Subscriber access provided by Gothenburg University Library
Article
Analysis of Plasmodium vivax Chloroquine Resistance Transporter (PvCRT) Mutant Isoforms Matthew R. Hassett, Bryce E. Riegel, Paul Samuel Callaghan, and Paul David Roepe Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.7b00749 • Publication Date (Web): 12 Sep 2017 Downloaded from http://pubs.acs.org on September 13, 2017
Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.
Biochemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.
Page 1 of 29
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
Analysis of Plasmodium vivax Chloroquine Resistance Transporter (PvCRT) Mutant Isoforms
Matthew R. Hassett, Bryce E. Riegel, Paul S. Callaghan & Paul D. Roepe*
Depts. of Chemistry and of Biochemistry & Cellular & Molecular Biology Georgetown University 37th and O Streets NW Washington DC 20057
Address correspondence to PDR; email:
[email protected], tel: 202 687 7300
pg. 1
ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Abstract Chloroquine (CQ) resistance (CQR) in Plasmodium falciparum malaria is widespread and has limited the use of CQ in many regions of the globe. Malaria caused by the related human parasite P. vivax is as widespread as is P. falciparum malaria and has been treated with CQ as extensively as has P. falciparum, suggesting that P. vivax parasites have been selected with CQ as profoundly as have P. falciparum parasites. Indeed, a growing number of clinical reports have presented data suggesting increased P. vivax CQR. Cytostatic (growth inhibitory) CQR for P. falciparum is caused by PfCRT mutations and it has been proposed that mutations in the PvCRT orthologue may similarly cause P. vivax CQR via increasing CQ transport from the P. vivax digestive vacuole. Here we report the first quantitative analysis of drug transport mediated by all known mutant isoforms of Plasmodium vivax chloroquine resistance transporter (PvCRT) in order to test the protein’s potential link to growing P. vivax CQR phenomena. Small, but statistically significant differences in the transport of CQ and other quinoline antimalarial drugs were found for multiple PvCRT isoforms, relative to wild type PvCRT, suggesting that mutations in PvCRT can contribute to P. vivax CQR and other examples of quinoline antimalarial drug resistance.
Introduction Plasmodium vivax malaria is a major health burden. Globally, although P. falciparum infections account for most deaths from malaria, outside the African continent the risk of acquiring P. vivax vs P. falciparum malaria is similar, with approximately 14 million cases of P. vivax malaria reported in 20151. Historically, drugs used to treat P. falciparum infections (such as chloroquine [CQ]) have also been used to treat P. vivax malaria patients, and due to cost and
pg. 2
ACS Paragon Plus Environment
Page 2 of 29
Page 3 of 29
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
other issues, CQ remains a frontline therapy for P. vivax malaria. While CQ resistance (CQR) began to emerge in P. falciparum beginning in the late 1960s, P. vivax CQR (PvCQR) has only been documented much more recently, beginning in 1989 in Papua New Guinea2.
Today,
PvCQR is an extremely serious, rapidly growing problem that puts millions at risk. Although PfCQR is becoming well understood, the mechanism(s) behind PvCQR are not well described. In the case of PfCQR, although they do not explain much of the resistance to the parasite kill (cytocidal) effects of CQ, mutations in the P. falciparum chloroquine resistance transporter gene pfcrt are the primary cause of resistance to the cytostatic or parasite growth inhibitory effects of CQ3. The mutations in pfcrt associated with PfCQR encode amino acid substitutions in the encoded PfCRT protein and multiple substitutions (typically 4 - 8) are required to convert PfCRT to an isoform capable of mediating PfCQR. There are now at least 53 distinct PfCRT isoforms known to exist, that collectively mediate a range of resistance phenomena4. For decades, it was believed that altered CQ transport within PfCQR parasites was the molecular basis of PfCQR, and upon the discovery of pfcrt mutations linked to PfCQR3, 5 mutant PfCRT protein was hypothesized to catalyze this altered transport. Indeed, for cytostatic CQR subsequent work validated this general hypothesis4, 6-8 and also showed the same PfCRT mutations perturb parasite digestive vacuolar physiology9-11. The 53 distinct known PfCRT isoforms mediate a range of CQ transport phenomena4. For over a decade the key K76T substitution found in CQR - conferring mutant PfCRT isoforms was believed to be diagnostic for altered CQ transport mediated by mutant PfCRTs, but recent work has shown that some K76T second - site revertants do not catalyze altered CQ transport relative to wild type PfCRT4. In addition, more recent data show that increased transport of CQ due to mutant PfCRT is necessary, but not sufficient, for resistance to the cytocidal (parasite kill) effects of CQ, with
pg. 3
ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
dysregulation in parasite autophagy and perhaps other processes further contributing to P. falciparum cytocidal CQR10. Overall, although the picture is now known to be more complex, altered CQ transport catalyzed by mutant PfCRT isoforms remains a key factor in mediating PfCQR phenomena. The P. vivax genome encodes a 424 amino acid, polytopic membrane protein very similar to PfCRT. The P. vivax CRT orthologue (PvCRT) was first identified in 2001 and the two proteins (PfCRT and PvCRT) were found to be 73% identical, and at least 85 % homologous12. While the endogenous function of PfCRT and PvCRT remains undefined, they are hypothesized to transport small molecules or ions across the DV membrane8, 13-16. The role that PvCRT might play in PvCQR phenomena is currently unclear. Despite the high degree of identity between PvCRT and PfCRT, and the obvious hypothesis that PvCRT mutations might confer PvCQR phenomena similar to how PfCRT mutations cause PfCQR, there has been very little analysis of drug transport or other effects mediated by PvCRT. Yet, it is imperative to examine whether similar drug transport phenomena are relevant for PvCQR. To our knowledge, in contrast to 53 PfCRTs, to date only 8 unique PvCRT isoforms have been identified from around the globe12,
18, 19
. Four of these; CQS3, CQS8, CQR1, and CQR3
(described in "Results") were first identified in a single study from Brazil with two sequenced from parasite isolates derived from patients for whom CQ therapy had failed. The implication is that these two parasite isolates are CQR and that mutations in the PvCRT isoforms found in these isolates may therefore confer PvCQR. Additional PvCRT isoforms have been observed in isolates from different locations that were initially characterized as either CQS or CQR based largely on clinical outcome
18,19
. In contrast, some studies have found clear evidence of PvCQR
via clinical data, but no PvCRT mutations were then found within the corresponding P. vivax
pg. 4
ACS Paragon Plus Environment
Page 4 of 29
Page 5 of 29
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
parasites isolated from these patients20. Taken together, these data illustrate why the role of PvCRT mutations in mediating PvCQR phenomena continues to be debated12, 18-22. Interestingly, contrary to the 53 distinct, geographically disposed patterns of multiple PfCRT amino acid substitutions (4 - 8) associated with different PfCQR phenotypes, with two exceptions every mutant PvCRT isoform so far discovered shows only a single amino acid substitution. These occur at unique positions relative to PfCRT substitutions12, 18. For example, one of the most commonly observed PvCRT isoforms, "K10", has a lysine residue inserted at position 10, which to our knowledge has never been observed for any PfCRT. If these unique PvCRT mutations are linked to PvCQR, then this would be somewhat surprising because even though outside Africa the overall global incidence of vivax and falciparum malaria is similar, and even though CQ has been used equally extensively to treat both vivax and falciparum malaria, PvCQR has taken (is taking) much longer to evolve around the globe, relative to PfCQR. Yet, statistically speaking, it would be expected that single amino acid substitutions (e.g. those found in PvCRT) would evolve faster than complex patterns of multiple (4 - 8) amino acid substitutions (e.g. those found in PfCRT) for essentially the same protein found in highly related species selected with similar toxic drug pressure via the same drug. Two studies have previously suggested that wild type PvCRT (expressed in CQS P. vivax) transports CQ, and that it transports the drug more efficiently than mutant, CQR associated PfCRT isoforms. The first hint of increased CQ transport by wild type PvCRT came from the observation of increased CQ IC50 for a P. falciparum strain engineered to express a PvCRT isoform found in a CQS strain of P. vivax.23
Subsequently, a detailed side-by-side
analysis of CQ transport by CRT proteins heterologously expressed in yeast found increased CQ transport mediated by wild type PvCRT relative to transport mediated by the CQR associated
pg. 5
ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 6 of 29
PfCRT isoform expressed in the CQR P. falciparum strain Dd2.24 As previously mentioned, PvCRT and PfCRTare 73% identical and 85% similar. Most differences are found within the first N terminal 60 amino acids, which are believed to be outside the first predicted transmembrane domain.
In PfCRT this region does not appear to interact with CQ25, so
presumably these amino acid differences do not account for the differences in CQ transport mediated by wild type PvCRT vs mutant PfCRT24. Further progress is hampered by the difficulty in culturing P. vivax.
Methods for
culturing P. falciparum in the presence of mature red blood cells have existed for decades, but since P. vivax prefers to invade immature reticulocytes, without a continuous fresh supply of these, tissue culturing is currently not routine26.
Rapid and more experimentally tractable
methods are needed to effectively analyze PvCRT function. Thus, using a previously designed galactose inducible CRT expression system, we have expressed all known isoforms of PvCRT to similar levels in S. cerevisiae yeast. Using these strains and previous methods4,17 we have analyzed CQ transport mediated by all known PvCRT isoforms. Since the related quinoline antimalarial drug amodiaquine (AQ) has been extensively used in certain vivax endemic regions, we have also tested whether mutant PvCRT proteins mediate altered AQ transport. Additionally, as primaquine (PQ) is the only FDA approved drug vs latent P. vivax hypnozoites, we endeavored to see whether mutant PvCRT facilitated altered PQ transport. We find that elevated transport of CQ by specific PvCRT isoforms is a possible explanation for P. vivax CQR in some, but not all, PvCQR isolates12, 18 and that certain mutant PvCRT isoforms are likely capable of mediating low levels of resistance to AQ and PQ.
Materials and Methods
pg. 6
ACS Paragon Plus Environment
Page 7 of 29
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
Materials. Cell culture plastics were from BD Falcon. Glass beads for cell lysis were from B. Braun Biotech (Allentown, PA). Yeast DOB medium lacking amino acids was supplied in powder form from MP Biomedicals (Solon, OH) and glucose, galactose, and raffinose were from Sigma (St. Louis, MO). Site-directed mutagenesis reagents were from Agilent (Santa Clara, CA) and Anti-V5-HRP antibody was from Invitrogen (Carlsbad, CA).
Radiolabeled AQ was
purchased from American Radiolabeled Chemicals Inc. (St. Louis, MO). All other chemicals were reagent grade or better, purchased from Sigma and used without additional purification. Yeast Strains and Methods. Yeast strains used for quantitative growth rate analysis were typically created from transfection of strain CH1305 (MATa ade2 ade3 ura3-52 leu2 lys2-801), which was supplied by J.F. Cannon27. Solid and liquid media were prepared as described in Sherman et al.,4, 24, 28 and included synthetic complete (SC) media lacking one or more specified amino acids, as well as rich medium (YPD). Induction of CRT protein expression was achieved by adding 2% galactose and 1% raffinose to SC media (then called SGR media) lacking uracil as described previously4,17,24. Plasmids and Mutagenesis. Plasmid pYES2 containing PvCRTWTvh was constructed previously using native pvcrt cDNA kindly provided by Dr. T. Wellems, NIH / NIAID24. This construct was used as template for all subsequent rounds of site-directed mutagenesis mediated by the oligonucleotides listed in Table 1.
Site - specific mutagenesis was as previously
described4,17; in brief, the Agilent QUICKChange mutagenesis method was used to create the 7 additional known isoforms of PvCRT (see Results). All constructs were confirmed by full length DNA sequencing of the pvcrt gene.
pg. 7
ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Name K10
Page 8 of 29
Sequence (5’-3’) CCTGAAAAAGAAGAAGAAGAAGGGGAGTCCCC
L34H
CACTTTGTTTGGCTACTTCTTCGGATCCATCATCTACC
P38L
GCGAAATACAAGAGGACGTCCTCATCAGCAGAAAAATCGCC
L47S
GAAAAATCGCCAATTTTTCGAAGCTAGCTTATAATG
L242P
GTACAAAATAAACATCCCGCGCCTGAACGCC
S249P
GCCTGAACGCCGTTGTTCCCTTCTTCCAAATATTCAC
F275V
GCAAATCAATTTGCCCGTCTCGGAAATCGG
L384F
CACTTTGTTTGGCTACTTCTTCGGATCCATCATCTACC
Y390C
CCTCTTCGGATCCATCATCTGCCGCATAGGAAAC
Table 1: Mutagenic oligonucleotides used in this study.
Preparation of Yeast Membranes. Yeast membranes were isolated using a glass bead lysis method with some modifications29. Cultures were grown in SGR-inducing media overnight and harvested at 3000g for 5 minutes. Cells were washed three times with 500 µL of harvest buffer (100 mM glucose, 50 mM imidazole, 5 mM DTT, pH 7.5). Washed cells were suspended in 500 µL breaking buffer (0.1 M glucose, 0.25 M sucrose, 50 mM imidazole, 1 mM MgCl2, 5 mM DTT, protease inhibitor cocktail (PIC), pH 7.5) and lysed by an equal volume of glass beads (0.5mm)29. The bead/pellet mixture was vortexed for 30 seconds at one-minute intervals for 20 minutes (10 total minutes of blending) using an Eppendorf 5415 D microcentrifuge (Hauppauge,
pg. 8
ACS Paragon Plus Environment
Page 9 of 29
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
NY). Bead/lysate mixture was spun at 300g to draw the glass beads to the bottom of the tube. The supernatant was transferred to a fresh microfuge tube and spun at 700g for 5 minutes. The supernatant was transferred to a fresh tube and spun at 1300g for 5 minutes. The resulting supernatant was transferred to a Ti-70.1 ultracentrifuge tube and spun at 100,000g for one hour. Resulting CM pellets were resuspended in a minimal amount of suspension buffer. Membranes were stored at -80°C prior to determination of protein content via Western blotting. Western Blotting. Was as described previously24. Quantitative Growth Rate Analysis.
Was performed under CRT-inducing conditions as
previously described for CQ- and PQ-dependent growth delay analyses4,
17, 24
. AQ-dependent
growth delays (pH 6.75, 2.0 mM AQ) were measured using previously described protocols for PQ4. Reported values are the average of at least four independent assays, with each assay conducted in triplicate (12 determinations in total). Error bars depict the standard error of the mean (SEM) for each reported value. [3H]AQ Whole Cell Accumulation Assays. [3H]AQ transport specific to PvCRT was assayed at pH 6.75 essentially as previously described for PfCRT mediated [3H]CQ transport, with minor modifications24 as described in Results.
Results Previously, we have expressed “yeast-codon-optimized” versions of pfcrt genes in S. cerevisiae yeast under control of either MeOH or galactose - inducible promoters4,17,24. Expression of PvCRT in S. cerevisiae is less onerous since the P. falciparum genome is 81% AT, but P. vivax is 58%. AT content is slightly less for the crt sequences with 72% AT for pfcrt and 54% for pvcrt, making native pvcrt codon usage similar to that of S. cerevisiae overall usage.
pg. 9
ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 10 of 29
Therefore, codon optimization to create a “yeast-codon-optimized” pvcrt gene is not necessary presumably because of the abundance of preferred yeast codons in the endogenous pvcrt gene. Indeed, previously, we were able to express native pvcrt cDNA in yeast to provide wild type PvCRT at yields similar to those for PfCRT encoded by yeast codon optimized pfcrt24. Using this PvCRT construct as template, we performed site-directed mutagenesis to create pvcrt genes encoding all 8 known PvCRT isoforms so far discovered (Table 2, Fig. 1). To our knowledge, these 8 represent all unique PvCRT isoforms so far identified12, 18, 19 (Table 2, Fig. 1).
Table 2: PvCRT isoforms. Origin = region where isolate harboring the PvCRT isoform was first obtained. Green cells are mutated residues at the designated positions (top, red) compared to the WT sequence (also known as "Sal-I").
Three of these PvCRTs have been found in PvCQR isolates (CL002, CQR1, and CQR3), 4 in PvCQS isolates (Sal-I (WT), CQS3, CQS8, and Chesson), and 1 has been found in both PvCQS and PvCQR isolates (K10)12, 18, 19 with CQR vs CQS status largely defined via clinical criteria. Expression of these PvCRTs in S. cerevisiae was similar for each isoform and levels of
pg. 10
ACS Paragon Plus Environment
Page 11 of 29
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
Figure 1: The position of all known naturally occurring PvCRT mutations superimposed upon the predicted topology of PvCRT generated using TMRPres2D. Mutations that have been observed in isolates from patients showing reduced response to CQ are circled in red, and the position of the one amino acid insertion noted to date is circled in blue.
PvCRT protein found in yeast membranes were comparable to that of PfCRT isoforms previously expressed (e.g. "HB3" PfCRT, left, Fig. 2)4, 17.
Figure 2: Western blot showing equal expression of all PvCRT isoforms, and to levels similar to those previously observed for PfCRT (left, "HB3" = wild type PfCRT). 7 µg of membrane protein are in each lane.
pg. 11
ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 12 of 29
To test whether these isoforms of PvCRT transport CQ, yeast strains expressing each isoform were first plated +/- external CQ at various concentrations under both non-inducing (+ glucose) and CRT - inducing (+ galactose/raffinose) conditions as described previously for PfCRT expressing yeast17, 24. These colony formation assays have previously been shown to reveal even subtle differences in CQ transport for CQS - associated vs CQR - associated PfCRT isoforms17, 24. Under non-inducing conditions (where CRT is not expressed), all yeast strains grow similarly at all CQ concentrations (Fig. 3A). However, similar to results with PfCRT expressing yeast17, 24, under inducing conditions where CRT is expressed, increasing amounts of CQ progressively inhibit yeast colony formation for yeast expressing functional PvCRT (Fig. 3B). Similar to PfCRT expressing yeast, this is due to PvCRT localization at the yeast plasma membrane catalyzing transport of toxic CQ into the yeast4, 17, 24. Strains maintaining the empty expression vector ("EV" far left, Fig. 3B) do not show decreased growth under inducing conditions at increased concentrations of CQ since no CQ transporter is present at the yeast plasma membrane to facilitate influx of the drug4,
17, 24
.
However, at approximately 3 mM
external CQ (corresponding to [CQ] expected within the parasite digestive vacuole at therapeutic blood concentrations of the drug30), a clear distinction between EV yeast vs yeast expressing PvCRT isoforms and yeast expressing PfCRT isoforms is revealed (Fig. 3B). At progressively higher [CQ] differences are revealed for yeast expressing different PvCRT or PfCRT isoforms that catalyze CQ transport with different efficiencies (e.g. compare "HB3" and "Dd2" PfCRT, lanes 2,3 Fig. 3B, to lanes 4-9, 11 Fig. 3B; as described previously17, 24 to the eye there is a small difference that can be confirmed by densitometry of the colony spots and subsequent quantitative growth analysis17). Interestingly, these data show that most PvCRT isoforms transport CQ more
pg. 12
ACS Paragon Plus Environment
Page 13 of 29
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
efficiently than does the Dd2 PfCRT isoform associated with PfCQR, a conclusion also reached previously for wild type PvCRT24. By contrast, yeast expressing PvCRT isoform CQR1, which was first identified in a CQR isolate18 showed lower growth inhibition upon external CQ exposure compared to the other PvCRT isoforms (Fig 3B, second lane from right) that was similar to that observed for HB3 or Dd2 PfCRT.
Figure 3: Colony formation assay revealing different CQ transport mediated by different PvCRT isoforms. Yeast were spotted at three ten-fold dilutions (top, middle, bottom, each panel) under non inducing (left) vs inducing (right) conditions and at different concentrations of (CQ (left side) as previously described17,
24
. Inward transport of CQ that impedes yeast growth is not
observed for any strains when CRT is not being expressed (left), however, under inducing conditions PvCRT isoforms are found to transport CQ better than either CQS (HB3) or CQR
pg. 13
ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 14 of 29
(Dd2) associated PfCRTs. Via the spotting assays a small (approximately 50 %) difference between strains expressing PfHB3 and PfDd2 is measured at 24 mM CQ upon densitometry of colony spots, which can then be better quantified by quantitative growth curve analysis as described24. EV indicates yeast harboring an empty vector negative control.
Next, similar to our work with PfCRT expressing strains, quantitative growth curve analysis in liquid media was done under optimized inducing conditions to firmly quantify the different CQ transport mediated by these PvCRT isoforms. Previous work showed that these quantified growth rates were linearly correlated with isoform specific [3H]CQ transport17. The quantified growth delays due to the expression of individual PvCRT isoforms were verified vs control PfCRT HB3 mediated growth delays in every PvCRT experiment (see Methods). Fig. 4 summarizes these data and shows that 5 PvCRT isoforms (Sal-I, K10, Chesson, CL002, and CQR1) catalyze CQ transport that is only slightly higher than that catalyzed by Dd2 PfCRT found in PfCQR strains. Interestingly, however, 2 PvCRT isoforms (CQS3 and CQS8) catalyzed statistically significant lower CQ transport, and one (CQR3) catalyzed statistically significant higher transport, relative to wild type (Sal I) PvCRT. Using calibration curves published previously17,24 we calculate that these differences correspond to a change in turnover of approximately 0.12 - 0.24 pmol CQ / 106 cells / min lower and approximately 0.3 pmol CQ / 106 cells / min higher transport, for CQS3, CQS8 and CQR3 PvCRTs, respectively, relative to wild type PvCRT. These data show that single mutations in PvCRT do have the ability to confer altered CQ transport, which suggests that at least some PvCRT mutations may alter P. vivax sensitivity to CQ.
pg. 14
ACS Paragon Plus Environment
Page 15 of 29
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
Figure 4: Quantification of CQ transport mediated by PvCRT (right 8 bars) and PfCRT (left 2 bars) via TECAN quantification of CQ and CRT dependent yeast growth rates as described previously17,24.
CQ- and PvCRT-dependent growth delays were measured under standard
conditions (pH 6.75, 16 mM CQ) and CQ transport calculated as described17, 24. * indicates p value < 0.05 vs. wild type (Sal I) PvCRT.
Since the related 4-aminoquinoline drug AQ has been used extensively in S. America, where P. vivax is endemic, it is conceivable that over time AQ pressure may have profoundly selected for mutant PvCRT isoforms that catalyze altered AQ transport. All yeast strains expressing PvCRT isoforms showed large AQ and PvCRT - dependent growth delays relative to yeast expressing either CQS associated (HB3) or CQR associated (Dd2) PfCRT isoforms (Fig. 5). With the exception of CQS8, differences in growth rates for all yeast expressing different mutant PvCRTs were statistically significant from yeast expressing wild type Sal I PvCRT, and all yeast expressing all PvCRT isoforms (including the wild type) showed statistically different
pg. 15
ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 16 of 29
transport relative to yeast expressing either wild type (HB3) or CQR associated (Dd2) PfCRT (Fig. 5, left Y axis).
Figure 5: AQ dependent growth delay of yeast expressing PvCRT isoforms. Growth delays were quantified under standard conditions (pH 6.75 and 2.0 mM AQ) as described4,17,24. All PvCRT isoforms transport AQ more efficiently than do PfCRT isoforms HB3 and Dd2. * indicates p value < 0.05 vs. PvCRT WT.
Previously we showed that CRT - mediated [3H]CQ transport was linearly correlated with quantified CQ and CRT dependent growth delays (Fig. 4 caption), however, direct [3H]AQ transport in this yeast model system has not previously been done. Thus, we tested whether a similar correlation between growth delay and inward transport of the drug also holds for AQ. Direct [3H]AQ measurement using whole yeast was done using methods reported previously for
pg. 16
ACS Paragon Plus Environment
Page 17 of 29
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
[3H]CQ24 (see "Methods").
As predicted, a strong linear correlation between [3H]AQ
accumulation and AQ dependent growth delay (R2=0.93) was found for yeast expressing the various PvCRT isoforms (Fig. 6; note SEM < 10 % for each data point). Using this correlation, similar to calculation of CQ transport (right Y axis, Fig. 4), AQ transport was tabulated for the different PvCRT isoforms (right Y axis, Fig. 5).
Figure 6. Linear correlation between PvCRT mediated AQ growth delay and PvCRT [3H]AQ transport (R2= 0.93).
Finally, since CQR associated PfCRT isoforms found in Africa were recently found to alter PQ transport4, and since PQ is used clinically to target latent hypnozoites of P. vivax (leading to possible extensive selection of P. vivax vs PQ), we tested whether any PvCRT isoforms perturbed transport of the 8-aminoquinoline drug PQ. We found that PQ-dependent growth delay was substantially reduced for strains expressing PvCRT isoforms relative to yeast expressing HB3 PfCRT (Fig. 7) and more uniform across yeast expressing PvCRT isoforms, relative to yeast expressing PfCRT isoforms4, save one exception. All PvCRT isoforms appear to transport
pg. 17
ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 18 of 29
PQ similar to PfCRT CQR isoform Dd2, however, peculiarly, yeast harboring PvCRT CQR1 showed essentially no growth delay at all, suggesting that PvCRT CQR1 does not transport PQ. Unfortunately, lack of availability of radiolabelled PQ prevented us from quantifying PQ transport further via the methods previously described for CQ17, 24 and AQ (above).
Figure 7. PQ dependent growth delay of yeast expressing PvCRT isoforms measured under standard conditions (pH 6.75 and 1.8 mM PQ). All PvCRT isoforms except one (CQR1) appear to transport PQ similarly to the CQR associated PfCRT isoform Dd2, and well below transport catalyzed by wild type PfCRT HB3. * indicates p value < 0.05 vs. wild type Sal I PvCRT.
Discussion Consistent with other reports24 these data show that P. vivax CRT proteins mediate transport of some quinolone antimalarial drugs still currently in use in the field. Overall, with
pg. 18
ACS Paragon Plus Environment
Page 19 of 29
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
respect to CQ and PQ transport, with a few exceptions most PvCRT isoforms behave similarly to the CQR associated PfCRT isoform Dd2. By contrast, our data show that all PvCRT isoforms transport AQ more efficiently than either CQS or CQR - associated PfCRT isoforms. Typically, PfCRT requires at least 4 amino acid substitutions to show significantly increased CQ transport relative to wild type PfCRT4. It surprising then that the data presented here suggests a single mutation (S249P in PvCRT isoform CQR3) can increase CQ transport by 32% relative to wild type PvCRT. Although this effect is relatively mild, previously it has been demonstrated by several laboratories that single amino acid substitutions in PfCRT can similarly increase CQ transport 30 - 100 % (described below). We suggest that since wild type PvCRT already catalyzes elevated CQ transport relative to all known PfCRTs24 then single amino acid substitutions have a better chance to modestly elevate CQ transport, which then may confer modest levels of PvCQR. There is previous precedent that supports this suggestion. For example, the Ecu1110 PfCRT isoform has only 4 amino acid substitutions relative to HB3 PfCRT. CQ IC50 for transfectants expressing PfCRT harboring 3 of the 4 substitutions was relatively low31. However, addition of the 4th substitution to these 3 for additional transfectants increased CQ IC50 by more than 100%31. Similarly, addition of the single K76T mutation to transform PfCRT isoform S106/1 to FCB PfCRT increases CQ transport by nearly 90%17, and the addition of N326D to PfCRT isoform KT088 to create isoform KT096 increases CQ transport by 31%4. The addition of a single amino acid substitution can also decrease PfCRT catalyzed CQ transport. A similar phenomenon is now also seen for PvCRT isoform CQS8, where CQ transport is diminished by 25% upon F275V substitution and for PvCRT isoform CQS3, where it is diminished by 13% upon a L47S substitution. The mutation of residue E198 to a lysine to
pg. 19
ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 20 of 29
convert PfCRT isoform Dd2 to isoform BC22 was recently found to decrease CQ transport by 39% and C72S substitution for isoform Ecu to create 7G8 PfCRT was recently found to decrease transport by 37%4, 17. Thus, it is not surprising that single amino acid substitutions for PvCRT would be capable of modifying CQ transport to the extent observed in this study. Similar phenomenon have also previously been seen with respect to AQ transport.
Fidock and
colleagues previously showed that the addition of a 4th single mutation to create the Ecu PfCRT isoform (either K76T, A220S, N326D, or I356L) increased md-AQ IC50 by 200%, suggesting increased AQ transport mediated by Ecu PfCRT31. AQ monotherapy first originated in Papua New Guinea and Brazil in 1946 and 1947, respectively32, and successful AQ monotherapy vs vivax malaria is still reported33. However, increased AQ transport by mutant PvCRT relative to wild type PvCRT demonstrated here is consistent with increased reports of reduced effectiveness of AQ monotherapy for some P. vivax isolates. Indeed, although less well studied than PvCQR, as early as 1992 there have been multiple well documented examples of AQ monotherapy failure in adult patients from Papua New Guinea where some of the mutant PvCRT isoforms studied here originate34. AQ failure in pediatric cases have been reported as early as 198935. This trend has continued well into the 21st century and has also recently been documented in nearby Indonesia33, 35, 36. Brazil is the origin of several other PvCRT isoforms studied here, however, AQ monotherapy for Brazilian P. vivax infections is not as well documented. Nonetheless, AQ has been used in Brazil for well over 50 years37, and cases of AQ failure in treating P. falciparum have been reported there since the 1960s38, 39. One 1989 study reported that 73% of Brazilian P. falciparum isolates were resistant to AQ therapy40. Thus, it is likely that prolonged AQ monotherapy in Brazil may have selected
pg. 20
ACS Paragon Plus Environment
Page 21 of 29
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
for increasingly AQ resistant P. vivax, similar to patterns in the development of PfCQR vs PvCQR seen around the globe41, 42 vs selection with CQ. We find that all PvCRT isoforms transport PQ poorly, or in the case of PvCRT CQR1, not at all. Recently, an interesting phenomenon related to PQ transport was described for some CQR PfCRT isoforms. It was noted in a study from Kenya that there was an inverse relationship between CQ and PQ susceptibility43, which was very strongly substantiated in recent work that showed a reciprocal relationship between CQ and PQ transport for these isoforms4. Interestingly, this reciprocal relationship holds only for drug transport mediated by PfCRT isoforms found in isolates from Africa4, but not PfCRTs from other regions of the globe, perhaps because of limited use of PQ in Africa44. Since P. vivax treatment can include the use of PQ to remove hypnozoites, it is perhaps not surprising then to see that correlation between PQ and CQ transport for PvCRT isoforms does not exist, similar to lack of correlation for PfCRT isoforms from regions of the globe where PQ is in use. That is, the reciprocal CQ / PQ relationship is only found in regions where PQ pressure has not been applied to malarial parasites. These data represent the first comprehensive analysis of drug transport for all known PvCRT isoforms. Similar to earlier studies with PfCRT the data suggest that selection of malarial parasites with quinoline - based antimalarial drugs yields mutant PvCRT proteins with complex patterns of quinoline drug transport substrate preferences. Also, importantly, a single amino acid substitution was found to confer slightly increased CQ transport for at least one PvCRT isoform, suggesting that at least mild forms of PvCQR can in theory be conferred by mutation of PvCRT. Using previous calibration of CQ IC50 shifts for P. falciparum vs similarly measured changes in PfCRT mediated CQ transport17 we estimate that P. vivax expressing CQR3 PvCRT could show CQ IC50 of up to approximately 460 nM vs approximately 290 nM for P. vivax expressing wild
pg. 21
ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 22 of 29
type PvCRT (note the correlation between transport and IC50 is not linear17, allowing us to only estimate maxima or a range of values). This conclusion is supported by a 2009 study of 155 P. vivax isolates from Indonesia that were found to exhibit CQ IC50 of approximately 295 nM (range 227-384 nM)46, consistent with our above estimate from CQ transport data. This CQR3 mediated shift in CQ IC50 would represent an approximate doubling of CQ IC50 relative to that found for a strain of P. falciparum expressing the CQR associated Dd2 PfCRT isoform. Relatedly, knowing that P. falciparum expressing HB3 PfCRT show AQ IC50 of 10 nM and that those expressing Dd2 PfCRT show AQ IC50 of 27.7 nM45 we can estimate that the changes in AQ transport caused by PvCRT mutations would confer shifts of AQ IC50 of similar relative magnitude, with (for example) AQ IC50 for P. vivax expressing either CQR3 or CL002 expected to be near approximately 90 nM and 120 nM, respectively. In conclusion, it seems likely that PvCRT plays a role in modulating P. vivax resistance to quinoline based antimalarial drugs, particularly AQ. Overall, we suggest that increased surveillance of PvCRT polymorphisms correlated with P. vivax patient clinical outcome is needed.
Acknowledgements Supported by RO1 AI056312 to PDR. We thank Dr. T. Wellems (NIAID / NIH) for PvCRT cDNA and our laboratory colleagues for helpful discussions.
References: 1) World Health Organization. World Malaria Report 2015 (World Health Organization, 2015). 2) Rieckmann, K. H., Davis, D. R., Hutton, D. C. (1989) Plasmodium vivax resistance to
pg. 22
ACS Paragon Plus Environment
Page 23 of 29
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
chloroquine? Lancet. 2, 1183-1184. 3) Fidock, D. A., Nomura, T., Talley, A. K., Cooper, R. A., Dzekunov, S. M., Ferdig, M. T., Ursos, L. M., Sidhu, A. B., Naudé, B., Deitsch, K. W., Su, X. Z., Wootton, J. C., Roepe, P. D., Wellems, T. E. (2000) Mutations in the P. falciparum digestive vacuole transmembrane protein PfCRT and evidence for their role in chloroquine resistance. Mol Cell. 6, 861–871. 4) Callaghan, P. S., Hassett, M. R., Roepe, P. D. (2015) Functional Comparison of 45 Naturally Occurring Isoforms of the Plasmodium falciparum Chloroquine Resistance Transporter (PfCRT). Biochemistry. 54, 5083-5094. 5) Cooper, R. A., Ferdig, M. T., Su, X. Z., Ursos, L. M., Mu, J., Nomura, T., Fujioka, H., Fidock, D. A., Roepe, P. D., Wellems, T. E. (2002) Alternative mutations at position 76 of the vacuolar transmembrane protein PfCRT are associated with chloroquine resistance and unique stereospecific quinine and quinidine responses in Plasmodium falciparum. Mol Pharmacol. 61, 35–42. 6) Martin, R. E., Marchetti, R. V., Cowan, A. I., Howitt, S. M., Bröer, S., Kirk, K. (2009) Chloroquine transport via the malaria parasite's chloroquine resistance transporter. Science. 325, 1680-2. 7) Paguio, M. F., Cabrera, M., Roepe, P. D. (2009) Chloroquine transport in Plasmodium falciparum. 2. Analysis of PfCRT-mediated drug transport using proteoliposomes and a fluorescent chloroquine probe. Biochemistry. 48, 9482-91. 8) Zhang, H., Paguio, M., Roepe, P. D. (2004) The antimalarial drug resistance protein Plasmodium falciparum chloroquine resistance transporter binds chloroquine. Biochemistry. 43, 8290- 6.
pg. 23
ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
9) Bennett, T. N., Kosar, A. D., Ursos, L. M., Dzekunov, S., Singh, Sidhu, A. B., Fidock, D. A., Roepe, P. D. (2004) Drug resistance-associated pfCRT mutations confer decreased Plasmodium falciparum digestive vacuolar pH. Mol Biochem Parasitol. 133, 99-114. 10) Gaviria, D., Paguio, M. F., Turnbull, L. B., Tan, A., Siriwardana, A., Ghosh, D., Ferdig, M. T., Sinai, A. P., Roepe, P. D. (2013) A process similar to autophagy is associated with cytocidal chloroquine resistance in Plasmodium falciparum. PLoS One. 8, e79059. 11) Gligorijevic, B., Bennett, T., McAllister, R., Urbach, J. S., Roepe, P. D. (2006) Spinning disk confocal microscopy of live, intraerythrocytic malarial parasites. 2. Altered vacuolar volume regulation in drug resistant malaria. Biochemistry. 45, 12411-23. 12) Nomura, T., Carlton, J. M., Baird, J. K., del Portillo, H. A., Fryauff, D. J., Rathore, D., Fidock, D. A., Su, X., Collins, W. E., McCutchan, T. F., Wootton, J. C., Wellems, T. E. (2001) Evidence for different mechanisms of chloroquine resistance in 2 Plasmodium species that cause human malaria. J Infect Dis. 183, 1653-1661. 13) Zhang, H., Howard, E. M., Roepe, P. D. (2002) Analysis of the antimalarial drug resistance protein Pfcrt expressed in yeast. J Biol Chem. 277, 49767-49775. 14) Roepe, P.D. (2011) PfCRT - mediated drug transport in malarial parasites. Biochemistry 50, 163-171. 15) Martin, R. E., and Kirk, K. (2004) The malaria parasite’s chloroquine resistance transporter is a member of the drug/metabolite transporter superfamily. Mol Biol Evol. 21, 1938– 1949. 16) Gligorijevic, B., Bennett, T., McAllister, R., Urbach, J. S., Roepe, P. D. (2006) Spinning disk confocal microscopy of live, intraerythrocytic malarial parasites. 2. Altered vacuolar volume regulation in drug resistant malaria. Biochemistry. 45, 12411-12423.
pg. 24
ACS Paragon Plus Environment
Page 24 of 29
Page 25 of 29
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
17) Baro, N. K., Callaghan, P. S., Roepe, P. D. (2013) Function of resistance conferring Plasmodium falciparum chloroquine resistance transporter isoforms. Biochemistry. 52, 4242-4249. 18) Orjuela-Sánchez, P., de Santana Filho, F. S., Machado-Lima, A., Chehuan, Y. F., Costa, M. R., Alecrim, M. d., del Portillo, H. A. (2009) Analysis of single-nucleotide polymorphisms in the crt-o and mdr1 genes of Plasmodium vivax among chloroquineresistant isolates from the Brazilian Amazon region. Antimicrob Agents Chemother. 53, 3561-3564. 19) Suwanarusk, R., Russell, B., Chavchich, M., Chalfein, F., Kenangalem, E., Kosaisavee, V., Prasetyorini, B., Piera, K. A., Barends, M., Brockman, A., Lek-Uthai, U., Anstey, N. M., Tjitra, E., Nosten, F., Cheng, Q., Price, R. N. (2007) Chloroquine resistant Plasmodium vivax: in vitro characterisation and association with molecular polymorphisms. PLoS One. 2, e1089. 20) Barnadas, C., Ratsimbasoa, A., Tichit, M., Bouchier, C., Jahevitra, M., Picot, S., Ménard, D. (2008) Plasmodium vivax resistance to chloroquine in Madagascar: clinical efficacy and polymorphisms in pvmdr1 and pvcrt-o genes. Antimicrob Agents Chemother. 52, 42334240.
21) Melo, G. C., Monteiro, W. M., Siqueira, A. M., Silva, S. R., Magalhães, B. M., Alencar, A. C., Kuehn, A., del Portillo, H. A., Fernandez-Becerra, C., Lacerda, M. V. (2014) Expression levels of pvcrt-o and pvmdr-1 are associated with chloroquine resistance and severe Plasmodium vivax malaria in patients of the Brazilian Amazon. PLoS One. 9, e105922. 22) Fernández-Becerra, C., Pinazo, M. J., González, A., Alonso, P. L., del Portillo, H. A.,
pg. 25
ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Gascón, J. (2009) Increased expression levels of the pvcrt-o and pvmdr1 genes in a patient with severe Plasmodium vivax malaria. Malar J. 8, 55. 23) Sá, J. M., Yamamoto, M. M., Fernandez-Becerra, C., de Azevedo, M. F., Papakrivos, J., Naudé, B., Wellems, T. E., Del Portillo, H. A. (2006) Expression and function of pvcrt-o, a Plasmodium vivax ortholog of pfcrt, in Plasmodium falciparum and Dictyostelium discoideum. Mol Biochem Parasitol. 150, 219-228. 24) Baro, N. K., Pooput, C., Roepe, P. D. (2011) Analysis of chloroquine resistance transporter (CRT) isoforms and orthologues in S. cerevisiae yeast. Biochemistry. 50, 6701-6710. 25) Lekostaj, J. K., Natarajan, J. K., Paguio, M. F., Wolf, C., Roepe, P. D. (2008) Photoaffinity labeling of the Plasmodium falciparum chloroquine resistance transporter with a novel perfluorophenylazido chloroquine. Biochemistry. 47, 10394-10406. 26) Golenda, C. F., Li, J., Rosenberg, R. (1997) Continuous in vitro propagation of the malaria parasite Plasmodium vivax. Proc Natl Acad Sci U S A. 94, 6786-6791. 27) Nigavekar, S. S., Cannon, J. F. (2002) Characterization of genes that are synthetically lethal with ade3 or leu2 in Saccharomyces cerevisiae. Yeast. 19, 115-122. 28) Sherman, F., Baim, S. B., Hampsey, D. M., Gooodhue, C. T., Friedman, L. R., Stiles, J. I. (1986) in Translational Control (Matthews MB, Ed.) Cold Spring Harbor Laboratory Press, Plainview, NY. 29) Delhez, J., Dufour, J. P., Thines, D., Goffeau, A. (1977) Comparison of the properties of plasma membrane-bound and mitochondria-bound ATPases in the yeast Schizosaccharmoyces pombe. Eur J. Biochem. 79, 319-328.
30) Roepe, P. D. (2014) To kill or not to kill, that is the question: cytocidal antimalarial drug resistance. Trends Parasitol. 30, 130-135.
pg. 26
ACS Paragon Plus Environment
Page 26 of 29
Page 27 of 29
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
31) Gabryszewski, S. J., Modchang, C., Musset, L., Chookajorn, T., Fidock, D. A. (2016) Combinatorial Genetic Modeling of pfcrt-Mediated Drug Resistance Evolution in Plasmodium falciparum. Mol Biol Evol. 33, 1554-1570. 32) Sá, J. M., Twu, O., Hayton, K., Reyes, S., Fay, M. P., Ringwald, P., Wellems, T. E. (2009) Geographic patterns of Plasmodium falciparum drug resistance distinguished by differential responses to amodiaquine and chloroquine. Proc Natl Acad Sci U S A. 106, 18883-18889. 33) Hasugian, A. R., Tjitra, E., Ratcliff, A., Siswantoro, H., Kenangalem, E., Wuwung, R. M., Purba, H. L., Piera, K. A., Chalfien, F., Marfurt, J., Penttinen, P. M., Russell, B., Anstey, N. M., Price, R. N. (2009) In vivo and in vitro efficacy of amodiaquine monotherapy for treatment of infection by chloroquine-resistant Plasmodium vivax. Antimicrob Agents Chemother. 53, 1094-1099. 34) Vrbova, H., Gibney, S., Gibson, F. D., Jolley, D., Heywood, P. F., Stace, J., Trenholme, K. R., Alpers, M. P. (1992) Chemoprophylaxis against malaria in Papua New Guinea: a trial of amodiaquine and a combination of dapsone and pyrimethamine. P N G Med J. 35, 275- 284. 35) Schuurkamp, G. J., Spicer, P. E., Kereu, R. K., Bulungol, P. K. (1989) A mixed infection of vivax and falciparum malaria apparently resistant to 4-aminoquinoline: a case report. Trans R Soc Trop Med Hyg. 83, 607-608. 35) Marfurt, J., Müeller, I., Sie, A., Maku, P., Goroti, M., Reeder, J. C., Beck, H. P., Genton, B. (2007) Low efficacy of amodiaquine or chloroquine plus sulfadoxine-pyrimethamine against Plasmodium falciparum and P. vivax malaria in Papua New Guinea. Am J Trop Med Hyg. 77, 947-954.
pg. 27
ACS Paragon Plus Environment
Biochemistry
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
36) Collins, W. E., Sullivan, J. S., Fryauff, D. J., Kendall, J., Jennings, V., Galland, G. G., Morris, C. L. (2000) Adaptation of a chloroquine-resistant strain of Plasmodium vivax from Indonesia to New World monkeys. Am J Trop Med Hyg. 62, 491-495. 37) Mein, R. M. (1951) Camoquin in the treatment of human malaria. Am J Trop Med Hyg. 31, 212-217. 38) Griffing, S. M., Tauil, P. L., Udhayakumar, V., Silva-Flannery, L. (2015) A historical perspective on malaria control in Brazil. Mem Inst Oswaldo Cruz. 110, 701-718. 39) de Souza, J. M. (1992) Epidemiological distribution of Plasmodium falciparum drug resistance in Brazil and its relevance to the treatment and control of malaria. Mem Inst Oswaldo Cruz. 87 (Suppl. III), 343-348. 40) Kremsner, P. G., Zotter, G. M., Feldmeier, H., Graninger, W., Kollaritsch, M., Wiedermann, G., Rocha, R. M., Wernsdorfer, W. H. (1989). In vitro drug sensitivity of Plasmodium falciparum in Acre, Brazil. Bull World Health Organ. 67, 289-293. 41) Getachew, S., Thriemer, K., Auburn, S., Abera, A., Gadisa, E., Aseffa, A., Price, R. N., Petros, B. (2015) Chloroquine efficacy for Plasmodium vivax malaria treatment in southern Ethiopia. Malar J. 14, 525. 42) Htun, M. W., Mon, N. C. N., Aye, K. M., Hlaing, C. M., Kyaw, M. P., Handayuni, I., Trimarsanto, H., Bustos, D., Ringwald, P., Price, R. N., Auburn, S., Thriemer, K. (2017) Chloroquine efficacy for Plasmodium vivax in Myanmar in populations with high genetic diversity and moderate parasite gene flow. Malar J. 16, 281. 43) Wendler, J. P., Okombo, J., Amato, R., Miotto, O., Kiara, S. M., Mwai, L., Pole, L., O'Brien, J., Manske, M., Alcock, D., Drury, E., Sanders, M., Oyola, S. O., Malangone, C., Jyothi, D., Miles, A., Rockett, K. A., MacInnis, B. L., Marsh, K., Bejon, P., Nzila, A.,
pg. 28
ACS Paragon Plus Environment
Page 28 of 29
Page 29 of 29
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Biochemistry
Kwiatkowski, D. P. (2014) A genome wide association study of Plasmodium falciparum susceptibility to 22 antimalarial drugs in Kenya. PLoS One. 9, e96486. 44) Baird, J. K., Hoffman, S. L. (2004) Primaquine therapy for malaria. Clin Infect Dis. 39, 1336-1345. 45) Paguio, M. F., Bogle, K. L., Roepe, P. D. (2011) Plasmodium falciparum resistance to cytocidal versus cytostatic effects of chloroquine. Mol Biochem Parasitol. 178, 1-6. 46) Russell, B., Chalfein, F., Prasetyorini, B., Kenangalem, E., Piera, K., Suwanarusk, R., Brockman, A., Prayoga, P., Sugiarto, P., Cheng, Q., Tjitra, E., Anstey, N. M., Price, R.N. (2008) Determinants of in vitro drug susceptibility testing of Plasmodium vivax. Antimicrob Agents Chemother. 52, 1040-1045.
FOR TABLE OF CONTENTS USE:
pg. 29
ACS Paragon Plus Environment