,ll and Chris P. M. Reutelingsperger'J Cardiovascular Research Institute Maastricht, EM Unit Department of Pathology, and Department of Biochemistry, University of Limburg, 6200 MD Maastricht, The Netherlands, and Ernst Boehringer Institut f"ur Arzneimittelforschung, Vienna, Austria Received July 8, 1992; Revised Manuscript Received February 10, I993
A chimeric protein was produced with the N-terminal domain (amino acids 1-45) of annexin I and the core of annexin V (amino acids 19-320). This protein, annexin IN-VC, has a similar Ca2+ requirement for binding to phospholipid bilayers of 20% phosphatidylserine (PS)/80% phosphatidylcholine (PC) as annexin V. In contrast to annexin V, this protein has a strong potency to aggregate phospholipid vesicles as is shown by turbidimetric measurements and cryo-electron microscopy. Ellipsometry was employed to study quantitatively the phenomenon of phospholipid vesicle adhesion to annexin IN-VCbound to a planar phospholipid bilayer. The amount of phospholipid vesicles bound by annexin IN-VC on the planar bilayer is proportional to its surface coverage and can be inhibited by coadsorption of annexin V on the planar bilayer or by shielding the phospholipid surface of the vesicles with blood coagulation factor Va. Annexin IN-VC, like annexin V, does not bind to pure PC bilayers, but its adsorption on anionic phospholipid bilayers brings about the capacity to bind pure PC vesicles. This suggests that annexin IN-VC generates or exposes after binding to anionic phospholipids another phospholipid binding site, that differs from the annexin V phospholipid binding site. Collectively, the data suggest that two-dimensional cluster formation of annexin IN-VC on a bilayer with anionic phospholipids is involved in vesicle adherence. ABSTRACT:
The annexins belong to a family of phospholipid binding proteins, that share structural homology in a conserved core, with 4 or (in the case of annexin VI) 8 internal repeats of about 70 amino acids containing the annexin consensus sequence,and a variableN-terminaltail (Geisow, 1986;Geisow et al., 1986). Several observationssupport the notion that the N-terminal part of the annexin molecule can influence the Ca2+requirement for binding to phospholipids. Phosphorylation of the N-terminus of annexin I (De et al., 1986;Pepinsky & Sinclair, 1986) and annexin I1 (Glenney & Tack, 1985) decreases the amount of Ca2+ required for binding (Glenney, 1986; Schlaepfer & Haigler, 1987). Limited proteolysis of the N-terminal tail of annexin I also decreases the Ca2+requirement for binding (Ando et al., 1989). Finally, monoclonal antibodies against the N-terminal domain of annexin I did not inhibit phospholipid binding and even decreased the amount of Ca2+required for binding (Glenney & Zokas, 1988). Aggregation of phospholipid vesicles has been reported for several annexins. Aggregation of chromaffin granules, purified from adrenal medulla, by annexin VI1 was already described in 1978 (Creutz et al., 1978). Vesicle aggregation and under certain conditions followed by vesicle fusion has been described for annexins I, 11, and VI1 (Creutz et al., 1978; Blackwood & Ernst, 1990;Nir et al., 1987; Drust & Creutz, 1988;Powel & Glenney, 1987). Ernst et al. (1991) constructed a chimera of annexins I and V with aggregating activity and concluded Supported by a grant from the Royal Dutch Academy of Sciences (KNAW) to C.P.M.R. * Address correspondence to this author at the Department of Biochemistry, Universityof Limburg, P.O. Box 6 16,6200 MD Maastricht, The Netherlands. Telephone: 31-43-881674. Fax: 31-43-670988. f CardiovascularResearch Institute Maastricht, University of Limburg. 5 Ernst Boehringer Institut fiir Arzneimittelforschung. 11 EM Department of Pathology, University of Limburg. 1 Department of Biochemistry, University of Limburg.
that this activity comes forth from structures that are included in the first repeat of annexin I plus eight residues of its aminoterminal tail. Annexin I1 restores secretion in permeabilized cells, whereas secretion is inhibited by immunoaffinity-purified antibodiesagainst annexin I1 (Ali et al., 1989). Someannexins are, therefore, thought to play a role in exocytosis. Annexin V in the presence of Ca2+ ions binds with high affinity to anionic phospholipids (Andree et al., 1990; Tait et al., 1989; Schlaepfer et al., 1987), but, compared to the other annexins, it displays the highest Ca2+requirement for binding (Blackwood & Ernst, 1990). Furthermore, annexin V does not promote vesicle aggregation, and in fact impairs vesicle aggregation by other annexins (Blackwood & Ernst, 1990; Oshry et al., 1991). In this paper, we describe a chimeric protein, annexin INV C , ~with the N-terminus of annexin I and the C-terminal core with the four repeats of annexin V, constructed for further exploration of the relationshipbetween primary structure and phospholipid binding properties of annexins. Ellipsometry, a sensitive optical technique for the measurement of protein adsorption on reflecting surfaces,was used to show that annexin V and the chimera have identical lipid binding properties. Turbidity measurements and cryo-electron microscopy revealed that annexin IN-VC,in contrast to annexin v, promotes aggregation of small unilamellar vesicles and causes the formation of large aggregates. The interaction of the chimera with lipid vesicles was further characterized by ellipsometric measurement of vesicle adsorption to planar bilayers covered with annexin IN-VC. The results indicate that the lipid-bound chimera exposes a new phospholipid binding site that is absent or masked in annexin V. I Abbreviations: annexin IN-VC, chimeric protein with N-terminal domain of annexin I and the core of annexin V; PS, 1,2-dioleoyl-snglycero-3-phosphatidylserine;PC, 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine.
0006-2960/93/0432-4634$04.00/0 0 - 1993 American Chemical Societv
Annexin IN-Vc-Mediated Vesicle Aggregation MATERIALS AND METHODS
Preparation of Phospholipid Vesicles and Planar Bilayers. 1,2-Dioleoyl-sn-glycero-3-phosphatidylserine (PS) was purchased from Avanti Polar Lipids and the corresponding phosphatidylcholine(PC) fromSigma Chemical Co. (P-1013). All experimentswere performed with phospholipid mixtures of 20% PS/80% PC (mol/mol) or purePC. Small unilamellar vesicles (SUV, 20-40 nm) were prepared according to de Kruijff et al. (1975) by sonicating a nitrogen-dried phospholipid mixture in buffer at 0 OC. Planar phospholipid bilayers were deposited on silicone slides by dipping hydrophilic silicone slides in a stirred vesicle solution (Giessen et al., 1991). Buffer. Experimentswere performed in a buffer of 50 mM Tris-HC1, pH 7.5, 100 mM NaCl, 3 mM CaC12, and 0.5 g/L bovine serum albumin (Sigma Chemical Co., A-7030) at 20 OC, unless stated otherwise. Proteins. Annexin V was purified from human placental tissue as described (Reutelingpserger et al., 1985). Purity of annexins was checked by SDS-polyacrylamide gel electrophoresis according to Schagger and Jagow (1987) in the presence of 2% 2-mercaptoethanol, stained with Coomassie Blue. Production of Annexin ZWVC. A plasmid fragment, obtained after cutting plasmid pRH291 (Maurer-Fogy et al., 1988) with restriction enzymes PuuII and SphI (PuuIISphI fragment), contained part of the phoA promoter, the bacterial ribosomal binding site, the entire coding region for annexin V, and a nontranslated part. It was subcloned into the commercially available plasmid M 13mpl8 doubly-cut with SmaI and SphI. Using the mutagenesis primer EBI-977
(CAACAGAGTCAGGATCGATTCCTCATCTGTGCCC) complementary to annexin V from nucleotides 221254 (Maurer-Fogy et al., 1988), and Amersham's in vitro mutagenesis system, mutated cDNA was produced with the indicated ClaI site at the codon for serine-36, without affecting the amino acid sequence. It was sequenced, and a large EcoRI-Hind111 insert was isolated and recloned in Bluescribe M13+ (Stratagen), resulting in pGN31. Coding oligonucleotide strands of the N-terminus of annexin I, EBI-982 (CGATTCCTCATCTGTGCCCAAGCCTTT-
CATAGCCTTCCGAAGAGTTTCTGCATCCGAGGATGGATTGAAGGTAGGATATAGGGGCTCACCGCTGATCCGG) and EBI-988 (GACCACCTTTGGAT-
GACTTCACAGTTTGAACATATTCCTGCTCTTCATTTTCAATAAACCAGGCCTGCTTGAGGAATTCTGATACCATTGCCATAAAATCACCTCAACCTC, were phosphorylated using T4 polynucleotide kinase (New England Biolabs). The reaction was stopped by heating at 95 OC for 10 min, and 12 p L of water was added, containing 1 pmol of the noncoding strands EBI-972 (TCGAGAGGT-
TGAGGTGATTTTATGGCAATGGTATCAGAATTCCTCAAGCAGGCCTGGTTTATTGAAAATGAAGAGCAGGAATATGTTCAAACTGTGAAGTCATCCAA) and EBI-978 (AGGTGGTCCCGGATCAGCGGTGAGCCCCTATCCTACTTCAATCCATCCTCGGATGCAGAAACTCTTCGGAAGGCTATGAAAGGCTTGGGCACAGATGAGGAAT) and approximately 1 p g of the XhoI-ClaI fragment of pGN3 1. After being annealed, the fragments were ligated using T4 ligase (New England Nuclear). Competent Escherichia coli JM 101 cells were transformed. A correctly expressed plasmid, checked by sequencing, was selected from the clones and named pGN32. TheXhoI-Hind111 insert of pGN32, containing the coding regions of the hybrid annexin, was cloned into pRH284, cut with XhoI and Hind111 (Maurer-Fogy et al., 1988). The
Biochemistry, Vol. 32, No. 17, 1993 4635 resulting plasmid, pGN38, expressed annexin IN-VC (4 mg of annexin IN-VC/L of fermentation) in E. coli JM 101 cells, grown as described (Maurer-Fogy et al., 1988). Purification of Annexin ZWVC. The fermentation of pGN38-transformed E. coli 101 was submitted to a French press to breakopen the E. colicells. The solution was adjusted to 5 mM CaC12 and 0.5% poly(ethy1enimine) (w/v) and was then centrifuged. Under these conditions, the chimera bound to the E. coli membranes. The membrane pellet was washed thoroughly. The final wash step contained EDTA to liberate the chimera from the membranes. The resulting supernatant was loaded on a TSK-DEAE column equilibrated with 20 mM Tris-HC1, pH 8.4. Elution from thecolumn was achieved using a linear gradient from 0 to 500 mM NaCl. The fractions containing the chimera were concentrated and loaded on a S-200 gel permeation column, equilibrated with 20 mM TrisHCl, pH 7.5, and 200 mM NaC1. Finally, the chimeracontaining fractions were pooled, dialyzed against 50 mM Tris-HC1, pH 7.9, and applied to a Mono Q column from which it was eluted by a NaCl gradient of 0-250 mM NaC1. The purified chimera was checked by sequencing on a pulsed liquid-phase sequenator (ABI, Model 477 A) using Edman chemistry. Identification of the cleaved amino acids was done by on-line reverse-phase HPLC. '25Z-AnnexinZWVC. Annexin IN-VC (100 p g ) was added to a vial containing two Iodo-beads (Pierce) and 1 mCi of lZsI in 1 mL of buffer (50 mM Tris-HC1, pH 7.5, and 100 mM NaCl) and incubated for 15 min under continuous stirring. was removed with a gel filtration (G-25) column. Free 1251 This resulted in a specific activity of 4 X 1O6 cpmlpg of annexin IN-VC. Aggregation of Phospholipid Vesicles Measured with Turbidity. Aggregation of phospholipid vesicles by annexins was measured essentially as described by Creutz et al. 1978. The optical density (OD) at 405 nm was recorded every 20 s for 10 min in a Cobas-Bio (Hoffmann-La Roche) autoanalyzer at 37 OC, which yielded the same results as aggregation measured in a conventional photometer. The optical density was corrected for the blank value of the cuvette, and the accuracy of the Cobas-Bio photometer signal was better than 0.5 mOD. The turbidity of solutions of small vesicles (20-40 nm) used in this study is very small (
