An Intelligent DNA Nanorobot with in Vitro Enhanced Protein

1 day ago - DNA nanorobots have emerged as new tools for nanomedicine with the potential to ameliorate the delivery and anticancer efficacy of various...
0 downloads 0 Views 13MB Size
Download PDF
This is an open access article published under an ACS AuthorChoice License, which permits copying and redistribution of the article or any adaptations for non-commercial purposes.

Letter Cite This: Nano Lett. XXXX, XXX, XXX−XXX

pubs.acs.org/NanoLett

An Intelligent DNA Nanorobot with in Vitro Enhanced Protein Lysosomal Degradation of HER2 Wenjuan Ma,† Yuxi Zhan,† Yuxin Zhang,† Xiaoru Shao,† Xueping Xie,† Chenchen Mao,† Weitong Cui,† Qian Li,‡ Jiye Shi,§ Jiang Li,‡ Chunhai Fan,‡,§ and Yunfeng Lin*,† †

State Key Laboratory of Oral Diseases, National Clinical Research Center for Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu 610041, People’s Republic of China ‡ School of Chemistry and Chemical Engineering, and Institute of Molecular Medicine, Renji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200240, China § Division of Physical Biology and Bioimaging Center, Shanghai Synchrotron Radiation Facility, CAS Key Laboratory of Interfacial Physics and Technology, Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800, China

Downloaded by 193.56.74.126 at 06:53:35:034 on June 05, 2019 from https://pubs.acs.org/doi/10.1021/acs.nanolett.9b01320.

S Supporting Information *

ABSTRACT: DNA nanorobots have emerged as new tools for nanomedicine with the potential to ameliorate the delivery and anticancer efficacy of various drugs. DNA nanostructures have been considered one of the most promising nanocarriers. In the present study, we report a DNA framework-based intelligent DNA nanorobot for selective lysosomal degradation of tumor-specific proteins on cancer cells. We site-specifically anchored an anti-HER2 aptamer (HApt) on a tetrahedral framework nucleic acid (tFNA). This DNA nanorobot (HApt-tFNA) could target HER2-positive breast cancer cells and specifically induce the lysosomal degradation of the membrane protein HER2. An injection of the DNA nanorobot into a mouse model revealed that the presence of tFNA enhanced the stability and prolonged the blood circulation time of HApt, and HApt-tFNA could therefore drive HER2 into lysosomal degradation with a higher efficiency. The formation of the HER2-HApttFNA complexes resulted in the HER2-mediated endocytosis and digestion in lysosomes, which effectively reduced the amount of HER2 on the cell surfaces. An increased HER2 digestion through HApttFNA further induced cell apoptosis and arrested cell growth. Hence, this novel DNA nanorobot sheds new light on targeted protein degradation for precision breast cancer therapy. KEYWORDS: DNA nanorobot, HER2, aptamer, framework nucleic acids, breast cancer, lysosome

E

biological macromolecule antibodies (e.g., trastuzumab) exert their effects by binding to and directing HER2 to the endocytosis pathway for ultimate lysosomal degradation.3,11,12 These antibodies also can kill HER2-positive cells via antibodydependent cell-mediated cytotoxicity (ADCC) in vivo.13,14 However, these monoclonal anti-HER2 antibodies have severe side effects in clinical trials, such as diarrhea, abnormal liver function, and drug resistance.15,16 Producing and storing monoclonal antibodies is also very challenging, which require rigorous conditions and specialized techniques.9,10,15,16 Therefore, these monoclonal antibodies are not that cost-effective, and new types of anti-HER2 drugs for HER2-positive breast cancer are needed. Removing HER2 from the plasma membrane or inhibiting the gene expression of HER2 is a promising alternative that could limit the malignancy of HER2-positive cancer cells.1,2,8 Recently, a DNA aptamer designed by SELEX,17,18 anti-HER2 aptamer

pidermal growth factor receptors (EGFR; HER) consist of four transmembrane members (i.e., HER1, HER2, HER3, and HER4),1,2 which are associated with cell self-renewal and death.1−3 The EGFRs involved in signal transduction pathways exist as monomers but function as dimers by binding to each other.2 This dimerization can initiate the activation of downstream signaling pathways associated with the promotion of cell proliferation and evasion of cell apoptosis.4−7 Among the EGFRs, HER2 acts as a network hub that mediates various types of information signaling among cancer cells.8 Moreover, HER2 is an important prognostic biomarker for 20−30% of breast cancers, which is the most common cancer in women.1,2,9,10 Overexpression of the HER2 receptor stimulates breast cells to proliferate and differentiate uncontrollably, thereby enhancing the malignancy of breast cancer and resulting in a poor prognosis for affected individuals.1−3 Accordingly, ascertaining and suppressing the amplification of HER2 is a vital therapeutic precondition for HER2-positive breast cancer patients. Current therapies to suppress the overexpression of HER2 in breast cancer mainly involve treatment with HER2-specific monoclonal antibodies such as trastuzumab.3,9,10 These traditional © XXXX American Chemical Society

Received: March 30, 2019 Revised: May 9, 2019

A

DOI: 10.1021/acs.nanolett.9b01320 Nano Lett. XXXX, XXX, XXX−XXX

Letter

Nano Letters Scheme 1. Schematic Illustration of the Internalization Process of HApt-tFNA in SK-BR-3 Cellsa

a

HApt-tFNA can bind to HER2 on the cytomembrane, and then the HER2-HApt-tFNA complex internalizes into SK-BR-3 cells by endocytosis. The HER2-HApt-tFNA complex is degraded in lysosomes, which arrests cell proliferation and induces cell death.

Table 1. Base Sequence of Each ssDNA ssDAN Cy5-S1 S1 S2 S3 S4 Cy5-HApt HApt HApt-S4

base sequence Cy5-ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG Cy5-GCAGCGGTGTGGGGGCAGCGGTGTGGGGGCAGCGGTGTGGGG GCAGCGGTGTGGGGGCAGCGGTGTGGGGGCAGCGGTGTGGGG GCAGCGGTGTGGGGGCAGCGGTGTGGGGGCAGCGGTGTGGGGTTTTACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG

direction 5’→3’ 5’→3’ 5’→3’ 5’→3’ 5’→3’ 5’→3’ 5’→3’ 5’→3’

affordable and facile therapeutic drugs.33−39 In particular, many studies reported that a tetrahedral framework nucleic acid (tFNA) could serve as a promising DNA nanocarrier for many antitumor drugs, owing to its high biocompatibility and biosecurity.40−42 For example, tFNA was reported to effectively deliver paclitaxel or doxorubicin to cancer cells for reversing drug resistance,41,42 small interfering RNAs (siRNAs) have been modified into tFNA for targeted drug delivery,43,44 and tFNA could deliver antisense peptide nucleic acids to inhibit methicillin-resistant Staphylococcus aureus.45 Moreover, the production and storage of tFNA are not complicated, and they can be quickly degraded in lysosomes by cells.46,47 Since both free HApt and tFNA can be diverted into lysosomes, we hypothesized that combining the HApt and tFNA as a novel DNA nanorobot (namely, HApt-tFNA) would be an effective strategy to improve its delivery and therapeutic efficacy in treating HER2-positive breast cancer. Therefore, in the current study, first, we generated and characterized HApt-tFNA and then compared its stability and ability to target and uptake HER2 with free HApt. Then, we further evaluated the cell-killing effects of the HApt-tFNA in different cell lines varying in HER2 expression to examine its specificity and selectivity. Moreover,

(HApt), has been investigated for its targeted antitumor effects on HER2-overexpressing cancers,11 including breast cancer, gastric cancer, and head-and-neck neoplasms.11,19 HApt is a single-stranded DNA (ssDNA) molecule of 42 bp in length and possesses both anticancer and targeting abilities. HApt can specifically recognize and bind to HER2 and then translocate HER2 into the lysosomes for degradation, thereby initiating cell death and suppressing cell growth.11,12 However, there are some limitations of this free form of HApt, including poor stability, easy consumption, and short period of action.11,20−22 As an alternative, nanoparticle-based delivery has gained increasing attention for suppressing HER2 in breast cancer treatment, and many nanoparticles have been explored for this purpose to date, such as gold nanoparticles (AuNPs).11,23 Although some positive effects have been demonstrated, the synthesis of these materials is complicated and time-consuming.11,20−22 Therefore, a new material with a high accessibility and low cost is urgently needed. DNA origami is an emerging field of DNA-based nanotechnology,24−32 and intelligent DNA nanorobots show great promise in working as a drug delivery system in healthcare.33−39 Different DNA-based nanorobots have been developed as B

DOI: 10.1021/acs.nanolett.9b01320 Nano Lett. XXXX, XXX, XXX−XXX

Letter

Nano Letters

Figure 1. Characterization of HApt-tFNA. (A) Schematic illustration of the synthetic process of HApt-tFNA. (B) Confirmation of the successful synthesis of HApt-tFNA by PAGE. Lane 1, S4. Lane 2, HApt-S4. Lane 3, S1. Lane 4, S1 + S2. Lane 5, S1 + S2 + S3. Lane 6, S1 + S2 + S3 + S4, tFNA. Lane 7, S1 + S2 + S3 + HApt-S4, HApt-tFNA. (C) Stability analysis of free HApt and HApt-tFNA in 10% FBS (n = 3). (D) Stability analysis of free HApt and HApt-tFNA in vivo (n = 4).

electron microscopy (TEM), which showed that the HApttFNA was approximately 15.0 nm in size (Figure S3). Atomic force microscopy (AFM, SPM-9700 instrument, Shimadzu, Kyoto, Japan) results were shown in Figure S4, and they revealed that the size of tFNA was approximately 10.0 nm, and the height was about 2.0 nm, while the size and height of HApt-tFNA were approximately 20.0 and 3.0 nm, respectively. The findings of AFM further validate that the nanorobot (HApt-tFNA) was generated successfully. Thus, these findings demonstrated that the DNA nanorobot could be prepared successfully with our synthesis method. Since various serum proteins might disturb the functions of nanostructures via nonspecific binding in fetal bovine serum (FBS),46,51 we compared the stability of free HApt and HApttFNA grown in a medium mixed with 10% FBS at 37 °C. As shown in Figure 1C, the HApt-tFNA could resist exposure to 10% FBS and showed a higher stability than free HApt. Furthermore, the in vivo distribution and circulatory time of HApt-tFNA and free HApt were compared in nude mice through fluorescence imaging. It showed that HApt-tFNA could circulate longer in the body than free HApt significantly (Figure 1D), suggesting that HApt-tFNA has a superior circulatory time. According to the plasm half-time measurement, the half-life of free HApt was about 15 min while that of HApt-tFNA was 35 min approximately (Figure S5). A significantly longer half-life was observed for HApt-tFNA relative to free HApt, which was critical for therapeutic efficacy. Meanwhile, we suspect that tFNA modified with different valence numbers of HApt might be able to enhance the anticancer effect on HER2-positive cancer cells. As mentioned above, tFNA can also be modified with various materials to perform specific functions.40−45 Therefore, the tFNA nanorobot can also be loaded with other

we explored the underlying mechanism of the therapeutic effects of HApt-tFNA through changes in HER2 expression, cell cycle and apoptosis, and effects on signaling pathways related to cancer cell proliferation and death (Scheme 1). Specifically, we predicted that tFNA would enhance the delivery efficacy of HApt, leading to the more effective transportation and lysosomal digestion of HER2, thereby overcoming the limitations of free HApt to ameliorate treatment of HER2positive breast cancers. Generation and Characterization of HApt-tFNA. HApttFNA was self-assembled by four ssDNAs (i.e., S1, S2, S3, and HApt-S4, Table 1), and the synthetic process of HApt-tFNA was schematically presented in Figure 1A. The successful generation of HApt-tFNA with each ssDNA was verified by polyacrylamide gel electrophoresis (PAGE; Figure S1), in which it showed that HApt could be modified to S4 and HApt-tFNA could be synthesized successfully (Figure 1B).45−51 The size of tFNA and HApt-tFNA was determined by dynamic light scattering (DLS) as 11.305 ± 0.782 nm and 19.818 ± 0.862 nm, respectively (Figure S2A,B). This size difference indicated the successful formation of HApt-tFNA, which is a prerequisite for an effective drug delivery system. As shown in Figure S2C, the polymer dispersion index (PDI) of tFNA was 0.424 ± 0.105 and that of HApt-tFNA was 0.667 ± 0.115. The PDI results indicated that the distribution of the HApt-tFNA was not excellent for the existence of polymers. Therefore, more work is needed to avoid the formation of polymers and increase the productivity of HApt-tFNA. For the current study, the way we used to purify the HApt-tFNA was high-performance liquid chromatography (HPLC; Thermo Scientific, Waltham, MA, USA). For further verification, we visualized the morphology of HApt-tFNA using transmission C

DOI: 10.1021/acs.nanolett.9b01320 Nano Lett. XXXX, XXX, XXX−XXX

Letter

Nano Letters

Figure 2. Expression of HER2 in different cells (SK-BR-3, MCF-7, and MCF-10A cells) and cell viability assay. (A) Immunofluorescent images of SKBR-3, MCF-7, and MCF-10A cells (HER2, red; nucleus, blue). Scale bars are 25 μm. (B) Cell viability assay (CCK-8 assay) of SK-BR-3, MCF-7 and MCF-10A cells after treatment with free HApt and HApt-tFNA for 72 h. Data is presented as mean ± SD (n = 4). Statistical analysis: * p < 0.05 vs control; *** p < 0.001 vs control; ## p < 0.01 vs free HApt with the same concentration.

materials such as siRNA to regulate or silence the expression of certain genes to amplify the effects against HER2-postive cancer cells.3 Moreover, the better stability, longer circulation time, and half-time of HApt-tFNA than free HApt might improve the anticancer effects by prolonging the action time after targeting HER2. Hence, HApt-tFNA could be designated to multiple

antitumor drug complexes, which is promising for general anticancer treatment. Expression of HER2 in Cells and the Cell Viability Assay. To examine the ability of the HApt-tFNA in specifically targeting HER2-overexpressing cells, we compared the cellkilling effects in vitro using different breast cell lines that vary in HER2 expression: SK-BR-3 (human breast cancer cells), MCFD

DOI: 10.1021/acs.nanolett.9b01320 Nano Lett. XXXX, XXX, XXX−XXX

Letter

Nano Letters

Figure 3. Comparison of cellular uptake between free Cy5-HApt and Cy5-HApt-tFNA. (A) Confocal laser scanning microscopy images show that the difference of cellular uptake between free HApt and HApt-tFNA in SK-BR-3, MCF-7, and MCF-10A cells (12 h of incubation; Cy5-HApt-tFNA, red; cytoskeleton, green; nucleus, blue). Scale bars are 25 μm. (B) Flow cytometry analysis of the uptake rates in SK-BR-3, MCF-7, and MCF-10A cells incubated with free Cy5-HApt or Cy5-HApt-tFNA for 12 h. Quantitative analysis of cellular uptake rates in cells treated with free Cy5-HApt or Cy5HApt-tFNA for 12 h. Data is presented as mean ± SD (n = 3). Statistical analysis: ** p < 0.01 vs control, *** p < 0.001 vs control; ## p < 0.01 vs free Cy5-HApt, ### p < 0.001 vs free Cy5-HApt.

stable at 48 or 72 h. Exposure to 375 nM HApt-tFNA was harmful to MCF-10A cells at 48 h or longer. Therefore, 250 nM was determined as the relatively optimal concentration of HApttFNA for targeting HER2-positive cancer treatment and was used in subsequent experiments. The effect of 250 nM tFNA on SK-BR-3 cells was also tested at 24, 48, and 72 h, and the viability of the SK-BR-3 cells was found to be increased only at 24 h (Figure S8). Hence, HApt-tFNA could exert more effective anticancer effects on SK-BR-3 cells than free HApt, and our findings support that HApt-tFNA has the capacity to specifically target SK-BR-3 cells, and tFNA can enhance the anticancer effects of HApt on cancer cells as hypothesized. While overexpression of HER2 also occurs in other cancers,19 further work is needed to determine whether this kind of intelligent DNA nanorobot could also exert the same effects on other HER2-positive cancers or is specific to breast cancer.

7 (human breast cancer cells), and MCF-10A cells (normal human breast cells). There is positive expression of HER2 in SKBR-3 cells and negative expression in both MCF-7 and MCF10A cells, which was further demonstrated by our immunofluorescence staining of HER2 in these cells before other experiments (Figure 2A). Immunoblotting also suggested that the expression of HER2 was significantly higher in SK-BR-3 cells than in MCF-7 and MCF-10A cells (Figure S6). These cells were then exposed to different concentrations of the nanostructures to determine the optimal concentration of HApt-tFNA in inhibiting the viability of SK-BR-3 cells but showing no significant effect on MCF-7 and MCH-10A cells. We found that HApt-tFNA at 250 nM could reduce the viability of SK-BR-3 cells effectively after treatment for 24 to 72 h (Figure 2B and Figure S7), whereas the viability of MCF-7 and MCF10A cells increased initially, and then maintained relatively E

DOI: 10.1021/acs.nanolett.9b01320 Nano Lett. XXXX, XXX, XXX−XXX

Letter

Nano Letters

Figure 4. Effects of free HApt and HApt-tFNA on SK-BR-3 cells. (A) Flow cytometry analysis of the cell cycle after SK-BR-3 cells exposed to free HApt or HApt-tFNA for 48 h. (B) Data analysis of cell cycle distribution. Data is presented as mean ± SD (n = 4). Statistical analysis: * p < 0.05 vs control; *** p < 0.001 vs control; # p < 0.05 vs free HApt. (C) Flow cytometry analysis of cell apoptosis after SK-BR-3 cells exposed to free HApt or HApt-tFNA for 48 h. (D) Immunoblotting analysis of the HER2 protein expression level after SK-BR-3 cells were treated with free HApt or HApt-tFNA for 48 h. (E) Semiquantitative analysis of immunoblotting of the HER2 expression level after cells were treated with free HApt or HApt-tFNA for 48 h. Data is presented as mean ± SD (n = 4). Statistical analysis: * p < 0.05 vs control; *** p < 0.001 vs control; # p < 0.05 vs free HApt. (F) Immunofluorescent images of HER2 after SK-BR-3 cells were treated with free HApt or HApt-tFNA for 48 h (HER2, red; nucleus, blue). Scale bars are 25 μm.

Comparison of Uptake and Targeting Abilities between Free HApt and HApt-tFNA. To investigate the different abilities of cell uptake, free HApt and HApt-tFNA were modified with cyanine-5 (Cy5; free Cy5-HApt and Cy5-HApttFNA, respectively) and were used to track the location of the nanostructures.31 First, we tested whether the cell internalization of free Cy5-HApt and Cy5-HApt-tFNA depended on HER2 levels by comparing the cellular uptake of SK-BR-3, MCF-7, and MCF-10A cells. Confocal imaging further showed that SK-BR-3 cells could take in both free Cy5-HApt and Cy5HApt-tFNA, and the intake of the Cy5-HApt-tFNA was much

greater (Figure 3A). Therefore, HApt-tFNA could facilitate SKBR-3 cells to assimilate the nanostructures, which may attribute to a more stable structure than free HApt. MCF-7 and MCF10A cells also took in both free Cy5-HApt and Cy5-HApt-tFNA but in much smaller amounts (Figure 3A). These results suggested that the internalization of free Cy5-HApt and Cy5HApt-tFNA in different cells is related to the extent of HER2 expression. To further quantitatively investigate the cellular uptake of free Cy5-HApt and Cy5-HApt-tFNA, we measured the percentage of cells that took in free Cy5-HApt or Cy5-HApttFNA though flow cytometry. More than 60% of the SK-BR-3 F

DOI: 10.1021/acs.nanolett.9b01320 Nano Lett. XXXX, XXX, XXX−XXX

Letter

Nano Letters

Figure 5. Distribution of free Cy5-HApt and Cy5-HApt-tFNA in SK-BR-3 cells. (A) After incubated with free Cy5-HApt or Cy5-HApt-tFNA for 12 h, the fluorescence signals of Cy5 showed a higher uptake by SK-BR-3 cells and clustering in lysosomes when grafted to TDNs (free Cy5-HApt and Cy5HApt-tFNA, red; lysosome, green; nucleus, blue). Scale bars are 5 μm. (B) Confocal fluorescence images of Cy5-HApt-tFNA and lysosomes in SK-BR3 cells after 6, 12, 24, and 36 h treatment times. The location of Cy5-HApt-tFNA overlapped with those of lysosomes at 12 and 24 h (Cy5-HApt-tFNA, red; lysosome, green; nucleus, blue). Scale bars are 5 μm. (C) Confocal fluorescence images of HER2 and Cy5-HApt-tFNA in SK-BR-3 cells after 12 and 24 h treatment times. The fluorescence intensity of HER2 and Cy5 signals both became weaker from 12 to 24 h (HER2, green; Cy5-HApt-tFNA, red; nucleus, blue). Scale bars are 10 μm.

developed as a diagnostic and location aid of HER2-positive cancers, with maintained antitumor effects. Moreover, the substrate of HApt-tFNA is DNA, which can be metabolized in the body to avoid the bioaccumulation of nanocarriers.46,47 This is an advantage over other traditional nanocarriers such as AuNPs, which contain heavy metals and are nonbiodegradable and harmful to normal cells and organs. Therefore, HApt-tFNA would be safer for various biomedical applications. Therapeutic Effects of Free HApt vs HApt-tFNA. Previous studies have reported that HApt could bind to HER2, mediate HER2 into cells, and degrade it in lysosomes.11 This process effectively decreases the amount of HER2 in the plasma membrane, thereby inhibiting cell self-renewal and promoting apoptosis. We used flow cytometry to analyze the changes of the cell cycle and apoptosis after incubation with HApt-tFNA for 48 h. As shown in Figure 4A,B, HApt-tFNA could significantly reduce the number of cells in the S phase compared to free HApt, suggesting that HApt-tFNA could inhibit cell proliferation. Moreover, the proportion of cells in the early and late apoptosis stages increased significantly after treatment with HApt-tFNA compared to that detected with free HApt treatment, which indicated that HApt-tFNA could promote the apoptosis of SK-BR-3 cells (Figure 4C). We

cells took in Cy5-HApt-tFNA, while only about 12% of the SKBR-3 cells took in free Cy5-HApt (Figure 3B and Figure S9). The HApt-tFNA could be internalized by SK-BR-3 cells much more easily than free HApt, which might be also related to the higher stability of HApt-tFNA and the ability of tFNA in driving the nanostructures into cells. By contrast, only a few MCF-7 (less than 4%) and MCF-10A cells (less than 10%) could assimilate free Cy5-HApt or Cy5-HApt-tFNA. Therefore, both free Cy5-HApt and Cy5-HApt-tFNA could target and enter SKBR-3 cells by recognizing HER2 specifically, and Cy5-HApttFNA showed a much better targeting ability. As shown in the Supporting Information, we also investigated the cellular uptake of Cy5-tFNA by SK-BR-3, MCF-7, and MCF-10A cells and found that tFNA could be taken up by the cells as demonstrated in previous studies (Figures S10− 12).46−49,51 These findings further support the results of the cell viability assay that demonstrate HApt-tFNA shows targeted cytotoxicity to SK-BR-3 cells. In addition, Cy5 can be loaded to free HApt and HApt-tFNA as a fluorescence signal for monitoring the translocation of nanostructures. Taken together, these results demonstrate that HApt-tFNA can exist in vitro and in vivo and that the fluorescence signal of Cy5-HApt-tFNA can be maintained for a long time. Thus, this compound might be G

DOI: 10.1021/acs.nanolett.9b01320 Nano Lett. XXXX, XXX, XXX−XXX

Letter

Nano Letters

Figure 6. Lysosomal function is involved in the anticancer performance of HApt-tFNA. (A) Cell viability assay (CCK-8 assay) after 48 h incubation of SK-BR-3 cells with HApt-tFNA and chloroquine (Chl). Data is presented as mean ± SD (n = 3). Statistical analysis: * p < 0.05 vs control; ** p < 0.01 vs control; # p < 0.05 vs free HApt. (B) HER2 analyzed by immunoblotting after SK-BR-3 cells treated with HApt-tFNA and Chl for 48 h (n = 4). (C) Semiquantitative analysis of immunoblotting of the HER2 expression level after cells were treated with free HApt or HApt-tFNA for 48 h. Data is presented as mean ± SD (n = 4). Statistical analysis: * p < 0.05 vs control; *** p < 0.001 vs control; # p < 0.05 vs free HApt. (D) Confocal fluorescence images of HER2 in SK-BR-3 cells after 48 h treatment with HApt-tFNA and Chl (HER2, red; nucleus, blue). Scale bars are 10 μm.

tFNA in SK-BR-3 cells showed with fluorescence were clearly the same as the locations of lysosomes stained with Lyso Tracker Green DND26. These results indicated that free Cy5-HApt and Cy5-HApt-tFNA could enter the lysosomes; thus, tFNA can be regarded as an efficient nanocarrier to transmit HApt into the target organelle. Using HER2 antibodies, we further observed that Cy5-HApttFNA can combine with HER2 and vesiculate (Figure S16). We next evaluated the degradation of HER2 in the lysosomes by observing the localization of HER2-Cy5-HApt-tFNA complexes at some time points (6, 12, 24, and 36 h) and staining lysosomes of SK-BR-3 cells simultaneously (Figure 5B). At 6 h, the confocal images showed that the Cy5 signal did not overlap with the signals of lysosomes, indicating that the Cy5-HApt-tFNA was not in the lysosomes. However, at 12 h, abundant Cy5 signals overlapped with lysosome signals, indicating that most of the Cy5-HApt-tFNA complexes were in the lysosomes. At 24 h, the Cy5 signals still overlapped with the lysosome signals, but the fluorescence intensity of Cy5 became weaker than that detected at 12 h. Hence, a part of Cy5-HApt-tFNA was degraded in lysosomes. Finally, only a small amount of Cy5-HApt-tFNA was not degraded at 36 h. For a further investigation of the changes of HER2 and Cy5 signals, we stained HER2 in SK-BR-3 cells that were exposed to Cy5-HApt-tFNA for 12 h (Videos S1 and S2) and 24 h (Videos S3 and S4). As shown in Figure 5C, the fluorescence intensity of HER2 and Cy5 signals became weaker from 12 to 24 h. These consistent changes of HER2 and Cy5 signals further support the formation of HER2-Cy5-HApttFNA complexes and their degradation. To verify the effects of lysosomes, we tested whether HER2 degradation would be

further found that HApt-tFNA could increase the number of cells in the S phase in both MCF-7 and MCF-10A cells compared to free HApt, although no significant differences were observed in the effects on cell apoptosis in MCF-7 or MCF-10A cells between free HApt and HApt-tFNA (Figures S13 and S14). Immunoblotting and immunofluorescence were further conducted to determine the extent of changes of HER2 expression after treatment with HApt-tFNA and free HApt. The surplus of HER2 decreased by approximately 2.5-fold after treating SKBR-3 cells with HApt-tFNA compared to treatment with free HApt (Figure 4D,E). Consistent with these immunoblotting results, the fluorescence signals of HER2 also decreased significantly in SK-BR-3 cells after treatment with HApt-tFNA (Figure 4F). Therefore, HApt-tFNA could reduce HER2 levels in SK-BR-3 cells, inhibit cell proliferation, and induce cell apoptosis. While reduction of HER2 is strongly associated with decrease in the malignant potential of tumors,1 our findings further supporting the therapeutic efficacy of HApt-tFNA against HER2-overexpressing breast cancers. Action Pathway and Mechanism of HApt-tFNA in Inducing HER2 Degradation. We previously reported that tFNA was degraded by lysosomes and could enhance cell autophagy.46,47 Therefore, we then examined whether HApttFNA could improve the efficiency of HApt delivery. Confocal images showed that the fluorescence signals of Cy5 from free Cy5-HApt in SK-BR-3 cells were much lower than those from Cy5-HApt-tFNA at the same concentration and incubation time (Figure 5A); meanwhile, we also found that tFNA could enter lysosomes in SK-BR-3 cells that were exposed to tFNA for 12 h (Figure S15). The locations of free Cy5-HApt or Cy5-HAptH

DOI: 10.1021/acs.nanolett.9b01320 Nano Lett. XXXX, XXX, XXX−XXX

Letter

Nano Letters

Figure 7. Effects of HApt-tFNA on the PI3K/AKT signaling pathway. (A) Immunoblotting analysis of essential proteins after SK-BR-3 cells treated with free HApt or HApt-tFNA for 48 h. (B−F) Semiquantitative analysis of the essential protein expression level by immunoblotting after SK-BR-3 cells were treated with free HApt or HApt-tFNA for 48 h. Data is presented as mean ± SD (n = 3). Statistical analysis: * p < 0.05 vs control; ** p < 0.01 vs control; *** p < 0.001 vs control; # p < 0.05 vs free HApt; ## p < 0.01 vs free HApt. (G−I) RT-PCR analysis of the essential gene expression level after SK-BR-3 cells were exposed to free HApt or HApt-tFNA for 48 h. Data is presented as mean ± SD (n = 4). Statistical analysis: * p < 0.05 vs control; ** p < 0.01 vs control; *** p < 0.001 vs control; # p < 0.05 vs free HApt.

(P-GSK) and Cyclin-D1 were lower in cells treated with HApttFNA than free HApt (Figure 7A,E,F), which indicated that cell proliferation was inhibited. The changes in genes of Bax, Bcl-2, and Cyclin-D1 were consistent with the changes of proteins, further indicating that the PI3K/AKT signaling pathway was down-regulated by HApt-tFNA (Figure 7G−I). In conclusion, the DNA nanorobot composed of HApt and tFNA showed a higher stability and a more effective performance than free HApt against HER2-positive breast cancer cells. The PI3K/AKT pathway was inhibited when membrane-bound HER2 decreased in SK-BR-3 cells under the action of HApttFNA. Our findings suggest that tFNA can enhance the anticancer effects of HApt on SK-BR-3 cells; while HApttFNA can bind to HER2 specifically, the compounded HER2HApt-tFNA complexes can then be transferred and degraded in lysosomes. After these processes, the accumulation of HER2 in the plasma membrane would decrease, which could also influence the downstream PI3K/AKT signaling pathway that is associated with cell growth and death (Scheme 1). However, some limitations need to be noted when interpreting our findings: (i) the cytotoxicity of the nanorobot on HER2-positive cancer cells was weak, and we did not compare the anticancer effects between conventional monoclonal antibodies and HApttFNA; (ii) the differences in delivery efficiency between tFNA and other nanocarriers need to be confirmed; and (iii) the confirmation of anticancer effects of HApt-tFNA on tumors within animals remains challenging. Despite these limitations, the present study provides novel evidence of the biological effects of tFNA when combined with HApt. Although the stability and the anticancer effects of HApt-tFNA may require further improvement before clinical application, our study

influenced when the function of the lysosome was inhibited by chloroquine (Chl).11 Chl can impair the activity of lysosomes by diffusing into the lysosomes and increasing the lysosomal pH.11 Additionally, Chl inhibits the fusion between lysosomes and autophagosomes and interferes with the function of lysosomal hydrolases.52−54 Cells exposed to Chl and then treated with HApt-tFNA showed a greater viability than those treated with only HApt-tFNA (Figure 6A). This demonstrated that the effects of HApt-tFNA depend greatly on the function of the lysosome. These results further supported that HApt-tFNA could combine with HER2 to form complexes, which were then delivered into the lysosomes based on HER2 and HApt-tFNAmediated endocytosis, and the consequent degradation of HER2 resulted in cell death. To further investigate whether the increased cell viability after inhibiting the function of lysosomes would lead to a decreased HER2 degradation, we measured the expression of HER2 and the HER2 expression exposed to Chl and HApt-tFNA in SK-BR-3 cells was higher than that of cells with a normal lysosomal function (Figure 6B−D). These results indicated that HER2 was not degraded when the lysosomes were inhibited even after treatment with HApt-tFNA. Some previous studies have reported that HER2 overexpression can promote cell migration and proliferation and also inhibit cell apoptosis by activating the PI3K/AKT pathway.4−7 Therefore, we tested the gene and protein expression of the PI3K/AKT pathway. The expressions of the antiapoptosis-related proteins phosphorylated AKT (P-AKT) and Bcl-2 were inhibited, while that of the pro-apoptosis protein Bax was promoted (Figure 7A−D). All of these changes of cells treated with HApt-tFNA were more significant than those of cells treated with free HApt. The levels of phosphorylated GSK I

DOI: 10.1021/acs.nanolett.9b01320 Nano Lett. XXXX, XXX, XXX−XXX

Letter

Nano Letters

plasma membrane in different cells (SK-BR-3, MCF-7, and MCF-10A cells). The cells were cultured on confocal plates (Corning) with their own complete growth medium. After culturing for 24 h, all cells were washed with phosphate-buffered saline (PBS; Gibco) three times to remove the residual growth medium. All samples were then immobilized by 4% paraformaldehyde (Gibco) for 20 min, permeabilized by 0.05% Triton-X 100 (Gibco) for 10 min, and blocked with 5% sheep serum (Corning) for 1 h at 37 °C. All cells were incubated with a primary antibody (rabbit anti-ErbB2, 1:250 dilution; Abcam, Cambridge, U.K.) at 4 °C overnight and then with goat antirabbit IgG (1:1000 dilution; Abcam) for 1 h. The cell nuclei were treated with DAPI (Sigma) for 10 min. All confocal images were acquired with a confocal laser scanning microscope (Nikon N-SIM, Japan). Cell Viability Measurement. To determine the optimal concentration of HApt-tFNA and free HApt, all cells were exposed to various concentrations (62.5, 125, 250, and 375 nM) and the cell viability was assessed with the cell counting kit-8 (CCK-8; Dojindo Laboratories, Japan). SK-BR-3, MCF-7, and MCF-10A cells were cultured in 96-well plates (5 × 103 cells/ mL) and then exposed to various concentrations of free HApt and HApt-tFNA the next day for 72 h, respectively. Medium (100 μL) was mixed with CCK-8 reagent (10 μL), per well, and a group of wells was treated with only medium as the control for background subtraction. After 1−4 h incubation, the absorbance of samples was measured by a Varioskan Flash microplate reader (Thermo Scientific, Waltham, MA, USA). Cy5-Labeled Free HApt and HApt-tFNA Cellular Uptake Assay. To analyze the difference in cellular uptake between free HApt and HApt-tFNA, confocal imaging and flow cytometry were applied.55 SK-BR-3, MCF-7, and MCF-10A cells were seeded on confocal plates and cultured in their respective complete growth media. After 24 h, the cells were treated with fresh growth medium containing 250 nM free Cy5-HApt or Cy5-HApt-tFNA for 12 h, and then residual nanostructures were removed. All cells were fixed in cold 4% paraformaldehyde for 20 min, permeated by 0.05% Triton-X 100 for 10 min, stained by phalloidin (Sigma) for 1 h at 37 °C, and treated with DAPI for 10 min. All cells were examined under a confocal laser scanning microscope (Nikon N-SIM) to determine the cellular uptake of free Cy5-HApt and Cy5-HApt-tFNA. For flow cytometry analyses, all cells were seeded into plates and treated with growth medium containing 250 nM free Cy5-HApt or Cy5HApt-tFNA for 12 h. After rinsing with PBS three times, a flow cytometer (FC500 Beckman, IL, USA) was used to analyze the cellular uptake of free Cy5-HApt and Cy5-HApt-tFNA. Effects of HApt-tFNA on Cell Biological Behaviors. Flow cytometry was conducted to observe the effect of HApt-tFNA on SK-BR-3 cells. For the cell cycle analysis, SK-BR-3 cells were treated with 250 nM free HApt or HApt-tFNA for 48 h and then were collected, rinsed with PBS twice, and fixed in cold 70% ethanol overnight at −20 °C. The next day, the cells were washed in PBS three times, treated with 100 μL of RNase A (30 min at 37 °C), and then exposed to 400 μL of propidium iodide (PI; 30 min at 4 °C). Finally, the cell cycle was examined on an FC500 Beckman flow cytometer. After the same treatment, SKBR-3 cells were harvested and washed three times for the analysis of cell apoptosis. In brief, the cells were incubated with 400 μL of Annexin V binding solution stained with 5 μL of Annexin V-FITC solution (10 min at 37 °C), followed by 5 μL of PI solution (10 min at 4 °C). Ultimately, cell apoptosis was investigated by flow cytometry (FC500 Beckman). For HER2

initiates a promising step toward the development of nanomedicines with novel and intelligent DNA nanorobots for tumor treatment. Methods. Cell Culture. The cell lines SK-BR-3 (human mammary gland adenocarcinoma cell line), MCF-7 (human breast adenocarcinoma cell line), and MCF-10A (human nontumorigenic epithelial cell line) were purchased from ATCC (Manassas, VA, USA). SK-BR-3 cells were cultured in McCoy’s medium (Gibco, Grand Island, NY, USA) supplemented with 10% (v/w) FBS (Corning, New York, NY, USA) and 1% (v/w) penicillin/streptomycin solution (P/S; Gibco). MCF-7 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) with 10% (v/w) FBS and 1% P/S. MCF-10A cells were cultured in DMEM/F12 (Gibco) mixed with 5% horse serum (Invitrogen), 20 ng/mL epidermal growth factor (Sigma), 0.5 μg/mL hydrocortisone (Sigma), 10 μg/mL insulin (Sigma), 1% nonessential amino acids (Sigma), and 1% P/S. The growth medium was completely changed every 3 to 4 days. All cells were seeded in T25 flasks (Corning) and incubated with 5% CO2 at 37 °C. Generation of HApt-tFNA. HApt was modified to the 5′-end of S4 (HApt-S4). All ssDNAs were synthesized and purified by TaKaRa (Ostu, Japan). Tris-HCl (10 mM, Sigma) and MgCl2 (50 mM, Sigma) were used to prepare the TM buffer (pH = 8.0), and the four different ssDNAs (S1, S2, S3, and HApt-S4) were mixed into the TM buffer at the same concentration. The mixture was warmed for 10 min at 95 °C and then cooled to 4 °C for 30 min. The tFNA was synthesized in the same way that was reported in our previous studies.46,48−51 When cells were incubated with tFNA or HApt-tFNA, tFNA and HApt-tFNA were purified by HPLC (Thermo Scientific, Waltham, MA, USA). HPLC employed a liquid mobile phase (25 nM Tris-HCl, Sigma; 450 mM NaCl, Sigma; pH = 7.4) with a flow velocity of 1 mL/min, which was conducted at a wavelength of 260 nm. The collections (tFNA, HApt-tFNA) of HPLC were then concentrated by using a tubular ultrafiltration membrane (30 kDa, Millipore, USA) with TM buffer. Finally, the samples were diluted to a concentration of 1 μM and stored in a 4 °C refrigerator. Authentication of the Successfully Synthesized HApt-tFNA. The successful assembly of HApt-tFNA was confirmed by 8% PAGE. The comixtures of each sample (S4, HApt-S4, S1, S1 + S2, S1 + S2 + S3, tFNA, and HApt-tFNA) with 6× loading buffer at a ratio of 5:1 were added to the PAGE gel, and electrophoresis was conducted at a constant voltage of 80 V for 80 min, dyed by Gel-Red (Sigma) for 20 min, and analyzed by an ultraviolet exposure apparatus (Bio-Rad, Hercules, CA, USA). In Vitro Stability Test. The mixture with 10% FBSsupplemented growth medium, and 250 nM free HApt or HApt-tFNA was incubated at 37 °C for different time periods (0, 2, 6, 12, 24, and 36 h) to test the nanostructures stability. The samples were then subjected to PAGE as described above. In Vivo Circulation Time Test. For the in vivo stability investigation of the nanostructures, we injected free Cy5-HApt (1 μM; 100 μL)/Cy5-HApt-tFNA (1 μM; 100 μL) into 6-weekold nude mice (20 g; male; Balb/c) through the tail vein. Before imaging, chloral hydrate (10%; 100 μL/mouse) was applied to anesthetize the mice by intraperitoneal injection. All images were captured with a whole-body fluorescent system (QuickView3000, Bio-Real, Austria) at different time points (2, 5, 10, 20, 30, 45, and 60 min). Immunofluorescence Staining of HER2. Immunofluorescence was used to determine the expression of HER2 on the J

DOI: 10.1021/acs.nanolett.9b01320 Nano Lett. XXXX, XXX, XXX−XXX

Letter

Nano Letters

secondary antibodies (1:2000) for 1 h at 37 °C, and visualized using an enhanced chemiluminescence detection system (BioRad). The internal reference was GAPDH. Statistics. Student’s t-test or one-way analysis of variance (ANOVA) was adopted to conduct the statistical analyses with GraphPad Prism 7. Variables are displayed as mean ± SD (standard deviation) with at least three independent repetitive experiments.

detection, SK-BR-3 cells were exposed to the same procedure. Immunoblotting (as described below) and immunofluorescence staining (as mentioned above) of HER2 were also conducted. Tracking Free Cy5-HApt and Cy5-HApt-tFNA by Staining Lysosomes. To further observe the differences between free HApt and HApt-tFNA, Lyso Tracker Green DND26 (Invitrogen) was applied. SK-BR-3 cells were plated on confocal plates for 24 h and then cocultured with 250 nM free HApt or HApt-tFNA for different time points, respectively. Next, the growth medium was changed to the medium containing Lyso Tracker Green DND26 at 37 °C for 1 h. Then, the cells were fixed in cold paraformaldehyde and stained with DAPI. Finally, confocal images were captured by a confocal laser scanning microscope (Nikon N-SIM). Chloroquine Intervention. The SK-BR-3 cells were treated with 10 nM Chl for 24 h to disturb lysosome function. After treating with Chl, the cells were cultured with 250 nM HApttFNA for 48 h, and the cell viability was measured by the CCK-8 reagent following the same procedure described above. To further investigate the expression of HER2, immunoblotting (as mentioned below) and immunofluorescence staining (as mentioned above) were also used. Real-Time Polymerase Chain Reaction (RT-PCR). Author: After culturing cells with free HApt or HApt-tFNA for 48 h, all RNAs were collected from SK-BR-3 cells by the RNeasy Plus Mini Kit (KeyGen Biotech, Nanjing, China), and they were purified and subject to reverse transcription by Superscript IV Reverse Transcriptase (Invitrogen). RT-PCR was conducted using SYBR Master Mix (TaKaRa) on an Applied Biosystems ABI 7500 system (Thermo Fisher, USA). The mRNA expression levels of Bax, Bcl-2, and Cyclin-D1 were tested using GAPDH as the control (sequences of mRNA primers synthesized by Invitrogen, Table 2).

■

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.nanolett.9b01320. Characterization of single-stranded DNAs, characterization of HApt-tFNA, plasma half-time measurement, immunoblotting of HER2 in different cells (SK-BR-3, MCF-7, MCF-10A cells), cell viability measurement of different cells (SK-BR-3, MCF-7, and MCF-10A cells) treated with free HApt or HApt-tFNA, cell viability measurement of SK-BR-3 cells treated with 250 nM tFNA, Cy5-labeled free HApt and HApt-tFNA cellular uptake assay, cellular uptake of tFNA by different cells (SK-BR-3, MCF-7, and MCF-10A cells), effects of HApttFNA on cell biological behaviors of MCF-7 and MCF10A cells, distribution of Cy5-tFNA in SK-BR-3 cells, and the observation of HER2-Cy5-HApt-tFNA complexes (PDF) Video S1 (ZIP) Video S2 (ZIP) Video S3 (ZIP) Video S4 (ZIP)

■

Table 2. Primer Sequences of Relevant Genes Designed for qPCR mRNA

primer pairs

GAPDH

Forward 5’-AAGACCTTGGGCTGGGACTG-3’ Reverse 5’-AGGCTGCGGGCTCAATTTAT-3’ Forward 5’-TCATGGGCTGGACATTGGAC-3’ Reverse 5’-GAGACAGGGACATCAGTCGC-3’ Forward 5’- AACATCGCCCTGTGGATGAC-3’ Reverse 5’- GACTTCACTTGTGGCCCAGAT-3’ Forward 5’- AGCTGTGCATCTACACCGAC-3’ Reverse 5’- GAAATCGTGCGGGGTCATTG-3’

Bax Bcl-2 Cyclin-D1

ASSOCIATED CONTENT

S Supporting Information *

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Tel: 86-28-85503487. Fax: 8628-85503487.

product length (bp)

ORCID

129

Jiang Li: 0000-0003-2372-6624 Yunfeng Lin: 0000-0003-1224-6561

236

Notes 216

The authors declare no competing financial interest.

113

ACKNOWLEDGMENTS This work was funded by the National Natural Science Foundation of China (NSFC, 81671031 and 81470721). We thank Doctor Chenghui Li (Analytical & Testing Center, Sichuan University) for the help of taking laser scanning confocal images. The animal experiment was carried out according to the guidelines of the Animal Ethics Committee of Sichuan University.

■

Immunoblotting. After treating SK-BR-3 cells with 250 nM free HApt or HApt-tFNA for 48 h, total proteins were harvested using the Whole Cell Lysis Assay (KeyGEN Biotech), mixed with 5× loading buffer at a ratio of 4:1, and heated at 100 °C for 10 min. All protein samples were subjected to SDS-PAGE (Beyotime, Nanjing, China), diverted to a polyvinylidene fluoride membrane (TaKaRa), and blocked with 5% bovine serum albumin (Sigma) solution for 1 h at 37 °C. Various primary antibodies (anti-GAPDH, antitotal/phosphorylated AKT, anti-Bax, anti-Bcl-2, anti-ErbB2, antitotal/phosphorylated GSK, and anti-Cyclin-D1; 1:1000; Abcam) were incubated with corresponding membranes overnight at 4 °C. The next day, the membranes were rewashed with TBST (100 mM NaCl, 10 mM Tris-base, and 0.1% Tween-20; pH 7.5) three times, exposed to

■

REFERENCES

(1) Loibl, S.; Gianni, L. HER2-positive breast cancer. Lancet 2017, 389, 2415−2429. (2) Yarden, Y. Biology of HER2 and its importance in breast cancer. Oncology 2001, 61, 1−13. (3) Zhang, Y. J.; Leonard, M.; Shu, Y.; Yang, Y. G.; Shu, D.; Guo, P. X.; Zhang, X. T. Overcoming Tamoxifen Resistance of Human Breast Cancer by Targeted Gene Silencing Using Multifunctional pRNA Nanoparticles. ACS Nano 2017, 11, 335−346.

K

DOI: 10.1021/acs.nanolett.9b01320 Nano Lett. XXXX, XXX, XXX−XXX

Letter

Nano Letters (4) Dey, N.; De, P.; Leyland-Jones, B. PI3K-AKT-mTOR inhibitors in breast cancers: From tumor cell signaling to clinical trials. Pharmacol. Ther. 2017, 175, 91−106. (5) Ikink, G. J.; Boer, M.; Bakker, E. R. M.; Hilkens, J. IRS4 induces mammary tumorigenesis and confers resistance to HER2-targeted therapy through constitutive PI3K/AKT-pathway hyperactivation. Nat. Commun. 2016, 7, 13567. (6) Rohlenova, K.; Neuzil, J.; Rohlena, J. The role of Her2 and other oncogenes of the PI3K/AKT pathway in mitochondria. Biol. Chem. 2016, 397, 607−15. (7) Zhao, D. L.; Sui, Y. X.; Zheng, X. Q. miR-331−3p inhibits proliferation and promotes apoptosis by targeting HER2 through the PI3K/Akt and ERK1/2 pathways in colorectal cancer. Oncol. Rep. 2016, 35, 1075−1082. (8) Zhang, Q.; Park, E.; Kani, K.; Landgraf, R. Functional isolation of activated and unilaterally phosphorylated heterodimers of ERBB2 and ERBB3 as scaffolds in ligand-dependent signaling. Proc. Natl. Acad. Sci. U. S. A. 2012, 109, 13237−13242. (9) Bang, Y. J.; Van Cutsem, E.; Feyereislova, A.; Chung, H. C.; Shen, L.; Sawaki, A.; Lordick, F.; Ohtsu, A.; Omuro, Y.; Satoh, T.; Aprile, G.; Kulikov, E.; Hill, J.; Lehle, M.; Ruschoff, J.; Kang, Y. K. Trastuzumab in combination with chemotherapy versus chemotherapy alone for treatment of HER2-positive advanced gastric or gastro-oesophageal junction cancer (ToGA): a phase 3, open-label, randomised controlled trial. Lancet 2010, 376, 687−697. (10) Sawaki, A.; Ohashi, Y.; Omuro, Y.; Satoh, T.; Hamamoto, Y.; Boku, N.; Miyata, Y.; Takiuchi, H.; Yamaguchi, K.; Sasaki, Y.; Nishina, T.; Satoh, A.; Baba, E.; Tamura, T.; Abe, T.; Hatake, K.; Ohtsu, A. Efficacy of trastuzumab in Japanese patients with HER2-positive advanced gastric or gastroesophageal junction cancer: a subgroup analysis of the Trastuzumab for Gastric Cancer (ToGA) study. Gastric Cancer 2012, 15, 313−22. (11) Lee, H.; Dam, D. H.; Ha, J. W.; Yue, J.; Odom, T. W. Enhanced Human Epidermal Growth Factor Receptor 2 Degradation in Breast Cancer Cells by Lysosome-Targeting Gold Nanoconstructs. ACS Nano 2015, 9, 9859−67. (12) Mahlknecht, G.; Maron, R.; Mancini, M.; Schechter, B.; Sela, M.; Yarden, Y. Aptamer to ErbB-2/HER2 enhances degradation of the target and inhibits tumorigenic growth. Proc. Natl. Acad. Sci. U. S. A. 2013, 110, 8170−5. (13) Li, J. Y.; Perry, S. R.; Muniz-Medina, V.; Wang, X.; Wetzel, L. K.; Rebelatto, M. C.; Hinrichs, M. J.; Bezabeh, B. Z.; Fleming, R. L.; Dimasi, N.; Feng, H.; Toader, D.; Yuan, A. Q.; Xu, L.; Lin, J.; Gao, C.; Wu, H.; Dixit, R.; Osbourn, J. K.; Coats, S. R. A Biparatopic HER2Targeting Antibody-Drug Conjugate Induces Tumor Regression in Primary Models Refractory to or Ineligible for HER2-Targeted Therapy. Cancer Cell 2016, 29, 117−29. (14) Moody, P. R.; Sayers, E. J.; Magnusson, J. P.; Alexander, C.; Borri, P.; Watson, P.; Jones, A. T. Receptor Crosslinking: A General Method to Trigger Internalization and Lysosomal Targeting of Therapeutic Receptor:Ligand Complexes. Mol. Ther. 2015, 23, 1888−98. (15) Miura, Y.; Sukawa, Y.; Hironaka, S.; Mori, M.; Nishikawa, K.; Tokunaga, S.; Okuda, H.; Sakamoto, T.; Taku, K.; Nishikawa, K.; Moriwaki, T.; Negoro, Y.; Kimura, Y.; Uchino, K.; Shinozaki, K.; Shinozaki, H.; Musha, N.; Yoshiyama, H.; Tsuda, T.; Miyata, Y.; Sugimoto, N.; Shirakawa, T.; Ito, M.; Yonesaka, K.; Yoshimura, K.; Boku, N.; Nosho, K.; Takano, T.; Hyodo, I. Five-weekly S-1 plus cisplatin therapy combined with trastuzumab therapy in HER2-positive gastric cancer: a phase II trial and biomarker study (WJOG7212G). Gastric Cancer 2018, 21, 84−95. (16) Nishikawa, K.; Takahashi, T.; Takaishi, H.; Miki, A.; Noshiro, H.; Yoshikawa, T.; Nishida, Y.; Iwasa, S.; Miwa, H.; Masuishi, T.; Boku, N.; Yamada, Y.; Kodera, Y.; Yoshida, K.; Morita, S.; Sakamoto, J.; Saji, S.; Kitagawa, Y. Phase II study of the effectiveness and safety of trastuzumab and paclitaxel for taxane- and trastuzumab-naive patients with HER2-positive, previously treated, advanced, or recurrent gastric cancer (JFMC45−1102). Int. J. Cancer 2017, 140, 188−196.

(17) Mahlknecht, G.; Sela, M.; Yarden, Y. Aptamer Targeting the ERBB2 Receptor Tyrosine Kinase for Applications in Tumor Therapy. Methods Mol. Biol. 2015, 1317, 3−15. (18) Yu, X.; Ghamande, S.; Liu, H.; Xue, L.; Zhao, S.; Tan, W.; Zhao, L.; Tang, S. C.; Wu, D.; Korkaya, H.; Maihle, N. J.; Liu, H. Y. Targeting EGFR/HER2/HER3 with a Three-in-One Aptamer-siRNA Chimera Confers Superior Activity against HER2(+) Breast Cancer. Mol. Ther.– Nucleic Acids 2018, 10, 317−330. (19) Boku, N. HER2-positive gastric cancer. Gastric Cancer 2014, 17, 1−12. (20) Petrizzo, A.; Conte, C.; Tagliamonte, M.; Napolitano, M.; Bifulco, K.; Carriero, V.; De Stradis, A.; Tornesello, M. L.; Buonaguro, F. M.; Quaglia, F.; Buonaguro, L. Functional characterization of biodegradable nanoparticles as antigen delivery system. J. Exp. Clin. Cancer Res. 2015, 34, 114. (21) Niazi, J. H.; Verma, S. K.; Niazi, S.; Qureshi, A. In vitro HER2 protein-induced affinity dissociation of carbon nanotube-wrapped antiHER2 aptamers for HER2 protein detection. Analyst 2015, 140, 243−9. (22) Kwon, S.; Duarte, J. N.; Li, Z. Y.; Ling, J. J. J.; Cheneval, O.; Durek, T.; Schroeder, C. I.; Craik, D. J.; Ploegh, H. L. Targeted Delivery of Cyclotides via Conjugation to a Nanobody. ACS Chem. Biol. 2018, 13, 2973−2980. (23) Liu, B.; Song, C. Y.; Zhu, D.; Wang, X.; Zhao, M. Z.; Yang, Y. J.; Zhang, Y. N.; Su, S.; Shi, J. Y.; Chao, J.; Liu, H. J.; Zhao, Y.; Fan, C. H.; Wang, L. H. DNA-Origami-Based Assembly of Anisotropic Plasmonic Gold Nanostructures. Small 2017, 13, 1603991. (24) Kearney, C. J.; Lucas, C. R.; O’Brien, F. J.; Castro, C. E. DNA Origami: Folded DNA-Nanodevices That Can Direct and Interpret Cell Behavior. Adv. Mater. 2016, 28, 5509−5524. (25) Farimani, A. B.; Dibaeinia, P.; Aluru, N. R. DNA OrigamiGraphene Hybrid Nanopore for DNA Detection. ACS Appl. Mater. Interfaces 2017, 9, 92−100. (26) Tikhomirov, G.; Petersen, P.; Qian, L. L. Fractal assembly of micrometre-scale DNA origami arrays with arbitrary patterns. Nature 2017, 552, 67−71. (27) Gopfrich, K.; Li, C. Y.; Ricci, M.; Bhamidimarri, S. P.; Yoo, J.; Gyenes, B.; Ohmann, A.; Winterhalter, M.; Aksimentiev, A.; Keyser, U. F. Large-Conductance Transmembrane Porin Made from DNA Origami. ACS Nano 2016, 10, 8207−8214. (28) Shaw, A.; Benson, E.; Hogberg, B. Purification of Functionalized DNA Origami Nanostructures. ACS Nano 2015, 9, 4968−4975. (29) Gerling, T.; Kube, M.; Kick, B.; Dietz, H. Sequence-programmable covalent bonding of designed DNA assemblies. Sci. Adv. 2018, 4, eaau1157. (30) Liu, X.; Zhang, F.; Jing, X.; Pan, M.; Liu, P.; Li, W.; Zhu, B.; Li, J.; Chen, H.; Wang, L.; Lin, J.; Liu, Y.; Zhao, D.; Yan, H.; Fan, C. Complex silica composite nanomaterials templated with DNA origami. Nature 2018, 559, 593−598. (31) Lin, M. H.; Song, P.; Zhou, G. B.; Zuo, X. L.; Aldalbahi, A.; Lou, X. D.; Shi, J. Y.; Fan, C. H. Electrochemical detection of nucleic acids, proteins, small molecules and cells using a DNA-nanostructure-based universal biosensing platform. Nat. Protoc. 2016, 11, 1244−1263. (32) Chao, J.; Wang, J.; Wang, F.; Ouyang, X.; Kopperger, E.; Liu, H.; Li, Q.; Shi, J.; Wang, L.; Hu, J.; Wang, L.; Huang, W.; Simmel, F. C.; Fan, C. Solving mazes with single-molecule DNA navigators. Nat. Mater. 2019, 18, 273. (33) Tripathi, R.; Kumar, A. Application of Nanorobotics for Cancer Treatment. Mater. Today-Proc. 2018, 5, 9114−9117. (34) Li, S. P.; Jiang, Q.; Liu, S. L.; Zhang, Y. L.; Tian, Y. H.; Song, C.; Wang, J.; Zou, Y. G.; Anderson, G. J.; Han, J. Y.; Chang, Y.; Liu, Y.; Zhang, C.; Chen, L.; Zhou, G. B.; Nie, G. J.; Yan, H.; Ding, B. Q.; Zhao, Y. L. A DNA nanorobot functions as a cancer therapeutic in response to a molecular trigger in vivo. Nat. Biotechnol. 2018, 36, 258. (35) Singh, H. R.; Kopperger, E.; Simmel, F. C. A DNA Nanorobot Uprises against Cancer. Trends Mol. Med. 2018, 24, 591−593. (36) Torelli, E.; Marini, M.; Palmano, S.; Piantanida, L.; Polano, C.; Scarpellini, A.; Lazzarino, M.; Firrao, G. A DNA Origami Nanorobot Controlled by Nucleic Acid Hybridization. Small 2014, 10, 2918− 2926. L

DOI: 10.1021/acs.nanolett.9b01320 Nano Lett. XXXX, XXX, XXX−XXX

Letter

Nano Letters (37) Chen, X. Z.; Hoop, M.; Shamsudhin, N.; Huang, T. Y.; Ozkale, B.; Li, Q.; Siringil, E.; Mushtaq, F.; Di Tizio, L.; Nelson, B. J.; Pane, S. Hybrid Magnetoelectric Nanowires for Nanorobotic Applications: Fabrication, Magnetoelectric Coupling, and Magnetically Assisted In Vitro Targeted Drug Delivery. Adv. Mater. 2017, 29, 1. (38) Zeeshan, M. A.; Shou, K. Y.; Sivaraman, K. M.; Wuhrmann, T.; Pane, S.; Pellicer, E.; Nelson, B. J. Nanorobotic drug delivery If I only had a heart. Mater. Today 2011, 14, 54−54. (39) Li, J.; Fan, C. H.; Pei, H.; Shi, J. Y.; Huang, Q. Smart Drug Delivery Nanocarriers with Self-Assembled DNA Nanostructures. Adv. Mater. 2013, 25, 4386−4396. (40) Liu, M.; Ma, W.; Li, Q.; Zhao, D.; Shao, X.; Huang, Q.; Hao, L.; Lin, Y. Aptamer-targeted DNA nanostructures with doxorubicin to treat protein tyrosine kinase 7-positive tumours. Cell Proliferation 2019, 52, No. e12511. (41) Kim, K. R.; Kim, D. R.; Lee, T.; Yhee, J. Y.; Kim, B. S.; Kwon, I. C.; Ahn, D. R. Drug delivery by a self-assembled DNA tetrahedron for overcoming drug resistance in breast cancer cells. Chem. Commun. (Cambridge, U. K.) 2013, 49, 2010−2. (42) Xie, X.; Shao, X.; Ma, W.; Zhao, D.; Shi, S.; Li, Q.; Lin, Y. Overcoming drug-resistant lung cancer by paclitaxel loaded tetrahedral DNA nanostructures. Nanoscale 2018, 10, 5457−5465. (43) Zeng, D.; Wang, Z.; Meng, Z.; Wang, P.; San, L.; Wang, W.; Aldalbahi, A.; Li, L.; Shen, J.; Mi, X. DNA Tetrahedral NanostructureBased Electrochemical miRNA Biosensor for Simultaneous Detection of Multiple miRNAs in Pancreatic Carcinoma. ACS Appl. Mater. Interfaces 2017, 9, 24118−24125. (44) Bai, S.; Xu, B.; Guo, Y.; Qiu, J.; Yu, W.; Xie, G. HighDiscrimination Factor Nanosensor Based on Tetrahedral DNA Nanostructures and Gold Nanoparticles for Detection of MiRNA-21 in Live Cells. Theranostics 2018, 8, 2424−2434. (45) Zhang, Y. X.; Ma, W. J.; Zhu, Y.; Shi, S. R.; Li, Q. S.; Mao, C. C.; Zhao, D.; Zhan, Y. X.; Shi, J. Y.; Li, W.; Wang, L. H.; Fan, C. H.; Lin, Y. F. Inhibiting Methicillin-Resistant Staphylococcus aureus by Tetrahedral DNA Nanostructure-Enabled Antisense Peptide Nucleic Acid Delivery. Nano Lett. 2018, 18, 5652−5659. (46) Shi, S. R.; Lin, S. Y.; Li, Y.; Zhang, T.; Shao, X. R.; Tian, T. R.; Zhou, T. F.; Li, Q. S.; Lin, Y. F. Effects of tetrahedral DNA nanostructures on autophagy in chondrocytes. Chem. Commun. 2018, 54, 1327−1330. (47) Tian, T. R.; Zhang, T.; Zhou, T. F.; Lin, S. Y.; Shi, S. R.; Lin, Y. F. Synthesis of an ethyleneimine/tetrahedral DNA nanostructure complex and its potential application as a multi-functional delivery vehicle. Nanoscale 2017, 9, 18402−18412. (48) Shao, X. R.; Ma, W. J.; Xie, X. P.; Li, Q. S.; Lin, S. Y.; Zhang, T.; Lin, Y. F. Neuroprotective Effect of Tetrahedral DNA Nanostructures in a Cell Model of Alzheimer’s Disease. ACS Appl. Mater. Interfaces 2018, 10, 23682−23692. (49) Shi, S.; Peng, Q.; Shao, X.; Xie, J.; Lin, S.; Zhang, T.; Li, Q.; Li, X.; Lin, Y. Self-Assembled Tetrahedral DNA Nanostructures Promote Adipose-Derived Stem Cell Migration via lncRNA XLOC 010623 and RHOA/ROCK2 Signal Pathway. ACS Appl. Mater. Interfaces 2016, 8, 19353−63. (50) Ma, W.; Shao, X.; Zhao, D.; Li, Q.; Liu, M.; Zhou, T.; Xie, X.; Mao, C.; Zhang, Y.; Lin, Y. Self-Assembled Tetrahedral DNA Nanostructures Promote Neural Stem Cell Proliferation and Neuronal Differentiation. ACS Appl. Mater. Interfaces 2018, 10, 7892−7900. (51) Ma, W. J.; Xie, X. P.; Shao, X. R.; Zhang, Y. X.; Mao, C. C.; Zhan, Y. X.; Zhao, D.; Liu, M. T.; Li, Q. S.; Lin, Y. F. Tetrahedral DNA nanostructures facilitate neural stem cell migration via activating RHOA/ROCK2 signalling pathway. Cell Proliferation 2018, 51, e12554. (52) Amaravadi, R. K.; Thompson, C. B. The roles of therapy-induced autophagy and necrosis in cancer treatment. Clin. Cancer Res. 2007, 13, 7271−9. (53) Lavakhamseh, H.; Mohajeri, P.; Rouhi, S.; Shakib, P.; Ramazanzadeh, R.; Rasani, A.; Mansouri, M. Multidrug-Resistant Escherichia coli Strains Isolated from Patients Are Associated with Class 1 and 2 Integrons. Chemotherapy 2016, 61, 72−6.

(54) Li, Y.; Sun, Y.; Jing, L.; Wang, J.; Yan, Y.; Feng, Y.; Zhang, Y.; Liu, Z.; Ma, L.; Diao, A. Lysosome Inhibitors Enhance the Chemotherapeutic Activity of Doxorubicin in HepG2 Cells. Chemotherapy 2017, 62, 85−93. (55) Han, Y. P.; Li, X. M.; Chen, H. B.; Hu, X. J.; Luo, Y.; Wang, T.; Wang, Z. J.; Li, Q.; Fan, C. H.; Shi, J. Y.; Wang, L. H.; Zhao, Y.; Wu, C. F.; Chen, N. Real-Time Imaging of Endocytosis and Intracellular Trafficking of Semiconducting Polymer Dots. ACS Appl. Mater. Interfaces 2017, 9, 21200−21208.

M

DOI: 10.1021/acs.nanolett.9b01320 Nano Lett. XXXX, XXX, XXX−XXX