Antibacterial Activity of a Series of - ACS Publications - American

Article pubs.acs.org/jmc

Antibacterial Activity of a Series of N2,N4‑Disubstituted Quinazoline2,4-diamines Kurt S. Van Horn,†,§ Whittney N. Burda,‡,§ Renee Fleeman,‡ Lindsey N. Shaw,*,‡ and Roman Manetsch*,† †

Department of Chemistry, University of South Florida, 4202 East Fowler Avenue, CHE 205, Tampa, Florida 33620, United States Department of Cell Biology, Microbiology and Molecular Biology, University of South Florida, 4202 East Fowler Avenue, ISA 2015, Tampa, Florida 33620, United States

‡

ABSTRACT: A series of N2,N4-disubstituted quinazoline-2,4diamines has been synthesized and tested against multidrug resistant Staphylococcus aureus. A structure−activity and structure−property relationship study was conducted to identify new hit compounds. This study led to the identification of N2,N4-disubstituted quinazoline-2,4-diamines with minimum inhibitory concentrations (MICs) in the low micromolar range in addition to favorable physicochemical properties. Testing of biological activity revealed limited potential for resistance to these agents, low toxicity, and highly effective in vivo activity, even with low dosing regimens. Collectively, these characteristics make this compound series a suitable platform for future development of antibacterial agents.

■

INTRODUCTION

a return to the preantibiotic era where 80% of staphylococcal bloodborne infections were fatal. To this end, we have explored the potential of quinazolinebased agents for their anti-MRSA activity. Quinazolines are a class of compounds that have shown potential as antibacterials. Recently, Lam et al. showed examples of 7-(benzimidazol-1-yl)2,4-diaminoquinazolines such as A that were highly selective toward S. aureus dihydrofolate reductase (DHFR), displaying a 46700-fold Ki selectivity over human DHFR.6 This active DHFR inhibitor was found to have an MIC of 0.25 μg/mL against trimethoprim resistant strains of S. aureus and showed protection in mice following a lethal challenge of S. aureus, resulting in a protection of 50% of the mice (PD50) at 2 mg/ mL. Huband et al. have reported substituted quinazolin-2,4-dione B as bacterial gyrase and topoisomerase inhibitors (Figure 1).7 They determined a minimum inhibitory concentration against 90% of the tested strains (MIC90) of 0.5 μg/mL versus staphylococci, 0.06 μg/mL versus streptococci, 2 μg/mL versus enterococci, and 0.5 μg/mL versus Moraxella catarrhalis, Haemophilus influenzae, Listeria monocytogenes, Legionella pneumophila, and Neisseria species. Compound B was used in a S. aureus in vivo murine acute lethal infection model, where an oral dose of 2.5 ± 1.8 mg/kg was found to protect 50% of mice infected with MRSA strain SA-1417. Indolo[1,2-c]quinazoline C and its analogues have been shown to have antibacterial and antifungal activity by Rohini et al. (Figure 1).8 The MIC of these compounds were evaluated against Gram positive and negative bacteria, including Staph-

Staphylococcus aureus is a Gram positive bacterium that exists as a commensal of the human flora, with 30% of the population harboring this bacterium in their anterior nares.1 S. aureus can infect many ecological niches within the human body, causing a wide range of diseases. These can be categorized into skin and soft tissue infections such as folliculitis and impetigo, bacteremia, invasive infections such as endocarditis and pneumonia, and toxinoses such as food poisoning and toxic shock syndrome. As a result of this complex pathology, S. aureus is speculated to be the most common cause of infectious morbidity and mortality in the United States.2 The success of S. aureus as a pathogen is due, in large part, to its ability to develop resistance to antibiotics. Indeed, since the introduction of penicillin, S. aureus has demonstrated an extraordinary propensity for evading antibiotics, with resistance gained within the first 12 months following introduction of a new drug.3 Remarkably, resistance to daptomycin, a semisynthetic lipopeptide, was seen even before FDA approval.4 The most severe infections, and public health threats, are posed by methicillin resistant S. aureus strains (MRSA). These are isolates that possess a modified penicillin binding protein (Pbp2a), which effectively renders the entire class of β-lactam antibiotics inert. This leaves limited choices for therapeutic intervention, with vancomycin, a glycopeptide antimicrobial agent, commonly deployed in the direst of cases. In recent years, however, there has been an increase in vancomycin intermediate and vancomycin resistant S. aureus, which threatens to take away our most valuable treatment option for staphylococcal infections.5 With the rise in antibiotic resistance and a lack of antimicrobial therapy, we are faced with © XXXX American Chemical Society

Received: January 8, 2014

A

dx.doi.org/10.1021/jm500039e | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Figure 1. Quinazolines with reported antibacterial activity.

Figure 2. Synthesis of N2,N4-disubstituted quinazoline-2,4-diamines.

ylococcus aureus, Bacillus subtilis, Streptococcus pyogenes, Salmonella typhimurium, Escherichia coli, and Klebsiella pneumonia and also against the fungi Aspergillus niger, Candida albicans, and Trichoderma viridae. Quinazoline C had MICs between 2 and 5 μg/mL against all tested bacteria and between 2 and 10 μg/mL for fungal isolates. Mycobacterial growth inhibition and dihydrofolate reductase inhibition was reported by DeGraw et al. with a series of 2,4diaminoquinazolines D (Figure 1).9 An MIC of 1.8 μM was reported for D and a marked synergistic effect was found with diaminodiphenyl sulfone. Although activity was found with Mycobacterium, D was found to be inactive against Staphylococcus aureus, Enterococcus faecalis, Corynebacterium acnes, Pseudominas aeruginosa, Erysipelothrix insidiosa, Escherichia coli, Proteus vulgaris, and Salmonella chloraesuis. In vitro activity against E. coli, S. aureus, and K. pneumonia was discovered for the quinazoline class E at MICs of 2, 12 μM, and 12 μM, respectively, as reported by Kung et al. (Figure 1).10 In an in vivo murine model, compound E afforded a 40% survival rate when injected subcutaneously at 100 mg/kg in mice infected with K. pneumonia. Gottasová et al. reported the in vitro activity of 4aniloquinazoline F against B. subtilis and S. aureus (Figure 1).11 An MIC of 10 μg/mL and an EC50 of 0.8 μg/mL for F was found against S. aureus. Quinazoline F also had an MIC of 1 μg/mL and an EC50 of 0.7 μg/mL in assays using B. subtilis. Recently, we tested a small library of quinazolines, structurally different from previously reported antibacterial quinazolines and originally designed as potential antileishmanials, for antibacterial activity.12 The results were promising as several compounds had zones of inhibition (ZOI) against MRSA in Kirby−Bauer tests. A larger library was then prepared, and minimum inhibitory concentrations (MICs) were determined for those compounds having ZOIs. Herein, we report a detailed structure−activity relationship (SAR) study

focusing on the 2-position, the 4-position, and the quinazoline’s benzenoid ring. Furthermore, we report the selection process leading to frontrunner compounds displaying low mutation frequencies, limited cytotoxicity, and promising in vivo efficacy in murine models of infection.

■

RESULTS AND DISCUSSION Synthetic Chemistry. The quinazoline library was synthesized utilizing known procedures (Figure 2).13 Commercially available anthranilic acids (a) were cyclized with urea, and the resulting quinazoline-2,4-dione or commercially available benzoyleneurea (b) was reacted with phosphorus oxychloride to form the 2,4-dichloroquinazoline (c). Amine substitution occurred selectively at position 4, yielding 4-amino2-chloroquinazoline (d) and subsequently by substitution at position 2 to give the 2,4-diaminosubstituted quinazoline. Throughout this synthetic sequence, only 4-amino-2-chloroquinazoline (d) and the final N2,N4-disubstituted quinazoline2,4-diamine have been purified and characterized. Structure−Activity Relationship Studies. Testing of Quinazolines via Kirby−Bauer Assays. Assessment of the quinazolin-2,4-diamine structure shows three locales for substitution patterns: N2-substitution, N4-substitution, and benzenoid substitution at positions C5−C8. Initial studies focused on the amine substitutions as shown in Table 1. Compounds were initially tested using a Kirby−Bauer assay to determine whether they inhibited bacterial growth. Upon identification of active compounds, minimum inhibitory concentrations (MICs) were determined to assess the potency of the compounds. MICs were not determined for compounds without zones of inhibition in the Kirby−Bauer assays (Tables 1−3). First, a subset of N2,N4-substituted quinazolines were synthesized and tested, in which N4 was modified by a furfuryl moiety, while the N2-group was varied (Table 1). Quinazolines B



Article

Table 1. SAR of N-Alkyl-N-furfurylquinazolin-2,4-diamines and N2- and N4-Substitutions Rich in sp3 Hybridized Carbons

1 and 2 with a N2-methyl or N2-ethyl did not have ZOIs in the Kirby−Bauer assays. Branched alkyl groups on N2 furnished compounds 3 and 6 displayed inhibition, while unbranched polar substituents in 4 and 5 lacked any activity. Cycloalkyl groups on N2 varied in potency based on size: N2-cyclopropyl and N2-cyclobutyl quinazolines 7 and 8 were inactive while analogues 9 and 10 with a N2-cyclopentyl and a N2-cyclohexyl respectively provided ZOIs. Next, compounds were tested with

a furfuryl group at N2. N2-Furfuryl-quinazolines 11 and 12 with N4-methyl and N4-isopropyl were both active From this small set it was concluded that when a furfuryl moiety was substituted at N4, best antibacterial activity would be observed when a bulky alkyl substituent was at N2. In contrast, small groups were tolerated at N4 with N2-furfuryl-modified quinazolines. With the idea to reduce the number of aromatic rings, a subset of compounds was designed to test whether N2- and N4C



Article

methyl or N4-isopropyl displayed MICs of 390 and 35 μM, respectively, showing that isopropyl derivation leads to more active compounds than methyl derivation. The five active nonaromatic 2,4-diaminoquinazolines from 13−34 displayed quite different MICs. The N2-cyclopentyl-N4isopropyl-quinazolin-2,4-diamine 26 had an MIC comparable to the N4-furfuryl-N2-cyclopentyl derivative 9 or the N4furfuryl-N2-isopropyl derivative 3. The N4-cyclopentyl-N2isopropyl analogue 31 was more active with an MIC of 37 μM, whereas compound 29, with N4-methylthioethyl-N2isopropyl derivation and an MIC >360 μM, was inactive. N2,N4-Dibutylquinazolin-2,4-diamine 28 and N4-cyclohexyl-N2isopropylquinazolin-2,4-diamine 32, with respective MICs of 0.37 and 3.5 μM, were the only analogues of the entire series displaying submicromolar or single-digit micromolar activity. These most active dialkyl 2,4-diaminoquinazolines make for interesting points in the compound subseries. Study of the benzenoid substitution revealed 6-, 7-, and 8chloro-substituted compounds 35−37 to have MICs six times more active than the quinazoline 3 with an unsubstituted benzenoid ring (Table 2). 6-Methoxy-quinazoline 45 was more than twice as active as reference compound 3, while all the other methyl- or methoxy-substituted quinazolines were less potent. As the compounds studied previously contained mostly alkyl or furfuryl derivation, the effect of benzyl and phenyl substituents was observed (Table 3). N-Benzyl-N-isopropyl derivatives 47 and 48 with MICs of 34 μM had nearly the same MIC as the N4-phenyl derivative 49 and the N-butyl N-phenyl derivatives 51 and 52. N4-Benzyl-N2-butyl 50 had an MIC of 3.3 μM, again showing the favorable effects that butyl groups have on activity when 50 is compared to 48 while also showing the preference of benzyl over phenyl when 50 is compared to 51. The N,N-dibenzyl derivative 53 also had excellent activity, with an MIC of 2.9 μM, again indicating that benzyl derivation is good for improving the antibacterial activity over phenyl derivation. The MICs for N4-phenyl derivatives 54 and 55 with N2- benzyl or phenyl were 31 and 32 μM, respectively. Mixing N-furfuryl with N-benzyl or p-substituted N-phenyl resulted in compounds 56−59 with MICs in the range of 30 μM. Compound Optimization Based on Initial SAR and Mutation Frequency Studies. The four most active quinazolines found in the initial SAR were 28, 32, 50, and 53. Prior to optimization efforts, compounds 28, 32, 50, and 53 were assessed for developability based on mutation frequencies. Although compounds 28 and 32, without aromatic side chains, were highly potent quinazolines (Table 1), it was decided that analogues thereof would not be synthesized due to the less than favorable mutation frequency (see below). As seen in Table 3, nearly all tested compounds with aromatic side chains were active. Thus, analogues were synthesized by using parasubstituted benzyl amines to make analogues of 53 (Table 4). Mono p-chlorobenzyl 60 and 61 had MICs of 27 and 67 μM, respectively, while the dichloro derivative 62 had better activity with an MIC of 2.4 μM. p-Methylbenzyl derivatives 63−65 had MICs of 28 and 71 μM for the monomethyl derivatives and 27 μM for the di-p-methylbenzyl derivative 65. The N2-pmethoxybenzyl derivative 66 had an MIC of 0.67 μM, more than four times more active than the parent 53. The N4-pmethoxybenzyl and dimethoxy derivatives 67 and 68 were less active, with MICs of 68 and 25 μM, respectively. As previous SAR data indicated that a chloro substituent at the benzenoid ring increases the activity (Table 2), quinazo-

residues rich in sp3-hybridized carbons are tolerated without compromising activity. Analogues 13−27 and 30−32 were synthesized in which one of the two N2,N4-substitutents was a methyl, an isopropyl, or a 2-hydroxyethyl group, whereas the other consisted of a branched, an unbranched, or a saturated cycloalkyl moiety. None of these analogues were particularly active with the exceptions of the N2-cyclopentyl-N4-isopropyl derivative 26, the N4-cyclopentyl-N2-isopropyl derivative 31, and the N4-cyclohexyl-N2-isopropyl derivative 32. Analogues 28 with N2,N4-dibutyl and 29 with N4-2-(methylthio)ethyl and N2isopropyl also inhibited growth. Following this, a subset of quinazolines was prepared to probe whether antibacterial activity can be improved via steric and electronic effects on the quinazoline benzenoid ring (Table 2). N4-Furfuryl-N2-isopropyl-substituted quinazoline 3 was Table 2. SAR of Benzenoid Substitutions

3 35 36 37 38 39 40 41 42 43 44 45 46

R1

R2

R3

R4

ZOI (mm)

MIC (μM)

−H −H −H −H −Cl −H −H −H −CH3 −H −H −H −OCH3

−H −H −H −Cl −H −H −H −CH3 −H −H −H −OCH3 −H

−H −H −Cl −H −H −H -CH3 −H −H −H −OCH3 −H −H

−H −Cl −H −H −H −CH3 −H −H −H −OCH3 −H −H −H

10 10 12 11 9 10 none none none none none 10 9

180 32 32 32 >78 340 nd nd nd nd nd 80 >80

selected as a reference compound, to which analogues 35−46 were monosubstituted at positions C5−C8 with either a chloro, a methyl, or a methoxy group. The best compounds were quinazolines 35−38, with one chloro substitutent suppressing the growth of bacteria equally or more efficiently than reference compound 3. The analogues 39−46 substituted with a methyl or a methoxy group were less potent with inhibition of growth observed in 25% and 50% of the samples, respectively. The trends noted for this set are that a chloro- substitution is well tolerated while methoxy- is less so and methyl- is even less. A final focus was a selection of compounds with aromatic residues (Table 3). Analogues 47−59, bearing phenyl and/or benzyl groups at N2- and/or N4-positions, were successful in inhibiting the growth of S. aureus in Kirby−Bauer tests. Minimum Inhibitory Concentration Assays. To obtain a more precise structure−activity relationship study, quinazolines displaying ZOIs were tested in a minimum inhibitory concentration (MIC) assay. The furfuryl substituted quinazolines 1−12 (Table 1) displayed a range of activity against S. aureus. The N2-isopropyl derivative 3 was twice as active as the N2-tert-butyl-quinazoline 6, with an MIC of 180 μM. N2Cyclopentyl-quinazoline 9 had a MIC comparable to the isopropyl derivative, while N2-cyclohexyl-quinazoline 10 had an MIC of 78 μM. N2-Furfuryl-2,4-diaminoquinazoline with N4D



Article

Table 3. N2- and/or N4-Benzyl and/or Phenyl Substitutions

Table 4. Combination with 7-Chloro or p-Substituted Benzyl at N2 and/or N4

factor of approximately 10 was observed with the addition of a 7-chloro group to the N2-p-methoxybenzyl derivative 66 or to the di-p-chlorobenzyl derivative 62 in compounds 71 and 72. Combining the N4-p-chlorobenzyl with N2-p-methoxybenzyl and 7-chloro resulted in compound 73, with a low antibacterial activity of 51 μM. The only 7-chloroquinazoline to maintain

lines were synthesized by combining the benzenoid 7-chloro group with a variety of the most active N2- and N4-benzyl substitutions (Tables 3 and 4). Addition of a 7-chloro group to the benzenoid ring of the N2,N4-dibenzylquinazolin-2,4diamine 53 reduced the MIC activity from 2.9 to 27 μM in compound 69 (Table 5). A similar reduction in activity of a E



Article

Table 5. Combinations with 7-Chloro

activity was the N2-butyl derivative 70 with a MIC of 0.73 μM, in comparison to its reference 50 with an MIC of 3.3 μM. Physicochemical Properties. A limited structure−property relationship study was conducted for the three lead quinazolines 32, 50, and 53. Aqueous solubility, permeability, and the partition coefficient log D were experimentally determined at two pHs.14 The properties of all tested compounds were affected by pH, with better solubilities and poorer permeabilities being observed in more acidic environments. Regardless, because solubility and permeability, as well as log D, were acceptable for all tested compounds, the quinazoline2,4-diamines show promise as a compound series with favorable physicochemical properties. In Vitro Biological Evaluation. Testing for Bactericidal and Bacteriostatic Activity. An important distinction of antibiotics is whether they are bactericidal or bacteriostatic. Bactericidal agents kill bacteria, while bacteriostatic agents prevent their reproduction. The minimum bactericidal concentrations (MBCs) were tested for the most potent quinazolines 28, 32, 50, 53, and 62 (Figure 3). Compound 28 was found to have an excellent MBC50 of 0.036 μM compared to the MIC of 0.37 μM. For compound 32, the MBC50 was found to be 8.8 μM, which is around nine times the MIC. Despite this being greater than the MIC, this compound still appears to possess bactericidal activity. Compound 50 had an

MBC50 of 0.98 μM, compared with the MIC of 3.3 μM, showing very strong bactericidal capacity. The MBC50 for 62 was 7.2 μM, which is three times the MIC of 2.4 μM, again showing strong bactericidal capacity. Interestingly, compound 53, with an MIC of 2.9 μM, was not found to be bactericidal at any of the concentrations tested, thus demonstrating bacteriostatic activity. Cytotoxicity and Hemolysis Assays of Selected Compounds. The cytotoxicity of frontrunner compounds was determined against adenocarcinomic human alveolar basal epithelial cells (A549 cells, Figure 4). For lead compounds 32, 50, and 53, we observed almost no cytotoxicity, recovering greater than 60% of cells at all concentrations tested, compared to untreated controls. Similarly, when compound 28 was tested, we recovered >50% of cells at all concentrations tested. Specifically, for compound 32, we recovered greater than 100% A549 viability at concentrations ranging from 1.8 to 8.8 μM. At concentrations ranging from 18 to 440 μM, we recovered 98.6% to 70.3% viability of A549 cells, respectively. For compound 50, we recovered greater than 100% A549 viability at concentrations ranging from 1.6 to 16 μM. At concentrations ranging from 41 to 410 μM, we recovered greater than 95% viable A549 cells. For compound 53, we recovered between 93.2% and 83.6% of the A549 cells at concentrations ranging from 1.5 to 370 μM, respectively. Finally, for compound 28, we F



Article

Figure 3. The minimum bactericidal concentrations of lead quinazolines. The data shown represents percent recovery of inoculum compared to untreated controls from three independent experiments. Red square = MIC value for each agent.

Figure 4. The effect of lead quinazolines on human alveolar epithelia cells. The effects of lead quinazolines on cell viability were assessed using the MTT reagent and taken as a percentage of treated cells compared to untreated cells (DMSO). The data presented are the results from three independent experiments. Error bars are shown as ± SEM.

observed 100% A549 cell viability at concentrations ranging from 0 to 9.2 μM, and 58.8% cell viability at concentrations ranging from 36.7 to 459 μM. Investigating the Potential for MRSA Resistance to Quinazolines. An important attribute of potential antimicrobial agents is that the spontaneous development of resistance is not

easily attained. Thus, we set out to determine the spontaneous mutation frequency of 28, 32, 50, 53, and 62. We plated 1 × 109 cells on agar plates containing 2.5× the MIC of either 28, 32, or 62 and observed lawns of bacterial growth for every replicate. This indicates that resistance to these agents is readily acquired (Table 6). For compound 53, only seven spontaneous G



Article

Table 6. Physicochemical Properties of Quinazolines 32, 50, and 53

a (*) for solubility ≤5 μM, (**) for 5 μM < solubility ≤10 μM, (***) for 10 μM < solubility ≤20 μM, (****) for 20 μM < solubility ≤30 μM, (*****) for solubility ≥30 μM. bFor the determination of the Pe values, the following internal controls were utilized: carbazepine pH 4.0 permeability Pe = 108 × 10−6 (cm/s) and pH 7.4 permeability Pe = 130 × 10−6 (cm/s); ranitidine·HCl pH 4.0 permeability Pe = 5.2 × 10−6 (cm/s) and pH 7.4 permeability Pe = 2.2 × 10−6 (cm/s); verapamil·HCl pH 4.0 permeability Pe = 20.6 × 10−6 (cm/s) and pH 7.4 permeability Pe = 1360 × 10−6 (cm/s).

DNA sequence analysis of the spontaneous mutants generated using 53. Accordingly, we sequenced the quinolone resistancedetermining regions (QRDR) of the genes encoding DNA gyrase (gyrA and gyrB) and topoisomerase IV (grlA and grlB), as described by us previously.15 We found that each of the mutants contain the same mutations in the QRDR as that of the parent: S84L and E88K mutations were observed in gyrA and S80Y and E84G mutations in grlA. No mutations were observed in the QRDR of gyrB or grlB of the mutant strains. This indicates that the mechanism of action likely is not the inhibition of gyrase or topoisomerase IV. Work by others suggests that quinazoline-based compounds may interfere with dihydrofolate reductase (DHFR), an enzyme involved in the essential process of folic acid synthesis in bacterial cells.16 Therefore, we also employed DNA sequencing analysis of DHFR with the mutant and parental strains. Upon analysis, we again observed no mutations in the mutant strains compared to the wild-type. In spite of this finding, we next performed a tetrahydrofolic acid assay. DHFR catalyzes the final step in folic acid production, which is the reduction of dihydrofolic acid to tetrahydrofolic acid. If quinazolines are DHFR inhibitors, dihydrofolic acid would not be reduced to tetrahydrofolic acid. We hypothesized that by adding in exogenous tetrahydrofolic acid, we would rescue the cells from quinazoline-mediated killing. Our wild-type strain was thus grown in the presence of 5× MIC of compounds 32, 50, 53, and 62 and varying concentrations of tetrahydrofolic acid, ranging from 0 to 220 μM. The known DHFR inhibitor trimethoprim was also used as a positive control, while vancomycin, an antibiotic that inhibits cell wall biosynthesis, was used as a negative control. After the 18 h incubation period, we observed that even at the highest concentration of tetrahydrofolic acid used there was no growth of S. aureus in the presence of vancomycin, as expected. The reverse was true, again as expected, when cells were incubated with trimethoprim, with as little as 2.2 μM tetrahydrofolic acid recovering growth of the MRSA strain. For all compounds we observed similar results to trimethoprim when exogenous tetrahydrofolic acid was added, with bacterial growth fully restored compared to control wells that contain no tetrahydrofolic acid. These results strongly suggest that our series of quinazoline agents target DHFR for their antibacterial mechanism of action, in spite of the fact that no mutations were observed in the DHFR gene. We suggest that it is perhaps likely that the mutations occurring in the 53 resistance mutants likely result in enhanced efflux in these strains. Investigating Synergistic and Antagonistic Activities of Front-Runner Compounds Alongside other Known Folate Biosynthesis Targeting Antibacterials. To investigate if our compounds were active against strains that were resistant to other DHFR targeting antimicrobials, we next assessed activity

mutants were isolated over 10 replicates. The combined inoculum was 2.31 × 1010, which yielded a mutation frequency of 3.03 × 10−10. No spontaneous mutants were generated for compound 50, which yielded a mutation frequency less than 1 × 10−11. We next explored if cross resistance had developed toward derivatives of 53 when tested against the spontaneous mutants obtained from compound 53. First, we tested the MIC of these strains against the producing compound 53 and found that it had lost all activity against the mutant strains, with MICs >590 μM compared with 2.9 μM against the parent. The MIC was 27 μM against mutant 1 (M1) and the original strain for 60, while the compound became more effective against M2−M7, with an increased MIC of 2.7 μM. Compound 62 was only tested against M1 and M2 and had a 10-fold drop in activity from 2.4 to 24 μM. Quinazoline 63, with an original activity of 28 μM, had the same activity toward M1, while it has increased activity (MIC = 2.8 μM) against M2−M7. The MIC was 27 μM against the original strain and M1 and M2 for 65, while the activity against M3−M7 was increased to 2.7 μM. The activity of 66 had a minor decrease in efficacy from 0.67 to 27 μM against M1−M3 and a remarkably large drop in activity to 270 μM against M4, while the MIC remained unchanged for M5−M7. In all mutant strains, 68 had a reduction of activity from 25 μM against the original strain. Against strains M5 and M6, the MIC was 125 μM, and for the rest of the strains it was >250 μM. Compound 69, with an original MIC of 27 μM, had the same activity for M1 and M2 while activity was increased 10-fold to 2.7 μM against M3−M7. Activity for 70 was found to be 0.73 μM against the mutants and original strain alike. Compounds 61 (original MIC 67 μM), 64 (original MIC 71 μM), and 67 (original MIC 67 μM) were found to be more active against the mutants than the original strain. Analogue 61 had an MIC of 2.7 μM against all seven mutants. Against M1 and M2, 64 had MICs of 2.8 μM, whereas the MIC for M3−M7 was 28 μM. Compound 67 had MICs of 2.7 μM for M4 and M6 and 27 μM for the rest of the mutants. Collectively, this suggests that the development of spontaneous resistance to our quinazoline agents actually leads to a physiological burden, and greater sensitivity to other compounds from this class, rather than enhanced resistance. While an immediate observation for this finding is not entirely clear, it is common for organisms that incur resistance-facilitating mutations to do so at the expense of their overall cellular fitness. Thus, it is possible that mutations gained in these strains to circumvent the activity of 53 renders them more sensitive to other agents as a result of potentially deleterious mutations. Investigating the Mechanism of Action of the Quinazoline Derivatives. As quinazolines are closely related to quinolones, which target enzymes that mediate supercoiling, we employed H



Article

Figure 5. Testing the in vivo efficacy of lead quinazolines using a Galleria mellonella model of S. aureus infection. The in vivo efficacy of lead agents was assessed using a G. mellonella model of infection. Larvae were considered dead if they did not respond to physical stimuli. Mortality was measured using a log rank and χ-square test with 1degree of freedom. * = p > 0.05, ** = p > 0.01.

Figure 6. Lead quinazoline agents are efficacious in protecting mice during lethal S. aureus peritonitis infection. The significance of mortality was measured using a log rank and χ-square test with 1 degree of freedom. * = p > 0.05.

of the front-runners using a trimethoprim resistant strain of S. aureus. After 24 h of incubation, we observed that this strain was sensitive to all lead quinazolines tested. In addition, we also performed the reverse test, assessing the MIC of trimethoprim against our quinazoline resistant mutants. With these experiments, we again observed no changes in MIC, indicating that cross-resistance between front runner agents and trimethoprim does not occur despite apparently sharing the same target within the S. aureus cell. This is very encouraging and suggest our compounds target a different part of the DHFR protein, and also that the trimethoprim resistant strains that exist clinically should still be sensitive to killing by our front runner compounds.

Further to this, trimethoprim is almost always used clinically in conjunction with the dihydropteroate synthetase inhibitor sulfamethoxazole. These two antibiotics work synergistically to inhibit folic acid production in bacteria, which is an essential process, at different stages of the folate production pathway. We next set out to see if similar synergy was obtained when using our lead quinazolines alongside sulfamethoxazole. To determine this, we performed a checkerboard microtitration assay to determine the fractional inhibitor concentration (FIC) of sulfamethoxazole and compounds 32, 50, 53, and 62. We determined that the MIC of sulfamethoxazole alone against our wild-type S. aureus was 2.4 mM, while in combination with our lead agents, at concentrations ranging from 0.3 up to 300 μM, I



■

this was lowered to 150 μM, resulting in a FIC of 0.016. Compounds 32, 50, 53, and 62 have MICs of 3.5, 3.3, 2.9, and 2.4 μM, respectively, while in combination with sulfamethoxazole (150 μM), these compounds had decreased MICs of 0.3 μM (32, 50, and 53), and 0.24 μM (62). The sum of FIC of both agents (ΣFIC) for compounds 32, 50, 53, and 62 in combination with sulfamethoxazole were 0.10 and 0.11 for the first two agents and 0.12 for the latter two. These results indicate that these compounds, in combination with sulfamethoxazole, are synergistic in action as their ΣFIC is below the ≤0.5 threshold typically used to define such activity. In Vivo Biological Evaluation. Galleria mellonella Model of Infection. As a preliminary measure of in vivo efficacy, we next tested our lead agents in a Galleria mellonella model of S. aureus infection. For all compounds tested, larvae (N = 10) were infected with a lethal dose of S. aureus cells (1.0 × 109). Larvae were then treated 1 h postinfection with either the lead agents or the vehicle alone (negative control) (Figure 5). Additionally, we performed mock infection testing, where larvae were not injected with S. aureus (positive control). For 32 and 50, we observed a 40% increase in survival of treated larvae when using 5× MIC; however, this was just outside the range of statistical significance. When dosing was increased to 10× MIC for each of these agents, survival increased to 70% compared to the vehicle group, which was found to be highly statistically significant. For compound 62, 5× MIC treatment resulted in 50% protection (not significant), which rose to 60% survivability (significant) upon increasing to 10× MIC dosing. Finally, when using 5× MIC of 53, we observed 50% protection rates over the infection period that was found to be highly significant. Increased dosing with this agent did not lead to enhanced efficacy over the 5× MIC dose (data not shown). These results indicate the strong potential for in vivo efficacy of these agents in clearing lethal S. aureus infection. Murine Model of Lethal Peritonitis. As a final measure of the suitability of our quinazoline-based compounds to serve as antibacterial agents, we studied their in vivo efficacy using a murine model of lethal peritonitis. As such, the ability of 50 and 53 to treat S. aureus infection was determined due to their limited cytotoxicity, as determined using adenocarinomic human alveolar basal epithelial cells (A549) and favorable mutation frequencies. For all compounds tested, mice were infected with 1 × 108 S. aureus cells via intraperitoneal injection. At 1 h postinfection, mice were then injected via tail vein with 5× the MIC of either vancomycin (positive control), 50, or 53 (Figure 6). Each group of mice was compared to a negative control group receiving only vehicle (45% w/v (2-hydroxypropyl)-β-cyclodextrin in water) 1 h postinfection. For compounds 50 and 53, we only had a single mouse die during the infection period, which is a 69% increase in survival when compared to our untreated controls. These data were even better than that of the positive control, with only 50% protectivity observed with vancomycin. We were able to observe protection with vancomycin equivalent to that of 50 and 53 but only at 10× MIC (data not shown). On the basis of these encouraging results, we also tested our best frontrunner compound, 53, at 1× the MIC. At this concentration, we observed complete protection of all mice infected with MRSA, indicating excellent in vivo activity of these agents, even at very low concentrations and doses.

Article

CONCLUSION A total of 73 N2,N4-disubstituted quinazoline-2,4-diamines, many displaying antibacterial activities, have been synthesized systematically by varying the substitutions in the 2-, 4-, 5-, 6-, 7-, and/or 8-positions. The most potent in vitro activities with MICs in the submicromolar and single-digit range against MRSA were obtained with quinazoline-2,4-diamines 28, 32, 50, 53, 62, 66, and 70 bearing N,N-dibutyl substitution, a N4cyclohexyl-N2-isopropyl substitution, or a N4-benzyl moiety combined with either N2-benzyl or N2-n-butyl group. These substitution patterns are necessary for S. aureus activity, as supported by DeGraw et al., with quinazoline C (Figure 1), the quinazoline-2,4-diamine that was unsubstituted on either amine and inactive against S. aureus.9 Furthermore, the benzenoid ring of the quinazoline-2,4-diamine scaffold has been identified to play a secondary role for efficacy, with quinazolines substituted with one chloro group at the 6-, 7-, or 8-position displaying lower MICs against S. aureus in comparison to analogues unsubstituted at the benzenoid ring. Similarly, the data from Kung et al. in regard to D (Figure 1) shows that benzenoid substitution can lead to in vitro activity in S. aureus when the amine at the 4-position is unsubstituted, although excellent activity was not observed.10 These promising results led to efficacy testing of the lead compounds, which revealed a limited capacity for cytotoxicity of the agents as well as highly favorable spontaneous mutation frequencies for a number of the frontrunners. Investigation of the mechanism of action suggests that these agents function as inhibitors of dihydrofolate reductase within S. aureus cells. Finally, using murine models of infection we observed excellent in vivo efficacy for two of our lead agents, giving complete, or almost complete, protection to mice infected with a lethal dose of S. aureus that was superior to similar concentrations of the control agent vancomycin. The murine model data reported earlier shows better protection at the MIC than the S. aureus in vivo data reported by Huband et al. who reported a 50% protection at five times the MIC.7 The observed potencies of frontrunner compounds 32, 50, 53, and 62 in our assays make N2,N4-disubstituted quinazoline-2,4diamines an excellent platform for the future development of antibacterial agents.

■

EXPERIMENTAL SECTION

General. All reagents and solvents were obtained from Aldrich Chemical Co. and used without further purification. Anthranilic acids were purchased from Sigma-Aldrich, Oakwood Products, Inc. or TCI America. NMR spectra were recorded at ambient temperature on a 250 MHz Bruker, 400 MHz Varian, or 500 MHz Varian NMR spectrometer in the solvent indicated. All 1H NMR experiments are reported in δ units, parts per million (ppm) downfield of TMS, and were measured relative to the signals for chloroform (7.26 ppm), methanol (3.31 ppm), and dimethylsulfoxide (2.50 ppm). All 13C NMR spectra were reported in ppm relative to the signals for chloroform (77 ppm), methanol (49 ppm), and dimethylsulfoxide (39.5 ppm) with 1H decoupled observation. Data for 1H NMR are reported as follows: chemical shift (δ ppm), multiplicity (s = singlet, d = doublet, t = triplet, q = quartet, p = pentet, sext = sextet, sept = septet, oct = octet, m = multiplet), integration and coupling constant (Hz), whereas 13C NMR analyses were reported in terms of chemical shift. NMR data was analyzed by using MestReNova Software version 5.3.2−4936. The purity of the final compounds was determined to be ≥95% by high-performance liquid chromatography (HPLC) using an Agilent 1100 LC/MSD-VL with electrospray ionization. Melting points were determined using a MEL-TEMP 3.0 instrument and are uncorrected. Low-resolution mass spectra were performed on an Agilent 1100 LC/MSD-VL with electrospray ionization. HighJ



Article

1H), 6.32 (d, J = 1.6 Hz, 1H), 4.84 (d, J = 5.1 Hz, 2H). 13C NMR (63 MHz, CDCl3) δ 160.65, 157.61, 150.90, 150.32, 142.63, 133.70, 127.73, 126.40, 121.16, 113.32, 110.72, 108.73, 38.51. MS (ESI): [M + H]+ 260; found 260.1. Rf = 0.14 (hexanes to ethyl acetate 4:1). N4-(Furan-2-ylmethyl)-N2-methylquinazoline-2,4-diamine (1). 1d (0.12 g, 0.46 mmol) was reacted with methylamine and purified according to method Db to furnish 0.11 g (0.43 mmol) of the title compound as a light-yellow solid in 93% yield. 1H NMR (500 MHz, CD3OD) δ 8.00 (d, J = 8.0 Hz, 1H), 7.66−7.56 (m, 1H), 7.44 (d, J = 1.1 Hz, 1H), 7.35 (s, 1H), 7.26 (t, J = 7.7 Hz, 1H), 6.39 (d, J = 3.2 Hz, 1H), 6.36 (dd, J = 3.1, 1.9 Hz, 1H), 4.80 (s, 2H), 3.06 (s, 3H). 13 C NMR (126 MHz, CD3OD) δ 159.99, 150.78, 142.14, 142.10, 134.60, 123.99, 123.26, 110.18, 110.12, 107.92, 107.89, 107.87, 37.70, 27.11. HRMS: m/z calcd for C14H15N4O [M + H]+ 255.12404; found 255.12472. Rf = 0.37 (9:1 dichloromethane to methanol). Melting point decomposition at 205 °C. N2-Ethyl-N4-(furan-2-ylmethyl)quinazoline-2,4-diamine (2). 1d (0.080 g, 0.31 mmol) was reacted with ethylamine and purified according to method Db to furnish 0.067 g (0.25 mmol) of the title compound as a yellow solid in 81% yield. 1H NMR (400 MHz, CD3OD) δ 8.07−8.04 (m, 1H), 7.66 (dd, J = 11.3, 4.0 Hz, 1H), 7.47− 7.43 (m, 1H), 7.43−7.26 (m, 2H), 6.40−6.35 (m, 2H), 4.83 (s, 2H), 3.56 (dd, J = 14.2, 7.1 Hz, 2H), 1.28 (t, J = 6.9 Hz, 3H). HRMS: m/z calcd for C15H17N4O [M + H]+ 269.1397; found 269.1406. Rf = 0.43 (9:1 dichloromethane to methanol). Melting point 165−172 °C. 2-(4-(Furan-2-ylmethylamino)quinazolin-2-ylamino)ethanol (5). 1d (0.12 g, 0.46 mmol) was reacted with 2-aminoethanol and purified according to method Da to furnish 0.048 g (0.17 mmol) of the title compound in 37% yield. 1H NMR (500 MHz, CD3OD) δ 8.11 (d, J = 7.6 Hz, 1H), 7.76 (ddd, J = 8.4, 7.3, 1.3 Hz, 1H), 7.46 (d, J = 0.8 Hz, 1H), 7.40 (t, J = 7.5 Hz, 2H), 6.41 (d, J = 2.9 Hz, 1H), 6.40−6.36 (m, 1H), 3.74 (d, J = 36.6 Hz, 4H). 13C NMR (126 MHz, CD3OD) δ 160.46, 153.34, 150.50, 142.26, 139.06, 135.13, 124.56, 123.47, 116.45, 110.16, 110.12, 107.84, 59.81, 43.38, 37.93. HRMS: m/z calcd for C15H17N4O2 [M + H]+ 285.13460; found 285.13503. Rf = 0.24 (9:1 dichloromethane to methanol). Melting point 219−221 °C. N 2-(tert-Butyl)-N 4-(furan-2-ylmethyl)quinazoline-2,4-diamine (6). 1d (0.070 g, 0.27 mmol) was reacted with tert-butylamine and purified according to method Db to furnish 0.03 g (0.1 mmol) of the title compound as a yellow solid in 37% yield. 1H NMR (400 MHz, DMSO-d6) δ 8.08 (d, J = 8.0 Hz, 1H), 7.62−7.46 (m, 2H), 7.25 (d, J = 8.3 Hz, 1H), 7.10 (t, J = 7.4 Hz, 1H), 6.42−6.28 (m, 2H), 4.74 (s, 2H), 1.41 (s, 9H). 13C NMR (101 MHz, CD3OD) δ 161.54, 158.37, 153.08, 147.88, 143.22, 134.83, 123.96, 123.43, 121.97, 118.56, 111.37, 107.87, 52.63, 39.25, 29.76. HRMS: m/z calcd for C17H21N4O2 [M + H]+ 297.1710; found 297.1726. Rf = 0.24 (9:1 dichloromethane to methanol). Melting point 112−115 °C. N2-Cyclopropyl-N4-(furan-2-ylmethyl)quinazoline-2,4-diamine (7). 1d (0.080 g, 0.31 mmol) was reacted with cyclopropylamine and purified according to method Db to furnish 0.080 g (0.29 mmol) of the title compound as a yellow solid in 92% yield. 1H NMR (500 MHz, CD3OD) δ 7.93 (d, J = 8.2 Hz, 1H), 7.46 (t, J = 6.8 Hz, 2H), 7.37 (dd, J = 1.7, 0.7 Hz, 1H), 7.11 (dd, J = 10.9, 5.4 Hz, 1H), 6.40− 6.32 (m, 1H), 6.29 (dd, J = 3.2, 1.9 Hz, 1H), 4.75 (s, 2H), 2.81 (ddd, J = 10.7, 7.1, 3.7 Hz, 1H), 0.93−0.80 (m, 2H), 0.67−0.59 (m, 2H). 13C NMR (126 MHz, CD3OD) δ 159.84, 156.50, 151.26, 142.72, 141.96, 141.93, 133.87, 123.37, 122.98, 119.04, 110.23, 107.79, 37.49, 23.21, 6.63. HRMS: m/z calcd for C16H17N4O [M + H]+ 281.13969; found 281.13955. Rf = 0.36 (9:1 dichloromethane to methanol). Melting point decomposition at 170 °C. N 2-Cyclobutyl-N4 -(furan-2-ylmethyl)quinazoline-2,4-diamine (8). 1d (0.080 g, 0.31 mmol) was reacted with cyclopropylamine and purified according to method Db to furnish 0.080 g (0.29 mmol) of the title compound as a white solid in 92% yield. 1H NMR (500 MHz, CD3OD) δ 7.89 (d, J = 7.6 Hz, 1H), 7.51−7.48 (m, 1H), 7.43− 7.41 (m, 1H), 7.25 (s, 1H), 7.16−7.11 (m, 1H), 6.37−6.30 (m, 2H), 4.75 (s, 2H), 4.54−4.43 (m, 1H), 2.35 (s, 2H), 2.12−2.06 (m, 2H), 1.81−1.74 (m, 2H). HRMS: m/z calcd for C17H19N4O [M + H]+ 295.1553; found 295.1545. Rf = 0.36 (9:1 dichloromethane to methanol). Melting point decomposition at 170 °C.

resolution mass spectra (HRMS) were performed on an Agilent LC/ MSD TOF system G3250AA. Analytical thin layer chromatography (TLC) was performed on silica gel 60 F254 precoated plates (0.25 mm) from EMD Chemical Inc., and components were visualized by ultraviolet light (254 nm). Reported Rf was determined for TLC. Silicycle silica gel 230−400 (particle size 40−63 μm) mesh was used for all flash column chromatography. General Synthetic Procedure A: Cyclization of Anthranilic Acids to the Corresponding Quinazoline-2,4-diones. One equivalent of anthranilic acid and 3.5 equivalents of urea were mortar and pestled to a powder and heated to 200 °C in a round-bottom flask open to the atmosphere. After two hours, the mixture was cooled, triturated with water, and filtered to give the product as crude. No further purification was performed. General Synthetic Procedure B: Chlorination of Quinazoline-2,4-diones to the Corresponding 2,4-Dichloroquinazolines. One equivalent of quinazoline-2,4-dione and 1 equivalent of N,N-dimethylaniline were mixed in 12 equivalents of phosphorus oxychloride and the mixture refluxed under an argon atmosphere until starting material was no longer present by TLC (3−16 h). The mixture was then cooled and added to ice in the amount of 10 times the reaction volume. The solution was filtered to give crude product. General Synthetic Procedure C: Amine Substitution of 2,4Dichloroquinazolines to Yield 4-Amino-substituted 2-Chloroquinazolines. Amine (1.1 equivalent) and sodium acetate were mixed with 1 equivalent of 2,4-dichloroquinazoline at 0.1 M concentration in a 3:1 mix of tetrahydrofuran and water and heated to 65 °C. When the reaction was observed to be finished by TLC, the solution was diluted with ethyl acetate, the layers were separated, and the organic phase washed three times with an equal amount of water and dried over Na2SO4. The crude was then purified by either method Ca or Cb: Purification Method Ca. The compound was recrystallized with ethanol and water, filtered, and rinsed with cold ethanol to yield pure product. Purification Method Cb. The crude was purified by flash chromatography using hexanes and ethyl acetate. General Synthetic Procedure D: Amine Substitution of 4Aminosubstituted-2-chloroquinazolines to Yield 2,4-Diaminosubstituted Quinazolines. Amine (1.5 equivalents) was mixed with 1 equivalent of 4-amino-substituted 2-chloroquinazoline at 0.2 M concentration in ethanol in a sealed tube and heated to 150 °C. When the reaction was finished as observed by TLC, the compound was purified by either method Da or Db: Purification Method Da. Compound crystallized out of the cool solution and was filtered and then rinsed with cold ethanol to yield pure product. Purification Method Db. Solvent was evaporated, and the crude mixture was purified by flash chromatography using dichloromethane and methanol. Previously Reported Quinazolines. The following quinazolines have been previously reported: 3, 4, 18, 35−46.12 2,4-Dichloroquinazoline (1c). Commercially available benzoyleneurea (0.12 mol) and N,N-dimethylaniline (0.12 mol) were mixed in 60 mL of phosphorus oxychloride and heated to reflux under an atmosphere of argon. After 5 h, the solution was cooled and slowly added to 300 mL of ice. Once quenching was finished, the compound was extracted with chloroform (4 × 125 mL) and purified by flash chromatography using hexanes and ethyl acetate to yield the title compound in 61% yield (14.5 g, 73 mmol). 1H NMR (500 MHz, CDCl3) δ 8.29−8.24 (m, 1H), 8.02−7.99 (m, 2H), 7.74 (ddd, J = 6.3, 5.0, 3.2, 1H). 13C NMR (126 MHz, CDCl3) δ 164.14, 155.25, 152.49, 136.30, 129.49, 128.15, 126.31, 126.09, 122.48. MS (ESI): [M + H]+ 199, 201; found 198.9 (100%), 200.9 (64%). Rf = 0.56 (hexanes to ethyl acetate 4:1). 2-Chloro-N-(furan-2-ylmethyl)quinazolin-4-amine (1d). 1c (1 g,5.0 mmol) was reacted with furfurylamine and purified according to method Ca to furnish 1.21 g (4.7 mmol) of the title compound in 93% yield. 1H NMR (250 MHz, CDCl3) δ 7.78−7.67 (m, 3H), 7.41 (ddd, J = 8.1, 5.4, 2.9 Hz, 1H), 7.33 (s, 1H), 6.55 (s, 1H), 6.35 (d, J = 2.8 Hz, K



Article

N2-Cyclopentyl-N4-(furan-2-ylmethyl)quinazoline-2,4-diamine (9). 1d (0.12 g, 0.46 mmol) was reacted with cyclopentylamine and purified according to method Db to furnish 0.083 g (0.27 mmol) of the title compound as a brown solid in 59% yield. 1H NMR (500 MHz, CD3OD) δ 7.85 (d, J = 8.1 Hz, 1H), 7.46 (t, J = 7.6 Hz, 1H), 7.39 (s, 1H), 7.29 (s, 1H), 7.06 (t, J = 7.6 Hz, 1H), 6.31 (s, 1H), 6.27 (d, J = 3.1 Hz, 1H), 4.73 (d, J = 14.9 Hz, 2H), 4.38−4.25 (m, 1H), 1.99 (dt, J = 12.1, 5.9 Hz, 2H), 1.76−1.66 (m, 2H), 1.64−1.54 (m, 2H), 1.54−1.45 (m, 2H). 13C NMR (126 MHz, CD3OD) δ 160.46, 153.32, 150.50, 142.26, 139.06, 135.13, 124.56, 123.47, 116.45, 110.16, 110.12, 107.84, 59.81, 43.38, 37.93. HRMS: m/z calcd for C18H21N4O [M + H]+ 309.17099; found 309.17103. Rf = 0.45 (9:1 dichloromethane to methanol). Melting point 113−117 °C. N 2-Cyclohexyl-N4 -(furan-2-ylmethyl)quinazoline-2,4-diamine (10). 1d (0.10 g, 0.385 mmol) was reacted with cyclohexylamine and purified according to method Db to furnish 0.062 g (0.19 mmol) of the title compound as a brown solid in 50% yield. 1H NMR (400 MHz, CDCl3) δ 7.81 (s, 1H), 7.44 (t, J = 7.7 Hz, 1H), 7.35 (d, J = 8.1 Hz, 1H), 7.30 (s, 1H), 7.03 (t, J = 7.6 Hz, 1H), 6.28 (s, 1H), 6.26 (d, J = 3.1 Hz, 1H), 4.77 (s, 2H), 3.93 (s, 1H), 2.00 (d, J = 9.6 Hz, 2H), 1.73 (dd, J = 9.3, 3.9 Hz, 2H), 1.60 (dd, J = 8.8, 4.0 Hz, 1H), 1.37 (dd, J = 24.1, 12.0 Hz, 2H), 1.29−1.16 (m, 3H). HRMS: m/z calcd for C19H23N4O [M + H]+ 323.1866; found 323.1877. Rf = 0.54 (9:1 dichloromethane to methanol). Melting point decomposition at 165 °C. N-Methyl-2-chloroquinazolin-4-amine (11d). 1c (1.0 g, 5.0 mmol) was reacted with methylamine and purified according to method Ca to furnish 0.89 g (4.6 mmol) of the title compound in 92% yield. 1H NMR (400 MHz, CDCl3) δ 7.74−7.66 (m, 3H), 7.41 (t, J = 6.9 Hz, 1H), 6.28 (s, NH), 3.20 (d, J = 4.7 Hz, 3H). 13C NMR (101 MHz, CDCl3) δ 161.82, 158.02, 150.80, 133.64, 127.90, 126.41, 121.02, 113.60, 28.74. MS (ESI): [M + H]+ 194; found 194. Rf = 0.12 (hexanes to ethyl acetate 4:1). N2-(Furan-2-ylmethyl)-N4-methylquinazoline-2,4-diamine (11). 11d (0.080 g, 0.41 mmol) was reacted with furfurylamine and purified according to method Db to furnish 0.065 g (0.25 mmol) of the title compound as a brown solid in 62% yield. 1H NMR (500 MHz, CD3OD) δ 7.87 (d, J = 7.6 Hz, 1H), 7.55 (ddd, J = 8.3, 7.4, 1.2 Hz, 1H), 7.47−7.40 (m, 1H), 7.29 (d, J = 7.2 Hz, 1H), 7.18 (t, J = 8.1 Hz, 1H), 6.38−6.33 (m, 2H), 4.65 (s, 2H), 3.10 (s, 3H). 13C NMR (126 MHz, CDCl3) δ 160.66, 153.79, 150.74, 142.25, 139.03, 134.47, 124.59, 124.25, 117.00, 110.40, 110.25, 107.74, 38.01, 28.65. HRMS: m/z calcd for C14H15N4O [M + H]+ 255.1240; found 255.1237. Rf = 0.37 (9:1 dichloromethane to methanol). Melting point 145−155 °C. 2-Chloro-N-isopropylquinazolin-4-amine (12d). 1c (1 g, 5.0 mmol) was reacted with isopropylamine and purified according to method Ca to furnish 0.960 g (4.33 mmol) of the title compound in 87% yield. 1H NMR (400 MHz, CDCl3) δ 7.76−7.63 (m, 3H), 7.40 (tt, J = 12.8, 6.4 Hz, 1H), 5.75 (d, J = 5.8 Hz, NH), 4.65−4.45 (m, 1H), 1.32 (d, J = 6.5 Hz, 6H). 13C NMR (101 MHz, CDCl3) δ 160.32, 158.08, 151.05, 133.53, 128.04, 126.20, 120.89, 113.41, 43.52, 22.74. MS (ESI): [M + H]+ 222; found 222. Rf = 0.27 (hexanes to ethyl acetate 4:1). N2-(Furan-2-ylmethyl)-N4-isopropylquinazoline-2,4-diamine (12). 12d (0.080 g, 0.36 mmol) was reacted with furfurylamine and purified according to method Db to furnish 0.046 g (0.16 mmol) of the title compound as a brown solid in 45% yield. 1H NMR (500 MHz, CD3OD) δ 8.06 (d, J = 8.2 Hz, 1H), 7.62−7.54 (m, 1H), 7.41 (d, J = 1.1 Hz, 1H), 7.34 (d, J = 8.2 Hz, 1H), 7.23−7.16 (m, 1H), 6.33 (dd, J = 3.2, 1.9 Hz, 1H), 6.31−6.27 (m, 1H), 4.66 (s, 2H), 4.63−4.53 (m, 1H), 1.33 (d, J = 6.6 Hz, 6H). 13C NMR (126 MHz, CD3OD) δ 159.49, 155.15, 151.93, 141.98, 141.94, 133.90, 123.18, 123.09, 118.72, 110.25, 110.08, 106.81, 43.52, 37.71, 20.74. HRMS: m/z calcd for C16H19N4O [M + H]+ 283.15534; found 283.15565. Rf = 0.38 (9:1 dichloromethane to methanol). Melting point 168−178 °C. N2,N4-Dimethylquinazoline-2,4-diamine (13). 11d (0.080 g, 0.41 mmol) was reacted with methylamine and purified according to method Da to furnish 0.078 g (0.41 mmol) of the title compound as a white solid in quantitative yield. 1H NMR (500 MHz, CD3OD) δ 7.92 (d, J = 8.1 Hz, 1H), 7.67−7.63 (m, 1H), 7.31−7.25 (m, 2H), 3.09 (s,

3H), 3.03 (s, 3H). 13C NMR (126 MHz, CD3OD) δ 160.32, 153.64, 139.04, 134.57, 124.19, 123.21, 116.43, 109.50, 27.43, 26.98. HRMS: m/z calcd for C10H13N4 [M + H]+ 189.11402; found 189.11389. Rf = 0.21 (9:1 dichloromethane to methanol). Melting point decomposition at 280 °C. N2-Isopropyl-N4-methylquinazoline-2,4-diamine (14). 11d (0.080 g, 0.41 mmol) was reacted with isopropylamine and purified according to method Db to furnish 0.053 g (0.25 mmol) of the title compound as a white solid in 60% yield. 1H NMR (500 MHz, CD3OD) δ 8.00 (dd, J = 8.2, 1.0 Hz, 1H), 7.71 (ddd, J = 8.4, 7.2, 1.3 Hz, 1H), 7.44 (s, 1H), 7.34 (ddd, J = 8.3, 7.3, 1.1 Hz, 1H), 4.33 (s, 1H), 3.16 (s, 3H), 1.33 (d, J = 8.2, 6H). 13C NMR (126 MHz, CD3OD) δ 160.68, 152.91, 139.59, 134.51, 124.09, 123.18, 116.96, 109.93, 43.52, 27.43, 21.25. HRMS: m/z calcd for C12H17N4 [M + H]+ 217.14477; found 217.14485. Rf = 0.33 (9:1 dichloromethane to methanol). Melting point 259−262 °C. 2-(4-(Methylamino)quinazolin-2-ylamino)ethanol (15). 11d (0.080 g, 0.41 mmol) of was reacted with ethanol amine and purified according to method Da to furnish 0.062 g (0.28 mmol) of the title compound as a cream solid in 69% yield. 1H NMR (500 MHz, CD3OD) δ 7.92 (d, J = 8.1 Hz, 1H), 7.65 (t, J = 7.7 Hz, 1H), 7.36 (d, J = 7.6 Hz, 1H), 7.27 (t, J = 7.7 Hz, 1H), 3.79 (t, J = 5.5 Hz, 2H), 3.67− 3.62 (m, 2H), 3.11 (s, 3H). 13C NMR (126 MHz, CD3OD) δ 160.69, 154.93, 141.31, 134.16, 123.59, 122.95, 118.05, 110.15, 60.30, 43.40, 27.34. HRMS: m/z calcd for C11H15N4O [M + H]+ 219.12459; found 219.12427. Rf = 0.12 (9:1 dichloromethane to methanol). Melting point 199−204 °C. N2-Cyclopropyl-N4-methylquinazoline-2,4-diamine (16). 11d (0.080 g, 0.41 mmol) was reacted with cyclopropylamine and purified according to method Db to furnish 0.071 g (0.33 mmol) of the title compound as a yellow solid in 81% yield. 1H NMR (500 MHz, CD3OD) δ 7.93 (d, J = 8.0 Hz, 1H), 7.65−7.60 (m, 1H), 7.57 (d, J = 17.6 Hz, 1H), 7.28−7.23 (m, 1H), 3.07 (s, 3H), 2.82 (ddd, J = 10.5, 7.0, 3.6 Hz, 1H), 0.93 (q, J = 6.5 Hz, 2H), 0.68 (td, J = 7.1, 5.0 Hz, 2H). 13C NMR (126 MHz, CD3OD) δ 161.55, 157.10, 141.94, 135.34, 125.25, 124.29, 119.41, 111.66, 28.69, 24.17, 7.81. HRMS: m/z calcd for C12H15N4 [M + H]+ 215.1291; found 215.1288. Rf = 0.19 (9:1 dichloromethane to methanol). Melting point 204−208 °C. N2-Cyclopentyl-N4-methylquinazoline-2,4-diamine (17). 11d (0.080 g, 0.41 mmol) was reacted with cyclopentylamine and purified according to method Da to furnish 0.061 g (0.25 mmol) of the title compound as a white solid in 61% yield. 1H NMR (400 MHz, DMSOd6) δ 9.71 (s, 1H), 8.91 (s, 1H), 8.21 (d, J = 29.1 Hz, 2H), 7.63 (s, 1H), 7.23 (d, J = 6.6 Hz, 1H), 4.32 (s, 1H), 3.00 (s, 3H), 1.94 (d, J = 5.6 Hz, 2H), 1.62 (d, J = 25.9 Hz, 2H), 1.51 (s, 4H). 13C NMR (101 MHz, CD3OD) δ 161.21, 159.27, 150.19, 132.56, 123.03, 122.08, 121.02, 111.21, 52.75, 33.07, 26.94, 23.52. HRMS: m/z calcd for C14H19N4 [M + H]+ 243.16097; found 243.16118. Rf = 0.41 (9:1 dichloromethane to methanol). Melting point 223−228 °C. N-Ethyl-2-chloroquinazolin-4-amine (19d). 1c (0.20 g, 1.0 mmol) was reacted with ethylamine and purified according to method Cb to furnish 0.12 g (0.58 mmol) of the title compound in 58% yield. 1 H NMR (400 MHz, CD3OD) δ 8.03 (d, J = 8.2 Hz, 1H), 7.75−7.69 (m, 1H), 7.55 (d, J = 8.3 Hz, 1H), 7.45 (t, J = 7.6 Hz, 1H), 3.62 (q, J = 7.2 Hz, 2H), 1.28 (t, J = 7.2 Hz, 3H). 13C NMR (101 MHz, CD3OD) δ 161.48, 157.86, 150.07, 133.47, 126.13, 125.81, 122.43, 113.65, 36.10, 13.15. MS (ESI): [M + H]+ 208; found 208.1. Rf = 0.24 (hexanes to ethyl acetate 4:1). N4-Ethyl-N2-isopropylquinazoline-2,4-diamine (19). 19d (0.10 g 0.50 mmol) was reacted with isopropylamine and purified according to method Db to furnish 0.045 g (0.020 mmol) of the title compound as a yellow solid in 40% yield. 1H NMR (500 MHz, CD3OD) δ 8.05 (d, J = 8.1 Hz, 1H), 7.66 (dd, J = 11.4, 4.1 Hz, 1H), 7.36 (d, J = 36.9 Hz, 1H), 7.31 (dd, J = 14.0, 6.6 Hz, 1H), 4.29 (s, 1H), 3.68 (q, J = 7.2 Hz, 2H), 1.35−1.27 (m, 9H). 13C NMR (126 MHz, CD3OD) δ 159.93, 152.66, 139.32, 134.56, 124.10, 123.38, 116.73, 109.78, 43.58, 36.43, 21.36, 12.97. HRMS: m/z calcd for C13H19N4 [M + H]+ 231.16042; found 231.16093. Rf = 0.47 (9:1 dichloromethane to methanol). Melting point 205−208 °C. L



Article

N-2,2,2-Trifluoroethyl-2-chloroquinazolin-4-amine (20d). 1c (0.050 g, 0.25 mmol) was reacted with 2,2,2-trifluoroethylamine and purified according to method Cb to furnish 0.017 g (0.065 mmol) of the title compound in 26% yield. 1H NMR (400 MHz, CD3OD) δ 8.16 (d, J = 7.2 Hz, 1H), 7.82 (t, J = 7.4 Hz, 1H), 7.68 (d, J = 7.5 Hz, 1H), 7.58 (t, J = 7.7 Hz, 1H), 4.39 (q, J = 8.9 Hz, 2H). MS (ESI): [M + H]+ 235; found 235.0. Rf = 0.11 (hexanes to ethyl acetate 4:1). N2-Isopropyl-N4-(2,2,2-trifluoroethyl)quinazoline-2,4-diamine (20). 20d (0.017 g, 0.065 mmol) was reacted with isopropylamine and purified according to method Db to furnish 0.005 g (0.018 mmol) of the title compound as a white crystalline solid in 28% yield. 1 H NMR (500 MHz, CD3OD) δ 7.91 (dd, J = 8.2, 1.1, 1H), 7.60 (ddd, J = 8.4, 7.0, 1.4, 1H), 7.38 (d, J = 8.4, 1H), 7.17 (ddd, J = 8.1, 7.0, 1.0, 1H), 4.38 (q, J = 9.3, 2H), 4.24 (hept, J = 6.5, 1H), 1.26 (d, J = 6.5, 6H). 13C NMR (126 MHz, CD3OD) δ 160.87, 157.71, 149.57, 133.28, 124.83 (q, J = 278.55), 122.38, 122.15, 121.53, 110.32, 42.57, 40.98 (q, J = 34.34), 21.71. HRMS: m/z calcd for C13H16F3N4 [M + H]+ 285.13216; found 285.13253. Rf = 0.26 (9:1 dichloromethane to methanol). Melting point 103−108 °C. N4-Isopropyl-N2-methylquinazoline-2,4-diamine (21). 12d (0.080 g, 0.36 mmol) was reacted with methylamine and purified according to method Db to furnish 0.075 g (0.35 mmol) of the title compound as a white solid in 96% yield. 1H NMR (500 MHz, CD3OD) δ 8.18 (d, J = 8.2 Hz, 1H), 7.70 (ddd, J = 8.4, 7.3, 1.3 Hz, 1H), 7.53−7.24 (m, 2H), 4.68−4.59 (m, 1H), 3.07 (s, 3H), 1.37 (d, J = 6.6 Hz, 6H). 13C NMR (126 MHz, CD3OD) δ 159.24, 153.79, 139.37, 134.59, 124.18, 123.53, 116.58, 109.88, 43.89, 26.96, 20.52. HRMS: m/z calcd for C12H17N4 [M + H]+ 217.14477; found 217.14536. Rf = 0.33 (9:1 dichloromethane to methanol). Melting point 267−270 °C. N2-Ethyl-N4-isopropylquinazoline-2,4-diamine (22). 12d (0.080 g, 0.36 mmol) was reacted with ethylamine and purified according to method Db to furnish 0.039 g (0.17 mmol) of the title compound as a yellow solid in 47% yield. 1H NMR (500 MHz, CD3OD) δ 8.14 (d, J = 7.7 Hz, 1H), 7.63 (ddd, J = 8.3, 7.3, 1.2 Hz, 1H), 7.39 (s, 1H), 7.31−7.25 (m, 1H), 4.58 (dt, J = 13.2, 6.6 Hz, 1H), 3.53 (q, J = 7.2 Hz, 2H), 1.36 (d, J = 6.6 Hz, 6H), 1.28 (t, J = 7.2 Hz, 3H). 13C NMR (126 MHz, CD3OD) δ 159.29, 153.78, 140.32, 134.33, 123.78, 123.46, 117.19, 109.91, 43.79, 36.00, 20.67, 13.67. HRMS: m/z calcd for C13H19N4 [M + H]+ 231.16042; found 231.16067. Rf = 0.44 (9:1 dichloromethane to methanol). Melting point 209−216 °C. N2,N4-Diisopropylquinazoline-2,4-diamine (23). 12d (0.080 g, 0.36 mmol) was reacted with isopropylamine and purified according to method Db to furnish 0.041 g (0.17 mmol) of the title compound as a white solid in 47% yield. 1H NMR (500 MHz, CD3OD) δ 8.18 (dd, J = 8.2, 0.9 Hz, 1H), 7.71 (ddd, J = 8.4, 7.2, 1.3 Hz, 1H), 7.45 (s, 1H), 7.35 (ddd, J = 8.3, 7.2, 1.1 Hz, 1H), 4.63 (hept, J = 6.6 Hz, 1H), 4.30 (s, 1H), 1.37 (d, J = 6.6 Hz, 6H), 1.32 (d, J = 6.5 Hz, 6H). 13C NMR (126 MHz, CD3OD) δ 159.39, 152.89, 139.82, 134.54, 124.02, 123.47, 116.91, 109.90, 43.86, 43.52, 21.32, 20.59. HRMS: m/z calcd for C14H21N4 [M + H]+ 245.17607; found 245.17613. Rf = 0.38 (9:1 dichloromethane to methanol). Melting point 168−170 °C. 2-(4-(Isopropylamino)quinazolin-2-ylamino)ethanol (24). 12d (0.080 g, 0.36 mmol) was reacted with 2-aminoethanol and purified according to method Db to furnish 0.082 g (0.33 mmol) of the title compound as a white solid in 92% yield. 1H NMR (500 MHz, CD3OD) δ 8.08 (d, J = 8.1 Hz, 1H), 7.64−7.59 (m, 1H), 7.35 (d, J = 8.0 Hz, 1H), 7.24 (dd, J = 11.4, 4.0 Hz, 1H), 4.57 (dt, J = 13.2, 6.6 Hz, 1H), 3.78 (t, J = 5.6 Hz, 2H), 3.63 (t, J = 5.5 Hz, 2H), 1.34 (d, J = 6.6 Hz, 6H). 13C NMR (126 MHz, CD3OD) δ 159.41, 155.11, 141.87, 134.04, 123.34, 123.20, 118.19, 110.17, 60.40, 43.51, 43.42, 20.73. HRMS: m/z calcd for C13H19N4O [M + H]+ 247.15534; found 247.15531. Rf = 0.23 (9:1 dichloromethane to methanol). Melting point 185−188 °C. N2-Cyclopropyl-N4-isopropylquinazoline-2,4-diamine (25). 12d (0.080 g, 0.36 mmol) was reacted with cyclopropylamine and purified according to method Db to furnish 0.035 g (0.14 mmol) of the title compound as a cream solid in 40% yield. 1H NMR (400 MHz, DMSO-d6) δ 9.00 (s, 1H), 8.43 (d, J = 8.2 Hz, 1H), 7.72 (t, J = 7.5 Hz, 1H), 7.33 (t, J = 7.9 Hz, 1H), 4.55 (dq, J = 13.2, 6.5 Hz, 1H), 2.92−

2.84 (m, 1H), 1.29 (d, J = 6.5 Hz, 6H), 0.83 (d, J = 5.4 Hz, 2H), 0.64 (s, 2H). 13C NMR (101 MHz, DMSO-d6) δ 158.47, 155.49, 141.02, 134.19, 124.17, 123.44, 118.51, 110.28, 43.03, 23.45, 21.61, 6.93. HRMS: m/z calcd for C14H19N4 [M + H]+ 243.1604; found 243.1606. Rf = 0.34 (9:1 dichloromethane to methanol). Melting point 208−212 °C. N2-Cyclopentyl-N4-isopropylquinazoline-2,4-diamine (26). 12d (0.080 g, 0.36 mmol) was reacted with cyclopentylamine and purified according to method Da to furnish 0.080 g (0.30 mmol) of the title compound as a white crystalline solid in 82% yield. 1H NMR (500 MHz, CD3OD) δ 8.11−8.05 (m, 1H), 7.49 (ddd, J = 7.1, 6.4, 2.3 Hz, 1H), 7.31 (s, 1H), 7.18−7.10 (m, 1H), 4.57−4.43 (m, 1H), 4.35−4.22 (m, 1H), 2.09−1.94 (m, 2H), 1.81−1.66 (m, 2H), 1.64−1.49 (m, 4H), 1.34 (d, J = 6.6 Hz, 6H). 13C NMR (126 MHz, CD3OD) δ 159.16, 154.21, 141.65, 133.92, 123.40, 123.21, 117.97, 109.93, 53.06, 43.69, 32.65, 23.49, 20.94. HRMS: m/z calcd for C16H23N4 [M + H]+ 271.1917; found 271.1922. Rf = 0.49 (9:1 dichloromethane to methanol). Melting point 185−192 °C. N-tert-Butyl-2-chloroquinazolin-4-amine (27d). 1c (0.17 g, 0.86 mmol) was reacted with tert-butylamine and purified according to method Cb to furnish 0.064 g (0.27 mmol) of the title compound in 31% yield. 1H NMR (400 MHz, CD3OD) δ 8.16 (d, J = 8.3 Hz, 1H), 7.72 (t, J = 7.7 Hz, 1H), 7.56 (d, J = 8.3 Hz, 1H), 7.46 (t, J = 7.6 Hz, 1H), 1.57 (s, 9H). MS (ESI): [M + H]+ 236; found 236.1. Rf = 0.61 (hexanes to ethyl acetate 2:1). N4-tert-Butyl-N2-isopropylquinazoline-2,4-diamine (27). 27d (0.051 g, 0.22 mmol) was reacted with isopropylamine and purified according to method Db to furnish 0.047 g (0.018 mmol) of the title compound as a white powder in 83% yield. 1H NMR (400 MHz, CD3OD) δ 8.16 (d, J = 8.2 Hz, 1H), 7.67 (t, J = 7.4 Hz, 1H), 7.40 (d, J = 6.8 Hz, 1H), 7.31 (t, J = 7.7 Hz, 1H), 4.38−4.21 (m, 1H), 1.60 (s, 9H), 1.31 (d, J = 6.5 Hz, 6H). 13C NMR (101 MHz, CD3OD) δ 160.26, 152.63, 140.27, 134.60, 124.06, 123.83, 117.38, 110.57, 54.04, 43.73, 27.79, 21.70. HRMS: m/z calcd for C15H23N4 [M + H]+ 259.19172; found 259.19157. Rf = 0.47 (9:1 dichloromethane to methanol). Melting point 189−192 °C. N-Butyl-2-chloroquinazolin-4-amine (28d). 1c (0.30 g, 1.5 mmol) was reacted with n-butylamine and purified according to method Ca to furnish 0.275 g (1.16 mmol) of the title compound in 77% yield. 1H NMR (250 MHz, CDCl3) δ 7.77−7.53 (m, 3H), 7.44− 7.31 (m, 1H), 5.82 (s, NH), 3.61 (td, J = 7.1, 5.6, 2H), 1.64 (dt, J = 14.7, 7.2, 2H), 1.40 (td, J = 14.5, 7.2, 2H), 0.92 (t, J = 7.3, 3H). 13C NMR (101 MHz, CDCl3) δ 161.14, 150.99, 133.58, 128.10, 126.29, 121.19, 120.79, 113.42, 41.57, 31.47, 20.35, 14.02. MS (ESI): [M + H]+ 236, 238; found 236.0 (100%), 238.0 (34%). Rf = 0.21 (hexanes to ethyl acetate 4:1). N2,N4-Dibutylquinazoline-2,4-diamine (28). 3d (0.080 g, 0.34 mmol) was reacted with n-butylamine and purified according to method Da to furnish 0.031 g (0.114 mmol) of the title compound as a white solid in 34% yield. 1H NMR (500 MHz, DMSO-d6) δ 9.78 (s, NH), 8.36 (d, J = 8.2 Hz, 1H), 8.14 (s, NH), 7.76 (t, J = 7.7 Hz, 1H), 7.42 (d, J = 7.9 Hz, 1H), 7.37 (t, J = 7.3 Hz, 1H), 3.58 (d, J = 5.6 Hz, 2H), 3.45 (d, J = 5.9 Hz, 2H), 1.72−1.61 (m, 2H), 1.61−1.50 (m, 2H), 1.36 (dd, J = 14.4, 7.1 Hz, 4H), 0.92 (td, J = 7.3, 4.7 Hz, 6H). 13C NMR (101 MHz, DMSO-d6) δ 160.10, 153.50, 139.26, 135.43, 124.83, 124.36, 116.97, 110.02, 41.37, 40.72, 31.49, 30.69, 20.16, 19.93, 14.12, 14.07. HRMS: m/z calcd for C16H25N4 [M + H]+ 273.20737; found 207.20720. Rf = 0.22 (9:1 dichloromethane to methanol). Melting point 151−154 °C. 2-Chloro-N-(2-(methylthio)ethyl)quinazolin-4-amine (29d). 1c (0.20 g, 1.0 mmol) was reacted with 2-(methylthio)ethylamine and purified according to method Cb to furnish 0.15 g (0.59 mmol) of the title compound in 59% yield. 1H NMR (250 MHz, CD3OD) δ 7.93 (dd, J = 8.3, 0.8 Hz, 1H), 7.65 (ddd, J = 8.4, 7.0, 1.4 Hz, 1H), 7.50−7.44 (m, 1H), 7.38 (ddd, J = 8.3, 7.0, 1.3 Hz, 1H), 3.70 (dd, J = 7.5, 6.6 Hz, 2H), 2.75−2.65 (m, 2H), 2.08 (s, 3H). MS (ESI): [M + H]+ 254; found 254.0. Rf = 0.17 (hexanes to ethyl acetate 4:1). N2-Isopropyl-N4-(2-(methylthio)ethyl)quinazoline-2,4-diamine (29). 29d (0.12 g, 0.47 mmol) was reacted with isopropylamine and purified according to method Db to furnish 0.056 g (0.20 mmol) M



Article

of the title compound as a white solid in 43% yield. 1H NMR (500 MHz, CD3OD) δ 7.81 (d, J = 8.1 Hz, 1H), 7.47 (dd, J = 8.2, 7.2 Hz, 1H), 7.28 (d, J = 8.2 Hz, 1H), 7.06 (t, J = 7.6 Hz, 1H), 4.20 (dt, J = 13.0, 6.5 Hz, 1H), 3.76−3.71 (m, 2H), 2.79−2.74 (m, 2H), 2.11 (s, 3H), 1.22 (d, J = 6.5 Hz, 6H). 13C NMR (126 MHz, CD3OD) δ 160.39, 157.49, 148.19, 132.93, 122.28, 121.64, 121.48, 110.56, 42.62, 40.15, 32.36, 22.03, 14.11. HRMS: m/z calcd for C14H21N4S [M + H]+ 277.14814; found 277.14880. Rf = 0.52 (9:1 dichloromethane to methanol). Melting point 87−90 °C. 2-Chloro-N-cyclopropylquinazolin-4-amine (30d). 1c (0.16 g, 0.78 mmol) was reacted with cyclopropylamine and purified according to method Cb to furnish 0.14 g (0.62 mmol) of the title compound in 80% yield. 1H NMR (250 MHz, CD3OD) δ 7.92 (d, J = 7.9 Hz, 1H), 7.62 (ddd, J = 8.3, 7.0, 1.3 Hz, 1H), 7.45 (d, J = 8.0 Hz, 1H), 7.37− 7.28 (m, 1H), 2.95 (ddd, J = 11.1, 7.4, 3.9 Hz, 1H), 0.82−0.74 (m, 2H), 0.62 (ddd, J = 7.8, 6.1, 4.7 Hz, 2H). 13C NMR (63 MHz, CD3OD) δ 164.23, 158.86, 151.04, 134.80, 127.46, 126.98, 123.74, 114.77, 25.53, 7.05. MS (ESI): [M + H]+ 220; found 220.0. Rf = 0.12 (hexanes to ethyl acetate 2:1). N4-Cyclopropyl-N2-isopropylquinazoline-2,4-diamine (30). 30d (0.10 g, 0.48 mmol) was reacted with isopropylamine and purified according to method Db to furnish 0.094 g (0.39 mmol) of the title compound as a yellow solid in 81% yield. 1H NMR (500 MHz, CD3OD) δ 7.80 (d, J = 8.1 Hz, 1H), 7.44 (dd, J = 11.2, 4.1 Hz, 1H), 7.30 (d, J = 8.0 Hz, 1H), 7.01 (t, J = 7.5 Hz, 1H), 4.24 (dt, J = 12.8, 6.4 Hz, 1H), 2.92 (dt, J = 10.8, 3.6 Hz, 1H), 1.25−1.21 (m, 6H), 0.82−0.77 (m, 2H), 0.67−0.63 (m, 2H). 13C NMR (126 MHz, CD3OD) δ 161.84, 158.25, 149.46, 132.59, 122.51, 122.20, 121.04, 110.79, 42.46, 23.75, 22.04, 5.87. HRMS: m/z calcd for C14H19N4 [M + H]+ 243.16042; found 243.16004. Rf = 0.47 (9:1 dichloromethane to methanol). Melting point 81−85 °C. 2-Chloro-N-cyclopentylquinazolin-4-amine (31d). 1c (0.20 g, 1.0 mmol) was reacted with cyclopentylamine and purified according to method Cb to furnish 0.15 g (0.61 mmol) of the title compound in 61% yield. 13C NMR (101 MHz, DMSO-d6) δ 135.10, 133.42, 127.29, 126.35, 126.26, 126.04, 125.73, 122.64, 53.15, 31.91, 23.76. MS (ESI): [M + H]+ 248; found 248.1. Rf = 0.44 (hexanes to ethyl acetate 4:1). N4-Cyclopentyl-N2-isopropylquinazoline-2,4-diamine (31). 31d (0.12 g, 0.49 mmol) was reacted with isopropylamine and purified according to method Db to furnish 0.047 g (0.17 mmol) of the title compound as a cream crystalline solid in 35% yield. 1H NMR (500 MHz, CD3OD) δ 8.16 (d, J = 7.9 Hz, 1H), 7.66−7.61 (m, 1H), 7.40 (s, 1H), 7.28 (dd, J = 11.6, 4.3 Hz, 1H), 4.61 (dd, J = 14.5, 7.1 Hz, 1H), 4.34−4.24 (m, 1H), 2.18−2.07 (m, 2H), 1.88−1.79 (m, 2H), 1.78−1.69 (m, 2H), 1.69−1.62 (m, 2H), 1.31 (d, J = 6.5 Hz, 6H). 13C NMR (126 MHz, CD3OD) δ 159.89, 153.38, 140.82, 134.25, 123.62, 123.47, 117.46, 109.97, 53.59, 43.43, 31.82, 23.81, 21.45. HRMS: m/z calcd for C16H22N4 [M + H]+ 271.19172; found 271.19178. Rf = 0.50 (9:1 dichloromethane to methanol). Melting point 145−150 °C. 2-Chloro-N-cyclohexylquinazolin-4-amine (32d). 1c (0.16 g, 0.80 mmol) was reacted with cyclohexylamine and purified according to method Cb to furnish 0.15 g (0.55 mmol) of the title compound in 69% yield. 1H NMR (250 MHz, CD3OD) δ 8.05−7.99 (m, 1H), 7.60 (ddd, J = 8.4, 7.0, 1.4 Hz, 1H), 7.46−7.41 (m, 1H), 7.33 (ddd, J = 8.3, 7.0, 1.3 Hz, 1H), 4.17−4.01 (m, 1H), 1.97−1.84 (m, 2H), 1.70 (d, J = 2.6 Hz, 2H), 1.65−1.52 (m, 1H), 1.38−1.25 (m, 4H), 1.20−1.00 (m, 1H). 13C NMR (63 MHz, CD3OD) δ 161.94, 159.05, 151.35, 134.67, 127.25, 126.90, 123.83, 114.81, 51.68, 33.32, 26.71, 26.48. MS (ESI): [M + H]+ 262; found 262.1. Rf = 0.43 (hexanes to ethyl acetate 2:1). N4-Cyclohexyl-N2-isopropylquinazoline-2,4-diamine (32). 32d (0.10 g, 0.40 mmol) was reacted with isopropylamine and purified according to method Db to furnish 0.060 g (0.21 mmol) of the title compound as a white crystalline solid in 53% yield. 1H NMR (400 MHz, CD3OD) δ 7.95 (d, J = 8.0 Hz, 1H), 7.55 (t, J = 7.5 Hz, 1H), 7.31 (d, J = 8.3 Hz, 1H), 7.14 (t, J = 7.6 Hz, 1H), 4.20 (sept, J = 6.5 Hz, 2H), 2.04 (d, J = 2.2 Hz, 2H), 1.83 (d, J = 4.5 Hz, 2H), 1.70 (d, J = 12.4 Hz, 1H), 1.41 (m, 5H), 1.25 (d, J = 6.5 Hz, 6H). 13C NMR (101 MHz, CD3OD) δ 159.82, 157.34, 147.57, 133.16, 122.65, 121.83, 121.25, 110.84, 50.46, 42.93, 32.26, 25.37, 21.93. HRMS: m/z calcd for C17H25N4 [M + H]+ 285.2074; found 285.2077. Rf = 0.38

(dichloromethane to methanol 9:1). Melting point decomposition at 345 °C. 2-Chloro-N-((tetrahydrofuran-2-yl)methyl)quinazolin-4amine (33d). 1c (0.12 g, 0.60 mmol) was reacted with tetrahydrofurfurylamine and purified according to method Cb to furnish 0.13 g (0.49 mmol) of the title compound in 82% yield. 1H NMR (400 MHz, CD3OD) δ 7.98 (d, J = 7.8 Hz, 1H), 7.70−7.65 (m, 1H), 7.50 (d, J = 8.2 Hz, 1H), 7.43−7.37 (m, 1H), 4.22 (qd, J = 6.9, 4.7 Hz, 1H), 3.88 (dd, J = 14.7, 6.9 Hz, 1H), 3.79−3.65 (m, 2H), 3.58 (dd, J = 13.7, 7.6 Hz, 1H), 2.09−1.98 (m, 1H), 1.98−1.81 (m, 2H), 1.70−1.59 (m, 1H). 13C NMR (101 MHz, CD3OD) δ 161.74, 157.50, 149.97, 133.60, 126.21, 125.72, 122.43, 113.46, 77.23, 67.83, 45.17, 28.86, 25.35. MS (ESI): [M + H]+ 264; found 264.1. Rf = 0.15 (hexanes to ethyl acetate 2:1). N2-Isopropyl-N4-((tetrahydrofuran-2-yl)methyl)quinazoline2,4-diamine (33). 33d (0.10 g, 0.38 mmol) was reacted with isopropylamine and purified according to method Db to furnish 0.068 g (0.24 mmol) of the title compound as a clear amorphous solid in 63% yield. 1H NMR (400 MHz, CD3OD) δ 7.78 (d, J = 7.4 Hz, 1H), 7.46 (t, J = 7.1 Hz, 1H), 7.29 (d, J = 8.3 Hz, 1H), 7.01 (t, J = 7.1 Hz, 1H), 4.27−4.16 (m, 2H), 3.87 (dt, J = 13.5, 6.8 Hz, 1H), 3.77−3.55 (m, 3H), 2.04−1.78 (m, 3H), 1.66 (dq, J = 11.8, 6.8 Hz, 1H), 1.22 (d, J = 6.5 Hz, 6H). 13C NMR (101 MHz, CD3OD) δ 160.84, 159.31, 151.40, 132.53, 123.52, 122.07, 120.75, 111.04, 77.69, 67.81, 44.66, 42.45, 28.85, 25.39, 22.29. HRMS: m/z calcd for C16H23N4O [M + H]+ 287.18664; found 287.18737. Rf = 0.13 (2:1 hexanes to ethyl acetate). Methyl-2-(2-chloroquinazolin-4-ylamino)acetate (34d). 1c (0.198 g, 0.99 mmol) was reacted with glycine methyl ester and purified according to method Ca to furnish 0.18 g (0.72 mmol) of the title compound in 73% yield. 1H NMR (400 MHz, CD3OD) δ 7.85 (d, J = 8.1 Hz, 1H), 7.62 (dd, J = 11.3, 4.1 Hz, 1H), 7.45 (d, J = 8.3 Hz, 1H), 7.33 (t, J = 7.6 Hz, 1H), 4.26 (s, 2H), 3.71 (s, 3H). 13C NMR (101 MHz, CD3OD) δ 170.77, 161.67, 157.12, 150.04, 133.76, 126.38, 125.93, 122.25, 113.24, 51.72, 42.35. MS (ESI): [M + H]+ 252; found 252.1. Rf = 0.17 (hexanes to ethyl acetate 2:1). Ethyl-2-(2-(isopropylamino)quinazolin-4-ylamino)acetate (34). 34d (0.12 g, 0.47 mmol) was reacted with isopropylamine and purified according to method Db to furnish 0.060 g (0.21 mmol) of the title compound as an amorphous solid in 44% yield. 1H NMR (400 MHz, CD3OD) δ 7.84 (d, J = 8.2 Hz, 1H), 7.57−7.51 (t, J = 7.8 Hz, 1H), 7.32 (d, J = 8.2 Hz, 1H), 7.10 (t, J = 7.8 Hz, 1H), 4.26−4.14 (m, 5H), 1.25 (t, J = 7.1 Hz, 3H), 1.21 (d, J = 6.5 Hz, 6H). 13C NMR (101 MHz, CD3OD) δ 172.23, 162.13, 159.29, 150.86, 134.31, 123.71, 123.57, 122.61, 111.84, 62.22, 43.87, 43.66, 23.25, 14.52. HRMS: m/z calcd for C15H21N4O2 [M + H]+ 289.1659; found 289.1668. Rf = 0.34 (dichloromethane to methanol 9:1). N2-Benzyl-N4-isopropylquinazoline-2,4-diamine (47). 12d (0.080 g, 0.36 mmol) was reacted with benzylamine and purified according to method Db to furnish 0.019 g (0.065 mmol) of the title compound as a yellow crystalline solid in 18% yield. 1H NMR (400 MHz, DMSO-d6) δ 8.12 (d, J = 6.7 Hz, NH), 7.49 (t, J = 8.2 Hz, 2H), 7.44−7.32 (m, 3H), 7.28 (dd, J = 12.3, 4.7 Hz, 3H), 7.19 (t, J = 7.2 Hz, 1H), 7.08 (s, 1H), 4.57 (s, 2H), 4.44 (d, J = 6.1 Hz, 1H), 1.24 (dd, J = 25.1, 6.5 Hz, 6H). 13C NMR (101 MHz, DMSO-d6) δ 159.75, 141.48, 134.84, 133.28, 129.56, 129.21, 129.04, 128.75, 127.85, 127.08, 123.92, 121.31, 44.69, 42.85, 22.63. HRMS: m/z calcd for C18H21N4 [M + H]+ 293.17607; found 293.17641. Rf = 0.40 (9:1 dichloromethane to methanol). Melting point 200−202 °C. N-Benzyl-2-chloroquinazolin-4-amine (48d). 1c (0.30 g, 1.5 mmol) was reacted with benzylamine and purified according to method Ca to furnish 0.345 g (1.28 mmol) of the title compound in 85% yield. 1H NMR (400 MHz, CDCl3) δ 7.70 (ddd, J = 11.3, 8.4, 4.9 Hz, 3H), 7.48−7.26 (m, 5H), 6.27 (s, 1H), 4.83 (d, J = 5.3 Hz, 2H). 13 C NMR (101 MHz, CDCl3) δ 160.93, 157.93, 151.09, 137.48, 133.76, 129.11, 128.51, 128.21, 128.00, 126.46, 121.07, 113.38, 45.94. MS (ESI): [M + H]+ 270; found 270.0. Rf = 0.21 (hexanes to ethyl acetate 4:1). N4-Benzyl-N2-isopropylquinazoline-2,4-diamine (48). 48d (0.029 g, 0.11 mmol) was reacted with isopropylamine and purified N



Article

δ 10.46 (s, NH), 8.64 (s, NH), 8.45 (d, J = 8.0 Hz, 1H), 7.74 (dt, J = 7.8, 1.5 Hz, 1H), 7.44 (d, J = 8.5 Hz, 1H), 7.36 (dt, J = 7.8, 1.3 Hz, 1H), 7.36−7.12 (m, 10H), 4.75 (d, J = 5.5 Hz, 2H), 4.63 (d, J = 4.8 Hz, 2H). 13C NMR (126 MHz, DMSO-d6) δ 160.26, 153.49, 139.44, 138.85, 138.29, 135.67, 129.93, 128.85, 128.80, 128.24, 128.12, 127.72, 127.57, 124.93, 124.64, 117.19, 110.22, 110.12, 44.86, 44.35. HRMS: m/z calcd for C22H21N4 [M + H]+ 341.1761; found 341.1751. Rf = 0.45 (dichloromethane to methanol 9:1). Melting point 237−240 °C. N2-Benzyl-N4-phenylquinazoline-2,4-diamine (54). 49d (0.10 g, 0.39 mmol) was reacted with benzylamine and purified according to method Da to furnish 0.010 g (0.031 mmol) of the title compound as a white crystalline solid in 10% yield. 1H NMR (500 MHz, DMSO-d6) δ 9.56 (s, 1H), 9.13 (s, 1H), 8.37 (d, J = 7.5 Hz, 1H), 7.92 (d, J = 7.5 Hz, 2H), 7.86 (d, J = 8.1 Hz, 2H), 7.66 (ddd, J = 8.3, 6.9, 1.3 Hz, 1H), 7.48 (d, J = 8.4 Hz, 1H), 7.42−7.35 (m, 2H), 7.27 (ddd, J = 8.1, 7.0, 1.2 Hz, 1H), 7.25−7.20 (m, 2H), 7.13 (t, J = 7.4 Hz, 1H), 6.89 (t, J = 7.3 Hz, 1H), 1.89 (s, 2H). 13C NMR (101 MHz, DMSO-d6) δ 159.01, 157.09, 152.33, 141.80, 140.10, 133.64, 129.12, 128.92, 126.26, 124.14, 123.77, 123.10, 122.52, 121.45, 119.58, 112.43, 21.76. HRMS: m/z calcd for C21H19N4 [M + H]+ 327.16097; found 327.16140. Rf = 0.53 (9:1 dichloromethane to methanol). Melting point decomposition at 310 °C. N2,N4-Diphenylquinazoline-2,4-diamine (55). 49d (0.10 g, 0.39 mmol) was reacted with aniline and purified according to method Da to furnish 0.011 g (0.035 mmol) of the title compound in 9% yield. 1H NMR (500 MHz, DMSO-d6) δ 11.27 (s, 1H), 10.63 (s, 1H), 8.75 (d, J = 8.2 Hz, 1H), 7.95−7.85 (m, 1H), 7.68 (d, J = 7.7 Hz, 2H), 7.62− 7.56 (m, 1H), 7.56−7.49 (m, 1H), 7.49−7.38 (m, 4H), 7.34−7.26 (m, 3H), 7.16 (t, J = 6.4 Hz, 1H). 13C NMR (126 MHz, DMSO-d6) δ 159.50, 151.56, 139.50, 136.94, 136.64, 135.74, 128.80, 128.59, 126.29, 124.95, 124.92, 124.86, 124.82, 122.09, 117.53, 110.49, 56.03, 18.57. HRMS: m/z calcd for C20H17N4 [M + H]+ 313.14477; found 313.14503. Rf = 0.55 (9:1 dichloromethane to methanol). Melting point decomposition at 305 °C. N 2-Benzyl-N 4-(furan-2-ylmethyl)quinazoline-2,4-diamine (56). 1d (0.10 g, 0.39 mmol) was reacted with benzylamine and purified according to method Da to furnish 0.080 g (0.24 mmol) of the title compound as a white crystalline solid in 62% yield. 1H NMR (400 MHz, CD3OD) δ 7.86 (t, J = 10.0 Hz, 1H), 7.50 (t, J = 7.7 Hz, 1H), 7.36−7.08 (m, 8H), 6.26 (dd, J = 2.9, 1.9 Hz, 1H), 6.15 (s, 1H), 4.75− 4.55 (m, 4H). 13C NMR (101 MHz, CD3OD) δ 160.60, 151.87, 141.95, 139.64, 133.80, 133.64, 128.30, 127.41, 127.16, 126.85, 122.76, 122.44, 120.86, 110.71, 110.21, 107.28, 44.73, 37.61. HRMS: m/z calcd for C20H19N4O [M + H]+ 331.15589; found 331.15673. Rf = 0.49 (9:1 dichloromethane to methanol). Melting point decomposition at 150 °C. 2-Chloro-N-(4-chlorobenzyl)quinazolin-4-amine (57d). 1c (0.22 g, 1.1 mmol) was reacted with 4-chlorobenzylamine and purified according to method Ca to furnish 0.27 g (0.89 mmol) of the title compound in 81% yield. 1H NMR (400 MHz, CDCl3) δ 7.80−7.65 (m, 3H), 7.45 (t, J = 6.4 Hz, 1H), 7.32 (s, 4H), 6.31 (s, 1H), 4.83 (d, J = 5.3 Hz, 2H). 13C NMR (101 MHz, CDCl3) δ 160.68, 157.57, 150.87, 135.80, 133.79, 133.63, 129.60, 128.96, 127.82, 126.32, 120.76, 113.08, 44.89. MS (ESI): [M + H]+ 290; found 290.0. Rf = 0.31 (hexanes to ethyl acetate 2:1). N4-(4-Chlorobenzyl)-N2-(furan-2-ylmethyl)quinazoline-2,4diamine (57). 57d (0.032 g, 0.11 mmol) was reacted with furfurylamine and purified according to method Db to furnish 0.015 g (0.0 mmol) of the title compound in 39% yield. 1H NMR (500 MHz, CD3OD) δ 8.06 (dd, J = 8.3, 0.9 Hz, 1H), 7.72 (t, J = 10.9 Hz, 2H), 7.55 (ddd, J = 8.4, 5.1, 1.3 Hz, 1H), 7.41−7.35 (m, 2H), 7.29− 7.25 (m, 2H), 7.15 (ddd, J = 8.2, 7.0, 1.1 Hz, 1H), 6.30 (dd, J = 3.2, 1.8 Hz, 1H), 6.16 (s, 1H), 4.55 (s, 2H). 13C NMR (126 MHz, CD3OD) δ 160.05, 159.84, 154.60, 142.88, 142.86, 139.13, 134.41, 129.81, 129.39, 125.19, 124.83, 123.55, 123.06, 112.34, 111.32, 107.31, 39.44. HRMS: m/z calcd for C19H15ClN4O [M + H]+ 351.1007; found 351.1000. Rf = 0.60 (9:1 dichloromethane to methanol). Melting point decomposition at 180 °C. N2-(4-Chlorophenyl)-N4-(furan-2-ylmethyl)quinazoline-2,4diamine (58). 1d (0.10 g, 0.39 mmol) was reacted with benzylamine

according to method Db to furnish 0.016 g (0.055 mmol) of the title compound as a white crystalline solid in 50% yield. 1H NMR (400 MHz, DMSO-d6) δ 9.55 (s, NH), 8.18 (s, NH), 7.59 (s, 1H), 7.34 (dt, J = 22.9, 7.5 Hz, 6H), 7.23 (t, J = 7.2 Hz, 1H), 7.17 (s, 1H), 4.75 (d, J = 5.6 Hz, 2H), 4.14 (dd, J = 13.1, 6.5 Hz, 1H), 1.13 (d, J = 6.3 Hz, 6H). 13C NMR (101 MHz, DMSO-d6) δ 160.45, 156.58, 145.74, 139.91, 134.13, 128.93, 128.00, 127.46, 123.99, 123.05, 122.11, 111.11, 44.42, 42.88, 23.37. HRMS: m/z calcd for C 18H20N4O [M] + 308.16316; found 308.15874. Rf = 0.47 (9:1 dichloromethane to methanol). Melting point 161−164 °C. 2-Chloro-N-phenylquinazolin-4-amine (49d). 1c (0.30 g, 1.5 mmol) was reacted with aniline and purified according to method Ca to furnish 0.36 g (1.4 mmol) of the title compound as a white solid in 94% yield. 1H NMR (400 MHz, CDCl3) δ 7.90−7.73 (m, 2H), 7.70− 7.48 (m, 3H), 7.47−7.32 (m, 1H), 7.24−7.11 (m, 2H), 7.01 (dd, J = 15.4, 8.1 Hz, 1H). MS (ESI): [M + H]+ 256; found 256.0. Rf = 0.19 (hexanes to ethyl acetate 4:1). N2-Isopropyl-N4-phenylquinazoline-2,4-diamine (49). 49d (0.039 g, 0.15 mmol) was reacted with isopropylamine and purified according to method Db to furnish 0.010 g (0.036 mmol) of the title compound as a white solid in 24% yield. 1H NMR (400 MHz, DMSOd6) δ 9.49 (s, NH), 8.31 (d, J = 8.0 Hz, 1H), 7.90 (d, J = 7.2 Hz, 2H), 7.57 (t, J = 7.5 Hz, 1H), 7.34 (t, J = 7.7 Hz, 3H), 7.15 (t, J = 7.4 Hz, 1H), 7.07 (t, J = 7.2 Hz, 1H), 6.85 (s, NH), 4.11 (s, 1H), 1.15 (d, J = 6.5 Hz, 6H). 13C NMR (101 MHz, DMSO-d6) δ 158.10, 157.06, 151.00, 139.37, 132.99, 128.35, 127.63, 125.56, 123.28, 121.97, 120.90, 110.77, 42.03, 22.33. HRMS: m/z calcd for C17H19N4 [M + H]+ 279.16042; found 279.16094. Rf = 0.50 (9:1 dichloromethane to methanol). Melting point decomposition at 240 °C. N4-Benzyl-N2-butylquinazoline-2,4-diamine (50). 48d (0.10 g, 0.37 mmol) was reacted with n-butylamine and purified according to method Da to furnish 0.047 g (0.15 mmol) of the title compound as a white solid in 41% yield. 1H NMR (400 MHz, CDCl3) δ 9.54 (s, 1H), 8.43 (d, J = 8.1 Hz, 1H), 7.82 (s, 1H), 7.44−7.37 (m, 3H), 7.25−7.11 (m, 5H), 4.83 (d, J = 5.7 Hz, 2H), 3.39 (q, J = 6.8 Hz, 2H), 1.49 (p, J = 7.3 Hz, 2H), 1.31 (sext, J = 7.3 Hz, 2H), 0.85 (t, J = 7.3 Hz, 3H). 13 C NMR (101 MHz, CDCl3) δ 160.08, 153.46, 137.43, 134.65, 128.41, 127.83, 127.40, 124.41, 124.12, 116.62, 109.99, 109.68, 45.31, 41.02, 31.30, 19.95, 13.66. HRMS: m/z calcd for C19H23N4 [M + H]+ 307.1917; found 307.1926. Rf = 0.33 (dichloromethane to methanol 9:1). Melting point 210−212 °C. N2-Butyl-N4-phenylquinazoline-2,4-diamine (51). 49d (0.10 g, 0.39 mmol) was reacted with n-butylamine and purified according to method Da to furnish 0.011 g (0.038 mmol) of the title compound as a white crystalline solid in 10% yield. 1H NMR (400 MHz, DMSO-d6) δ 10.96 (s, 1H), 8.62 (d, J = 8.1 Hz, 1H), 8.25 (s, 1H), 7.85−7.70 (m, 3H), 7.51−7.37 (m, 4H), 7.25 (t, J = 6.7 Hz, 1H), 3.31−3.22 (m, 2H), 1.49 (dd, J = 24.5, 17.8 Hz, 2H), 1.39−1.14 (m, 2H), 0.92−0.70 (m, 3H). 13C NMR (126 MHz, DMSO-d6) δ 159.34, 153.33, 139.99, 137.54, 136.02, 128.96, 126.44, 125.16, 124.68, 123.20, 117.25, 110.23, 41.01, 31.40, 19.89, 14.01. HRMS: m/z calcd for C18H21N4 [M + H]+ 293.17662; found 293.17630. Rf = 0.33 (9:1 dichloromethane to methanol). Melting point 189−191 °C. N4-Butyl-N2-phenylquinazoline-2,4-diamine (52). 28d (0.080 g, 0.34 mmol) was reacted with aniline and purified according to method Da to furnish 0.021 g (0.071 mmol) of the title compound as a white crystalline solid in 21% yield. 1H NMR (400 MHz, DMSO-d6) δ 10.51 (s, 1H), 9.97 (s, 1H), 8.41 (d, J = 8.1 Hz, 1H), 7.82 (t, J = 7.6 Hz, 1H), 7.62 (d, J = 7.8 Hz, 2H), 7.52 (d, J = 8.2 Hz, 1H), 7.48−7.39 (m, 3H), 7.20 (t, J = 7.4 Hz, 1H), 3.56 (q, J = 6.8 Hz, 2H), 1.65 (p, J = 7.5 Hz, 2H), 1.36 (h, J = 7.4 Hz, 2H), 0.90 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, DMSO-d6) δ 159.95, 151.41, 138.60, 136.95, 135.24, 128.88, 124.74, 124.63, 124.31, 121.76, 117.29, 110.21, 41.43, 30.08, 19.72, 13.61. HRMS: m/z calcd for C18H21N4 [M + H]+ 293.17662; found 293.17709. Rf = 0.49 (9:1 dichloromethane to methanol). Melting point 234−236 °C. N2,N4-Dibenzylquinazoline-2,4-diamine (53). 48d (0.10 g, 0.37 mmol) was reacted with benzylamine and purified according to method Da to furnish 0.101 g (0.297 mmol) of the title compound as a white crystalline solid in 80% yield. 1H NMR (500 MHz, DMSO-d6) O



Article

2-Chloro-N-(4-methylbenzyl)quinazolin-4-amine (64d). 1c (0.22 g, 1.1 mmol) was reacted with 4-methylbenzylamine and purified according to method Ca to furnish 0.29 g (1.0 mmol) of the title compound in 90% yield. 1H NMR (400 MHz, CDCl3) δ 7.76− 7.63 (m, 3H), 7.40 (t, J = 8.0 Hz, 1H), 7.26 (d, J = 7.9 Hz, 2H), 7.14 (d, J = 7.8 Hz, 2H), 6.23 (s, 1H), 4.78 (d, J = 5.2 Hz, 2H), 2.32 (s, 3H). 13C NMR (101 MHz, CDCl3) δ 160.63, 157.70, 150.82, 137.79, 134.15, 133.46, 129.52, 128.30, 127.74, 126.16, 120.83, 113.16, 45.52, 21.11. MS (ESI): [M + H]+ 284; found 283.9. Rf = 0.39 (hexanes to ethyl acetate 2:1). N2-Benzyl-N4-(4-methylbenzyl)quinazoline-2,4-diamine (64). 64d (0.086 g, 0.30 mmol) was reacted with benzylamine and purified according to method Da to furnish 0.058 g (0.16 mmol) of the title compound as a white powder in 55% yield. 1H NMR (400 MHz, DMSO-d6) δ 10.44 (s, 1H), 8.63 (s, 1H), 8.46 (d, J = 8.0 Hz, 1H), 7.76 (t, J = 7.7 Hz, 1H), 7.47 (d, J = 8.1 Hz, 1H), 7.37 (t, J = 7.7 Hz, 1H), 7.26 (s, 5H), 7.19 (d, J = 6.9 Hz, 2H), 7.03 (d, J = 6.8 Hz, 2H), 4.70 (d, J = 5.2 Hz, 2H), 4.66 (s, 2H), 2.24 (s, 3H). 13C NMR (101 MHz, DMSO-d6) δ 160.13, 153.50, 139.40, 138.83, 136.60, 135.58, 135.21, 129.29, 128.79, 128.05, 127.67, 127.50, 124.88, 124.56, 117.17, 110.12, 44.61, 44.31, 21.11. HRMS: m/z calcd for C23H23N4 [M + H]+ 355.1917; found 355.1907. Rf = 0.38 (9:1 dichloromethane to methanol). Melting point 221−223 °C. N2,N4-Bis(4-methylbenzyl)quinazoline-2,4-diamine (65). 64d (0.086 g, 0.30 mmol) was reacted with 4-methylbenzylamine and purified according to method Da to furnish 0.080 g (0.22 mmol) of the title compound as a fluffy white crystalline solid in 72% yield. 1H NMR (400 MHz, DMSO-d6) δ 10.43 (s, 1H), 8.59 (s, 1H), 8.45 (d, J = 8.1 Hz, 1H), 7.76 (t, J = 7.7 Hz, 1H), 7.46 (d, J = 8.1 Hz, 1H), 7.37 (t, J = 7.7 Hz, 1H), 7.16 (dd, J = 19.9, 7.2 Hz, 4H), 7.08−7.00 (m, 4H), 4.71 (d, J = 5.5 Hz, 2H), 4.59 (d, J = 4.3 Hz, 2H), 2.25 (s, 3H), 2.24 (s, 3H). 13C NMR (101 MHz, DMSO-d6) δ 160.10, 153.41, 139.32, 136.57, 135.74, 135.60, 135.21, 129.33, 129.28, 128.01, 127.62, 124.88, 124.57, 117.10, 110.07, 44.59, 44.08, 21.11. Rf = 0.34 (9:1 dichloromethane to methanol). HRMS: m/z calcd for C24H25N4 [M + H]+ 369.2074; found 369.2091. Rf = 0.34 (9:1 dichloromethane to methanol). Melting point 249−251 °C. N4-Benzyl-N2-(4-methoxybenzyl)quinazoline-2,4-diamine (66). 48d (0.089 g, 0.33 mmol) was reacted with 4-methoxybenzylamine and purified according to method Da to furnish 0.096 g (0.26 mmol) of the title compound as a white crystalline solid in 79% yield. 1 H NMR (400 MHz, DMSO-d6) δ 10.49 (s, 1H), 8.57 (s, 1H), 8.48 (d, J = 8.1 Hz, 1H), 7.76 (t, J = 7.7 Hz, 1H), 7.45 (d, J = 7.6 Hz, 1H), 7.40−7.23 (m, 6H), 7.17 (d, J = 7.6 Hz, 2H), 6.79 (d, J = 7.7 Hz, 2H), 4.79 (d, J = 5.8 Hz, 2H), 4.56 (d, J = 4.2 Hz, 2H), 3.70 (s, 3H). 13C NMR (101 MHz, DMSO-d6) δ 160.23, 158.82, 153.39, 139.38, 138.32, 135.59, 130.63, 129.15, 128.77, 127.98, 127.51, 124.91, 124.54, 117.10, 114.18, 110.07, 55.46, 44.81, 43.79. HRMS: m/z calcd for C23H23N4O [M + H]+ 371.1866; found 371.1872. Rf = 0.38 (9:1 dichloromethane to methanol). Melting point 246−248 °C. 2-Chloro-N-(4-methoxybenzyl)quinazolin-4-amine (67d). 1c (0.22 g, 1.1 mmol) was reacted with 4-methoxybenzylamine and purified according to method Ca to furnish 0.24 g (0.82 mmol) of the title compound in 74% yield. 1H NMR (400 MHz, CDCl3) δ 7.77− 7.65 (m, 3H), 7.41 (ddd, J = 8.2, 6.5, 1.7 Hz, 1H), 7.31 (d, J = 8.6 Hz, 2H), 6.87 (dd, J = 9.1, 2.5 Hz, 2H), 6.24 (s, 1H), 4.76 (d, J = 5.2 Hz, 2H), 3.78 (d, J = 5.7 Hz, 3H). 13C NMR (101 MHz, CDCl3) δ 160.57, 159.37, 157.69, 150.81, 133.46, 129.72, 129.22, 127.72, 126.15, 120.85, 114.22, 113.16, 55.29, 45.25. MS (ESI): [M + H]+ 300; found 300.0. Rf = 0.27 (hexanes to ethyl acetate 2:1). N2-Benzyl-N4-(4-methoxybenzyl)quinazoline-2,4-diamine (67). 67d (0.089 g, 0.30 mmol) was reacted with benzylamine and purified according to method Da to furnish 0.092 g (0.25 mmol) of the title compound as a white crystalline solid in 83% yield. 1H NMR (400 MHz, DMSO-d6) δ 10.46 (s, 1H), 8.65 (s, 1H), 8.47 (d, J = 8.1 Hz, 1H), 7.75 (t, J = 7.7 Hz, 1H), 7.46 (d, J = 7.6 Hz, 1H), 7.40−7.15 (m, 8H), 6.76 (d, J = 7.7 Hz, 2H), 4.68 (d, J = 5.5 Hz, 4H), 3.69 (s, 3H). 13 C NMR (101 MHz, DMSO-d6) δ 159.99, 158.81, 153.48, 139.28, 138.85, 135.57, 130.13, 129.57, 128.83, 127.57, 127.49, 124.90, 124.56, 117.07, 114.10, 110.12, 55.45, 55.44, 44.29. HRMS: m/z calcd for

and purified according to method Da to furnish 0.089 g (0.25 mmol) of the title compound as a white crystalline solid in 64% yield. 1H NMR (400 MHz, CD3OD) δ 7.92−7.87 (m, 1H), 7.65 (d, J = 8.9 Hz, 2H), 7.57−7.52 (m, 1H), 7.41 (d, J = 8.6 Hz, 2H), 7.19 (t, J = 5.8 Hz, 2H), 7.18−7.12 (m, 1H), 6.33 (dd, J = 3.1, 1.9 Hz, 1H), 6.25 (d, J = 2.9 Hz, 1H), 4.76 (s, 2H). 13C NMR (101 MHz, CD3OD) δ 161.92, 158.22, 153.69, 151.81, 142.98, 140.74, 133.99, 129.32, 127.39, 125.75, 123.38, 122.08, 113.04, 111.37, 107.93, 99.72, 38.86. HRMS: m/z calcd for C19H16ClN4O [M + H]+ 351.1007; found 351.1027. Rf = 0.52 (9:1 dichloromethane to methanol). Melting point 143−145 °C. N4-(Furan-2-ylmethyl)-N2-(p-tolyl)quinazoline-2,4-diamine (59). 1d (0.34 g, 1.3 mmol) was reacted with p-toluidine and purified according to method Da to furnish 0.42 g (0.1.27 mmol) of the title compound as a yellow solid in 98% yield. 1H NMR (400 MHz, CD3OD) δ 8.15 (d, J = 8.1 Hz, 1H), 7.80 (t, J = 7.6 Hz, 1H), 7.54 (d, J = 8.3 Hz, 1H), 7.48−7.38 (m, 4H), 7.26 (d, J = 7.9 Hz, 2H), 6.34 (d, J = 17.1 Hz, 1H), 6.26 (s, 1H), 4.82 (s, 2H), 2.37 (s, 3H). 13C NMR (101 MHz, CD3OD) δ 160.92, 152.41, 150.44, 142.49, 139.19, 136.57, 135.44, 133.39, 129.74, 125.24, 124.05, 123.62, 117.26, 110.53, 110.30, 108.06, 38.20, 19.84. HRMS: m/z calcd for C20H19N4O [M + H]+ 331.1553; found 331.1544. Rf = 0.60 (9:1 dichloromethane to methanol). Melting point decomposition at 225 °C. N4-Benzyl-N2-(4-chlorobenzyl)quinazoline-2,4-diamine (60). 48d (0.075 g, 0.28 mmol) was reacted with 4-chlorobenzylamine and purified according to method Da to furnish 0.098 g (0.26 mmol) of the title compound as a white crystalline solid in 93% yield. 1H NMR (400 MHz, DMSO-d6) δ 13.09 (s, 1H), 10.45 (s, 1H), 8.65 (s, 1H), 8.46 (d, J = 8.0 Hz, 1H), 7.77 (t, J = 7.7 Hz, 1H), 7.49 (d, J = 7.8 Hz, 1H), 7.39 (t, J = 7.7 Hz, 1H), 7.26 (d, J = 13.1 Hz, 8H), 4.74 (d, J = 5.2 Hz, 2H), 4.63 (d, J = 4.3 Hz, 2H). 13C NMR (101 MHz, DMSO-d6) δ 160.25, 153.49, 139.45, 138.22, 137.99, 135.64, 131.99, 129.43, 128.73, 128.70, 127.97, 127.51, 124.86, 124.65, 117.25, 110.14, 44.79, 43.71. HRMS: m/z calcd for C22H20ClN4 [M + H]+ 375.1371; found 375.1384. Rf = 0.34 (9:1 dichloromethane to methanol). Melting point 268−270 °C. N2-Benzyl-N4-(4-chlorobenzyl)quinazoline-2,4-diamine (61). 57d (0.084 g, 0.28 mmol) was reacted with benzylamine and purified according to method Da to furnish 0.084 g (0.22 mmol) of the title compound as a white crystalline solid in 80% yield. 1H NMR (400 MHz, DMSO-d6) δ 13.06 (s, 1H), 10.54 (s, 1H), 8.64 (s, 1H), 8.47 (d, J = 8.1 Hz, 1H), 7.77 (t, J = 7.7 Hz, 1H), 7.48 (d, J = 7.9 Hz, 1H), 7.41−7.36 (m, 1H), 7.28 (dd, J = 23.2, 6.5 Hz, 8H), 4.73 (d, J = 5.5 Hz, 2H), 4.63 (d, J = 4.9 Hz, 2H). 13C NMR (101 MHz, DMSO-d6) δ 160.30, 153.44, 139.37, 138.79, 137.30, 135.68, 132.06, 129.81, 128.77, 128.67, 127.58, 127.47, 124.93, 124.64, 117.15, 110.08, 44.29, 44.15. HRMS: m/z calcd for C22H20ClN4 [M + H]+ 375.1371; found 375.1377. Rf = 0.29 (9:1 dichloromethane to methanol). Melting point 246−248 °C. N2,N4-Bis(4-chlorobenzyl)quinazoline-2,4-diamine (62). 57d (0.081 g, 0.27 mmol) was reacted with 4-chorobenzylamine and purified according to method Db to furnish 0.028 g (0.068 mmol) of the title compound as a white solid in 25% yield. 1H NMR (400 MHz, DMSO-d6) δ 8.59 (s, 1H), 8.04 (d, J = 8.1 Hz, 1H), 7.50 (t, J = 7.5 Hz, 1H), 7.25 (d, J = 8.4 Hz, 9H), 7.06 (t, J = 7.5 Hz, 1H), 4.67 (s, 2H), 4.48 (s, 2H), 3.70 (s, 1H). HRMS: m/z calcd for C22H19Cl2N4 [M + H]+ 409.0981; found 409.0983. Rf = 0.27 (9:1 dichloromethane to methanol). Melting point 174−177 °C. N4-Benzyl-N2-(4-methylbenzyl)quinazoline-2,4-diamine (63). 48d (0.065 g, 0.24 mmol) was reacted with 4-methylbenzylamine and purified according to method Da to furnish 0.066 g (0.19 mmol) of the title compound as a white crystalline solid in 78% yield. 1H NMR (400 MHz, DMSO-d6) δ 10.47 (s, 1H), 8.60 (s, 1H), 8.47 (d, J = 8.0 Hz, 1H), 7.76 (t, J = 7.7 Hz, 1H), 7.46 (d, J = 7.6 Hz, 1H), 7.40−7.35 (m, 1H), 7.31 (s, 2H), 7.25 (d, J = 3.4 Hz, 3), 7.10 (dd, J = 36.0, 6.9 Hz, 4H), 4.77 (d, J = 5.6 Hz, 2H), 4.60 (s, 2H), 2.25 (s, 3H). 13C NMR (101 MHz, DMSO-d6) δ 160.21, 153.46, 139.39, 138.28, 136.59, 135.73, 135.62, 129.35, 128.75, 128.07, 127.67, 127.52, 124.90, 124.57, 117.12, 110.09, 44.81, 44.11, 21.12. HRMS: m/z calcd for C23H23N4 [M + H]+ 355.1917; found 355.1915. Rf = 0.35 (9:1 dichloromethane to methanol). Melting point 258−260 °C. P



Article

C23H23N4O [M + H]+ 371.1866; found 371.1877. Rf = 0.38 (9:1 dichloromethane to methanol). Melting point 222−224 °C. N2,N4-Bis(4-methoxybenzyl)quinazoline-2,4-diamine (68). 67d (0.090 g, 0.30 mmol) was reacted with 4-methoxybenzylamine and purified according to method Da to furnish 0.098 g (0.24 mmol) of the title compound as a white crystalline solid in 82% yield. 1H NMR (400 MHz, DMSO-d6) δ 10.42 (s, 1H), 8.57 (s, 1H), 8.45 (d, J = 8.1 Hz, 1H), 7.75 (t, J = 7.7 Hz, 1H), 7.45 (d, J = 7.5 Hz, 1H), 7.36 (t, J = 7.7 Hz, 1H), 7.21 (dd, J = 19.9, 7.6 Hz, 4H), 6.80 (t, J = 8.5 Hz, 4H), 4.70 (d, J = 5.7 Hz, 2H), 4.60 (s, 2H), 3.71 (s, 3H), 3.70 (s, 3H). 13 C NMR (101 MHz, DMSO-d6) δ 160.05, 158.81, 153.38, 139.33, 135.57, 130.72, 130.18, 129.42, 129.02, 124.89, 124.54, 117.10, 114.18, 114.11, 110.07, 55.43, 44.27, 43.78. HRMS: m/z calcd for C24H25N4O2 [M + H]+ 401.1972; found 401.1985. Rf = 0.46 (9:1 dichloromethane to methanol). Melting point 257−259 °C. 2,4,6-Trichloroquinazoline (69c). Commercially available 2amino-5-chlorobenzoic acid (1 g, 5.8 mmol) was reacted according to general procedure A to give crude 69b. Without further purification, 69b was reacted according to general procedure B to give 0.55 g (2.7 mmol) of the crude title compound (47% over two steps). 1H NMR (250 MHz, CDCl3) δ 8.17 (d, J = 8.9 Hz, 1H), 7.94 (d, J = 2.0 Hz, 1H), 7.66 (dd, J = 8.9, 2.0 Hz, 1H). 13C NMR (63 MHz, CDCl3) δ 163.85, 156.31, 152.68, 142.97, 130.45, 127.37, 127.07, 120.77. MS (ESI): [M + H]+ 233; found 232.9. Rf = 0.68 (hexanes to ethyl acetate 4:1). N-Benzyl-2,7-dichloroquinazolin-4-amine (69d). 69c (0.51 g, 2.2 mmol) was reacted with benzylamine and purified according to method Cb to furnish 0.59 g (1.9 mmol) of the title compound in 89% yield. 1H NMR (250 MHz, CDCl3) δ 7.61 (d, J = 2.0 Hz, 1H), 7.57 (d, J = 8.8 Hz, 1H), 7.34−7.18 (m, 6H), 6.29 (s, 1H), 4.76 (d, J = 5.3 Hz, 2H). 13C NMR (63 MHz, CDCl3) δ 160.42, 158.82, 151.67, 139.79, 136.95, 128.95, 128.39, 128.14, 127.04, 126.91, 122.42, 111.58, 45.86. MS (ESI): [M + H]+ 304; found 304.0. Rf = 0.47 (hexanes to ethyl acetate 2:1). N2,N4-Dibenzyl-7-chloroquinazoline-2,4-diamine (69). 69d (0.086 g, 0.28 mmol) was reacted with benzylamine and purified according to method Db to furnish 0.076 g (0.20 mmol) of the title compound as a yellow crystalline solid in 72% yield. 1H NMR (250 MHz, CD3OD) δ 7.81 (d, J = 8.7 Hz, 1H), 7.36−7.05 (m, 11H), 6.99 (d, J = 8.5 Hz, 1H), 4.70 (s, 2H), 4.57 (s, 2H). 13C NMR (101 MHz, CDCl3) δ 159.74, 159.66, 152.49, 139.62, 138.75, 138.25, 128.73, 128.47, 127.94, 127.60, 127.54, 127.04, 124.33, 122.32, 121.69, 45.44, 45.10. HRMS: m/z calcd for C22H20ClN4 [M + H]+ 375.1371; found 375.1390. Rf = 0.54 (9:1 dichloromethane to methanol). Melting point 146−149 °C. N4-Benzyl-N2-butyl-7-chloroquinazoline-2,4-diamine (70). 69d (0.088 g, 0.29 mmol) was reacted with butylamine and purified according to method Db to furnish 0.089 g (0.26 mmol) of the title compound as a yellow crystalline solid in 90% yield. 1H NMR (250 MHz, CD3OD) δ 7.82 (d, J = 8.7 Hz, 1H), 7.40−7.06 (m, 6H), 6.97 (dd, J = 8.7, 1.9 Hz, 1H), 4.99 (s, 2H), 3.39−3.27 (m, 2H), 1.35 (ddd, J = 26.5, 20.7, 9.5 Hz, 4H), 0.88 (t, J = 7.2 Hz, 3H). 13C NMR (63 MHz, CD3OD) δ 161.65, 161.51, 153.70, 140.72, 139.64, 129.43, 128.47, 127.97, 125.24, 123.56, 122.13, 110.85, 45.39, 42.09, 33.22, 21.25, 14.39. HRMS: m/z calcd for C19H21ClN4 [M + H]+ 341.1527; found 341.1545. Rf = 0.39 (9:1 dichloromethane to methanol). Melting point 121−123 °C. 2,7-Dichloro-N-(4-chlorobenzyl)quinazoline-4-amine (71d). 69c (0.32 g, 1.4 mmol) was reacted with 4-chlorobenzylamine and purified according to method Cb to furnish 0.33 g (0.98 mmol) of the title compound in 71% yield. 1H NMR (400 MHz, CDCl3) δ 7.74 (d, J = 8.7 Hz, 1H), 7.62 (d, J = 1.6 Hz, 1H), 7.36 (dd, J = 8.7, 1.8 Hz, 1H), 7.25 (dd, J = 16.8, 8.4 Hz, 4H), 6.64 (s, 1H), 4.78 (d, J = 5.3 Hz, 2H). 13 C NMR (101 MHz, CDCl3) δ 160.46, 158.67, 151.57, 139.86, 135.41, 133.84, 129.67, 128.88, 127.11, 126.70, 122.56, 111.54, 45.04. MS (ESI): [M + H]+ 338; found 337.9. Rf = 0.51 (hexanes to ethyl acetate 2:1). 7-Chloro-N2,N4-bis(4-chlorobenzyl)quinazoline-2,4-diamine (71). 71d (0.082 g, 0.24 mmol) was reacted with 4-chlorobenzylamine and purified according to method Da to furnish 0.038 g (0.086 mmol)

of the title compound as a white crystalline solid in 36% yield. 1H NMR (400 MHz, CDCl3) δ 7.42 (s, 1H), 7.39 (d, J = 8.7 Hz, 1H), 7.28−7.17 (m, 10H), 7.00 (dd, J = 8.7, 2.1 Hz, 1H), 4.68 (d, J = 5.5 Hz, 2H), 4.61 (d, J = 5.7 Hz, 2H). 13C NMR (101 MHz, CD3OD) δ 160.25, 160.15, 152.34, 139.29, 138.37, 138.05, 132.16, 131.88, 128.45, 128.13, 127.97, 127.89, 127.17, 123.78, 122.33, 121.02, 43.63, 43.18. . HRMS: m/z calcd for C22H18Cl3N4 [M + H]+ 443.0592; found 443.0582. Rf = 0.77 (9:1 dichloromethane to methanol). Melting point 190−191 °C. N4-Benzyl-7-chloro-N2-(4-methoxybenzyl)quinazoline-2,4diamine (72). 69d (0.10 g, 0.35 mmol) was reacted with 4methoxybenzylamine and purified according to method Da to furnish 0.094 g (0.23 mmol) of the title compound as a white crystalline solid in 67% yield. 1H NMR (400 MHz, CDCl3) δ 7.44 (s, 1H), 7.36 (d, J = 8.7 Hz, 1H), 7.34−7.23 (m, 7H), 6.97 (dd, J = 8.7, 1.2 Hz, 1H), 6.82 (d, J = 8.4 Hz, 2H), 5.70 (bs, 1H), 5.26 (bs, 1H), 4.73 (d, J = 5.4 Hz, 2H), 4.60 (d, J = 5.7 Hz, 2H), 3.77 (s, 3H). 13C NMR (101 MHz, CDCl3) δ 172.49, 159.86, 159.70, 158.70, 153.19, 138.61, 138.32, 131.76, 128.91, 128.75, 127.93, 127.62, 124.83, 122.06, 121.49, 113.86, 55.25, 45.09, 44.97. HRMS: m/z calcd for C23H22ClN4O [M + H]+ 405.1477; found 405.1486. Rf = 0.62 (9:1 dichloromethane to methanol). Melting point 221−223 °C. 7-Chloro- N 4 -(4-chlorobenzyl)-N 2 -(4-methoxybenzyl)quinazoline-2,4-diamine (73). 71d (0.082 g, 0.24 mmol) was reacted with 4-methoxybenzylamine and purified according to method Da to furnish 0.044 g (0.10 mmol) of the title compound as a white crystalline solid in 42% yield. 1H NMR (400 MHz, DMSO-d6) δ 10.57 (s, 1H), 8.63 (s, 1H), 8.47 (d, J = 8.8 Hz, 1H), 7.51 (s, 1H), 7.40 (dd, J = 8.8, 1.7 Hz, 1H), 7.27 (dd, J = 14.6, 8.3 Hz, 4H), 7.07 (d, J = 8.2 Hz, 2H), 6.73 (d, J = 8.3 Hz, 2H), 4.72 (d, J = 5.4 Hz, 2H), 4.49 (d, J = 5.4 Hz, 2H), 3.67 (s, 3H). 13C NMR (101 MHz, DMSO-d6) δ 159.82, 158.80, 153.37, 140.77, 139.98, 137.19, 132.08, 130.51, 129.69, 129.10, 128.69, 127.06, 124.67, 116.54, 114.09, 109.05, 90.55, 55.42, 44.19, 43.88. HRMS: m/z calcd for C23H21Cl2N4O [M + H]+ 439.1087; found 439.1085. Rf = 0.79 (9:1 dichloromethane to methanol). Melting point 261−262 °C. Physicochemical Property Assays. Permeability Assay. Permeability Pe was determined by a standard parallel artificial membrane permeability assay (PAMPA by pION) as reported previously.14b Aqueous Solubility Assay. Solubility at pH 7.4 was determined using a Biomek FX lab automation workstation with pION μSOL evolution software as reported previously and at pH 2.0 using an inhouse HPLC assay.14b For pH 2.0, a calibration curve was made by plotting the area under the curve at 254 nm (UV by HPLC) against the concentration of each compound injected after performing a serial dilution (25−0.781 μM) using a solvent in which the compound is soluble (DMSO). A 100 μM solution was then made for each compound in a buffer at pH 2.0 by performing a 1:100 serial dilution using a 10 mM DMSO stock solution of each compound. This solution was incubated at 21 °C for 18 h, filtered using a filter plate, and injected into the HPLC to compare the area found at wavelength 254 nm with the previously made calibration curve. Partition Coefficient Assay. Log D was also determined in-house via an HPLC method adapted from the strategy reported by Donovan and Pescatore.14a Two buffers were made at a concentration of 50 μM each: ammonium acetate at pH 7.4 and ammonium formate at pH 3.0. A set of compounds with known log D values between −0.36 and 5.68 were used to make a calibration curve at each pH by using a linear gradient between 0 and 100% acetonitrile, with buffer at the specific pH used as the second solvent. The curve was made by plotting the log D value against the retention time. Quinazolines were then injected into the HPLC and the retention time compared to the calibration curve previously determined. Bacterial Strains and Growth Conditions. The methicillin resistant S. aureus strain CBD-635 used in this study has previously been described and its genome sequenced.17 For murine models of infection we used MRSA strain USA300 FPR.18 In addition, a trimethoprim resistant strain of S. aureus (NRS106) was used to observe resistance to lead quinazoline-based compounds. This strain was acquired from the Network on Antimicrobial Resistance in Staphylococcus aureus Q



Article

(NARSA). Bacterial strains were grown in tryptic soy broth (TSB) at 37 °C, and when necessary, agar was added to a final concentration of 1.5% (w/v) for growth plates and 0.7% (w/v) for overlay media. Disk Diffusion Assay. These were performed as described previously.19 Briefly, bacterial strains were streaked onto plates and incubated overnight. A single colony was used to inoculate broth media and allowed to grow overnight. The overnight culture was diluted 1:1000 into 5 mL of molten overlay agar and mixed before being used to inoculate growth plates. After plates were allowed to dry, three sterile filter disks were added per plate and inoculated with 10 μL of test compound. The stock concentration for each test compound was 5 mg mL−1 suspended in DMSO. Bacterial plates were incubated for 24 h. Zones of inhibition were measured in millimeters, with the assay being performed in triplicate. Microtiter MIC and MBC Determination Assays. Both assays were performed as described in our previous publications.19 Briefly, minimum inhibitory concentrations (MIC) were determined for compounds which displayed antimicrobial activity against S. aureus CBD-635. Broth cultures were prepared as described above. These overnight cultures were diluted 1:1000 into fresh media, and 200 μL was transferred to a sterile 96-well plate. Relevant concentrations of test compounds were applied to each well and samples mixed by pipetting before incubation at 37 °C overnight. MICs were determined by visual inspection of the minimum concentration of drug that produced no bacterial growth (as determined by a lack of turbidity). The assay was performed in triplicate to verify the MIC. The minimum bactericidal concentrations (MBC) were determined from MIC samples by serially diluting and plating onto TSA. Plates were incubated overnight at 37 °C and the MBC determined by calculating CFU per mL for each of the concentrations of compound tested compared to the initial inoculum. The data is represented as the percent killing by comparison of drug containing samples to samples that contain no drug. Derivations of Spontaneous Mutation Frequencies. TSA was prepared containing 32, 50, 53, and 62 at a concentration of 2.5× the MIC. Overnight broth cultures of S. aureus CBD-635 were prepared as described above before 1 mL aliquots were extracted and harvested by centrifugation. The pellet was then resuspended in 100 μL of fresh TSB and used to inoculate the quinazoline containing media. Plates were incubated overnight at 37 °C. Assays were performed a total of 10 times using fresh overnight cultures. The CFU/mL of each overnight culture was determined by serial dilution and plating. The spontaneous mutation frequency for each quinazoline compound was determined by dividing the number of colonies obtained by the total bacterial inoculum. Sequence Analysis of QRDR and DHFR for Spontaneously Resistant Mutants. DNA was extracted from wild-type and spontaneously resistant CBD-635 mutants using a DNeasy kit (Qiagen), according to the manufactures protocol. The QRDR of gyrAB and grlAB was PCR amplified using primers described by us previously.15 The dfrA gene was PCR amplified using primers GCTCCAATAGCAGTGTAGTC/GGTCAACGTATGAAGCTCCTTC. Samples were then sent to MWG to undergo sequencing analysis. Investigating the Mechanism of Action of Quinazoline-Based Compounds. To evaluate the effect quinazolines have on DHFR reduction of dihydrofolic acid, a tetrahydrofolic acid assay was performed. An overnight culture of S. aureus CDB-635 was diluted 1:1000 into fresh TSB followed by the addition of compound 53 at 5× the MIC. This culture was then seeded into a sterile 96-well plate and exogenous tetrahydrofolic acid added at concentrations ranging from 0 to 224 μM. The cultures were then incubated at 37 °C for 18 h. The samples were visually inspected to determine if the addition of exogenous tetrahydrofolic acid rescued quinazoline mediated cell killing. This assay was repeated in triplicate in order to verify effects, with trimethoprim and vancomycin controls run in parallel. Trimethoprim is a known DHFR inhibitor, while vancomycin is a glycopeptide antibiotic that inhibits cell wall biosynthesis. Fractional Inhibitory Concentration Index of Quinazoline-Based Compounds in Combination with Sulfamethoxazole. To determine

if the lead quinazolines work synergistically with sulfamethoxazole, we used a checkerboard microtitration method to determine the fractional inhibitory concentration (FIC) and ΣFIC index of paired combinations of quinazoline and sulfamethoxazole. The ΣFIC index was then used to determine if synergy, antagonism, or indifference occurred as a result of interactions between antibacterial agents. Briefly, the MIC of sulfamethoxazole and quinazolines individually and combined were determined. From this we determined the FIC as follows. The FIC value was calculated from the MIC of sulfamethoxazole alone divided by the MIC of sulfamethoxazole in combination with lead agents. The FIC of lead quinazolines was determined from the MIC of each compound alone divided by the MIC of each compound in combination with sulfamethoxazole. The sum of these two values yields the ΣFIC index. This value is then used to determine whether synergism (ΣFIC ≤ 0.5), indifference (0.5 < ΣFIC ≤ 4), or antagonism (ΣFIC > 4) occurred between the two compounds. Evaluation of the Antimicrobial Efficacy and Toxicity Using a G. mellonella Model of Infection. To determine the in vivo efficacy of compounds, a G. mellonella model of S. aureus infection was used as previously described.20 Briefly, 1 mL aliquots of overnight cultures of S. aureus CBD-635 were pelleted by centrifugation and washed in sterile PBS before being resuspended in 100 μL of PBS. G. mellonella larvae (N = 10) that weighed 200−300 mg were then inoculated with 5 μL of S. aureus (1 × 109 CFU) into the last left proleg. Larvae were then treated with compounds at 1 h post-inoculation. Treatments were performed in the same manner as infection, except that injections were into the next left proleg moving toward the head of the larvae. Larvae were then incubated at 37 °C and mortality rates were monitored for 78 h; larvae were considered dead if they did not respond to physical stimuli. Data was analyzed for statistical significance using a log rank and χ square test with 1 degree of freedom. In Vivo Efficacy Testing Using a Murine Model of Lethal Peritonitis. Six mice per treatment were IP inoculated with a lethal dose of MRSA strain FPR (1 × 108 CFU/mL) in 5% mucin. After 1 h, we then injected mice with either 5× MIC or 10× MIC of vancomycin (positive controls), 125 μL of 2-(hydroxypropyl)-β-cyclodextrin (vehicle, negative control), 5 mg kg−1 compound 50 or 53, or 1 mg kg−1 compound 53 via tail vein. Upon inoculation, mice were monitored twice daily for 5 days. The clinical end point of this study was when infected animals reached a premoribund state. The criteria for determining this was if mice develop a hunched posture, rapid, shallow, and/or labored breathing, ruffled fur, lethargy, failure to respond to stimuli, soiled anogenital area, paralysis, paresis, head tilt, circling, vocalizations, nonpurposeful movements, and/or were unable to eat or drink. Any animal which displayed these signs was euthanized. We then compared the number of animals that reach a premoribund state between the control (vehicle or known antibiotic treated) and test groups. Data was analyzed for statistical significance using a log rank and χ squared test with 1 degree of freedom.

■

AUTHOR INFORMATION

Corresponding Authors

*For R.M.: phone, 813-974-7306; E-mail, [email protected]. *For L.N.S.: phone, 813-974-2087; E-mail, [email protected]. Author Contributions §

These authors contributed equally.

Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS USED CA-MRSA community-associated methicillin resistant S. aureus; HAI hospital-acquired infection; MIC minimum inhibitory concentration; MRSA methicillin resistant S. aureus; SAR structure−activity relationship; VRSA vancomycin resistant S. aureus R



■

Article

3-carboxyl-4(1H)-quinolones to deliver orally bioavailable antimalarials. J. Med. Chem. 2012, 55, 4205−4219. (15) Cormier, R.; Burda, W. N.; Harrington, L.; Edlinger, J.; Kodigepalli, K. M.; Thomas, J.; Kapolka, R.; Roma, G.; Anderson, B. E.; Turos, E.; Shaw, L. N. Studies on the antimicrobial properties of Nacylated ciprofloxacins. Bioorg. Med. Chem. Lett. 2012, 22 (20), 6513− 6520. (16) Ghose, A. K.; Crippen, G. M. Quantitative structure−activity relationship by distance geometry: quinazolines as dihydrofolate reductase inhibitors. J. Med. Chem. 1982, 25 (8), 892−899. (17) Carroll, W. A.; Agrios, K. A.; Altenbach, R. J.; Buckner, S. A.; Chen, Y.; Coghlan, M. J.; Daza, A. V.; Drizin, I.; Gopalakrishnan, M.; Henry, R. F.; Kort, M. E.; Kym, P. R.; Milicic, I.; Smith, J. C.; Tang, R.; Turner, S. C.; Whiteaker, K. L.; Zhang, H.; Sullivan, J. P. Synthesis and structure−activity relationships of a novel series of tricyclic dihydropyridine-based KATP openers that potently inhibit bladder contractions in vitro. J. Med. Chem. 2004, 47 (12), 3180−3192. (18) Diep, B. A.; Gill, S. R.; Chang, R. F.; Phan, T. H.; Chen, J. H.; Davidson, M. G.; Lin, F.; Lin, J.; Carleton, H. A.; Mongodin, E. F.; Sensabaugh, G. F.; Perdreau-Remington, F. Complete genome sequence of USA300, an epidemic clone of community-acquired meticillin-resistant Staphylococcus aureus. The Lancet 2006, 367 (9512), 731−739. (19) Burda, W. N.; Fields, K. B.; Gill, J. B.; Burt, R.; Shepherd, M.; Zhang, X. P.; Shaw, L. N. Neutral metallated and meso-substituted porphyrins as antimicrobial agents against Gram-positive pathogens. Eur. J. Clin. Microbiol. 2012, 31 (3), 327−335. (20) Bionda, N.; Fleeman, R. M.; Shaw, L. N.; Cudic, P. Effect of ester to amide or N-methylamide substitution on bacterial membrane depolarization and antibacterial activity of novel cyclic lipopeptides. ChemMedChem 2013, 8 (8), 1394−1402.

REFERENCES

(1) Kuehnert, M. J.; Kruszon-Moran, D.; Hill, H. A.; McQuillan, G.; McAllister, S. K.; Fosheim, G.; McDougal, L. K.; Chaitram, J.; Jensen, B.; Fridkin, S. K.; Killgore, G.; Tenover, F. C. Prevalence of Staphylococcus aureus nasal colonization in the United States, 2001− 2002. J. Infect. Dis. 2006, 193 (2), 172−179. (2) MRSA may kill more US citizens than HIV. BMJ (Br. Med. J.) 2007, 335 (7625), 850−850. (3) Stephens, J.; Davies, L. The war on superbugs. Scrip Mag. 2008, 2401, 44−47. (4) Hayden, M. K.; Rezai, K.; Hayes, R. A.; Lolans, K.; Quinn, J. P.; Weinstein, R. A. Development of daptomycin resistance in vivo in methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol. 2005, 43 (10), 5285−5287. (5) Public Health Dispatch: Vancomycin-Resistant Staphylococcus aureusPennsylvania. In Mortality Morbidity Wkly. Rep. 2002, 51, 902. (6) Lam, T.; Hilgers, M. T.; Cunningham, M. L.; Kwan, B. P.; Nelson, K. J.; Brown-Driver, V.; Ong, V.; Trzoss, M.; Hough, G.; Shaw, K. J.; Finn, J. Structure-based design of new dihydrofolate reductase antibacterial agents: 7-(benzimidazol-1-yl)-2,4-diaminoquinazolines. J. Med. Chem. 2014, 57 (3), 651−668. (7) Huband, M. D.; Cohen, M. A.; Zurack, M.; Hanna, D. L.; Skerlos, L. A.; Sulavik, M. C.; Gibson, G. W.; Gage, J. W.; Ellsworth, E.; Stier, M. A.; Gracheck, S. J. In vitro and in vivo activities of PD 0305970 and PD 0326448, new bacterial gyrase/topoisomerase inhibitors with potent antibacterial activities versus multidrug-resistant gram-positive and fastidious organism groups. Antimicrob. Agents Chemother. 2007, 51 (4), 1191−1201. (8) Rohini, R.; Muralidhar Reddy, P.; Shanker, K.; Hu, A.; Ravinder, V. Antimicrobial study of newly synthesized 6-substituted indolo[1,2c]quinazolines. Eur. J. Med. Chem. 2010, 45 (3), 1200−1205. (9) DeGraw, J. I.; Brown, V. H.; Colwell, W. T.; Morrison, N. E. Potential antileprotic agents. 3. Inhibition of mycobacterial dihydrofolic reductase by 2,4-diamino-5-methyl-6-alkylquinazolines. J. Med. Chem. 1974, 17 (7), 762−764. (10) Kung, P.; Casper, M. D.; Cook, K. L.; Wilson-Lingardo, L.; Risen, L. M.; Vickers, T. A.; Ranken, R.; Blyn, L. B.; Wyatt, J. R.; Cook, P. D.; Ecker, D. J. Structure−activity relationships of novel 2substituted quinazoline antibacterial agents. J. Med. Chem. 1999, 42 (22), 4705−4713. (11) Gottasová, R.; Kubíková, J.; Č ipák, L. Antibacterial effect of some 2,6-disubstituted 4-aniloquinazolines. Folia Microbiol. 1998, 43 (6), 679−682. (12) Van Horn, K. S.; Zhu, X.; Pandharkar, T.; Yang, S.; Vesely, B.; Kyle, D. E.; Wang, M. Z.; Werbovetz, K. A.; Manetsch, R., unpublished results. (13) (a) Feng, J.; Zhang, Z.; Wallace, M. B.; Stafford, J. A.; Kaldor, S. W.; Kassel, D. B.; Navre, M.; Shi, L.; Skene, R. J.; Asakawa, T.; Takeuchi, K.; Xu, R.; Webb, D. R.; Gwaltney, S. L., II. Discovery of alogliptin: a potent, selective, bioavailable, and efficacious inhibitor of dipeptidyl peptidase IV. J. Med. Chem. 2007, 50 (10), 2297−2300. (b) Ife, R. J.; Brown, T. H.; Blurton, P.; Keeling, D. J.; Leach, C. A.; Meeson, M. L.; Parsons, M. E.; Theobald, C. J. Reversible inhibitors of the gastric (H+/K+)-ATPase. 5. Substituted 2,4-diaminoquinazolines and thienopyrimidines. J. Med. Chem. 1995, 38 (14), 2763−2773. (c) Kanuma, K.; Omodera, K.; Nishiguchi, M.; Funakoshi, T.; Chaki, S.; Semple, G.; Tran, T.-A.; Kramer, B.; Hsu, D.; Casper, M.; Thomsen, B.; Sekiguchi, Y. Lead optimization of 4-(dimethylamino)quinazolines, potent and selective antagonists for the melaninconcentrating hormone receptor 1. Bioorg. Med. Chem. Lett. 2005, 15 (17), 3853−3856. (14) (a) Donovan, S. F.; Pescatore, M. C. Method for measuring the logarithm of the octanol−water partition coefficient by using short octadecyl-poly(vinyl alcohol) high-performance liquid chromatography columns. J. Chromatogr., A 2002, 952, 47−61. (b) Zhang, Y.; Clark, J. A.; Connelly, M. C.; Zhu, F.; Min, J.; Guiguemde, W. A.; Pradhan, A.; Iyer, L.; Furimsky, A.; Gow, J.; Parman, T.; El, M. F.; Phillips, M. A.; Kyle, D. E.; Mirsalis, J.; Guy, R. K. Lead optimization of S


Antibacterial Activity of a Series of - ACS Publications - American

Recommend Documents