Antisense RNA-based High-Throughput Screen System for Directed

Subscriber access provided by CMU Libraries - http://library.cmich.edu

Article

Antisense RNA-based High-Throughput Screen System for Directed Evolution of Quorum Quenching Enzymes Sang-Soo Han, Won-Ji Park, Hak-Sung Kim, and Geun-Joong Kim ACS Chem. Biol., Just Accepted Manuscript • DOI: 10.1021/acschembio.5b00714 • Publication Date (Web): 14 Sep 2015 Downloaded from http://pubs.acs.org on September 20, 2015

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Chemical Biology is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Chemical Biology

Antisense RNA-based High-Throughput Screen System for Directed Evolution of Quorum Quenching Enzymes

Sang-Soo Han1#, Won-Ji Park2,3#, Hak-Sung Kim1* and Geun-Joong Kim2*

1

Department of Biological Sciences, Korea Advanced Institute of Science and Technology, 373-1,

Gusung-dong, Yusung-gu, Daejon, 305-701, Korea, 2Department of Biological Sciences, College of Natural Sciences, Gwangju, Korea, 3Department of Molecular Medicine (BK21plus), Chonnam National University Graduate School, Chonnam National University, Gwangju 500-757, Korea,

#

These authors contributed equally

*Corresponding author H.S. Kim E-mail: [email protected]; Phone: 082-042-350-2602;

G.J. Kim E-mail: [email protected]; Phone: 082-062-530-3403

1

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT Quorum quenching (QQ) enzymes, which disrupt the quorum sensing signaling process, have attracted considerable attention as new antimicrobial agents. However, their low catalytic efficiency for quorum sensing molecules remains a challenge. Herein, we present an antisense RNA-based highthroughput screen system for directed evolution of a quorum quenching enzyme. The screening system was constructed by incorporating an antisense RNA (RyhB) into a synthetic module to quantitatively regulate the expression of a reporter gene fused with a sense RNA (sodB). To control the expression of a reporter gene in response to the catalytic activity of a quorum quenching enzyme, the region of interaction and mode between a pair of antisense (RyhB) and sense (sodB) RNAs was designed and optimized through the prediction of the secondary structure of the RNA pair. The screening system constructed was shown to lead to a significant reduction in the false-positive rate (average 42%) in the screening of N-acyl-homoserine lactonase (AiiA) with increased catalytic activity, resulting in a true-positive frequency of up to 76%. The utility and efficiency of the screening system were demonstrated by selecting an AiiA with 31-fold higher catalytic efficiency than the wildtype in three rounds of directed evolution. The present approach can be widely used for the screening of quorum quenching enzymes with the desired catalytic property, as well as for a synthetic network for a stringent regulation of the gene expression.

Keywords: Quorum quenching, acyl-homoserine lactone, antisense RNA, high-throughput screen

2


Page 2 of 25

Page 3 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTROUCTION Many bacteria communicate with each other through a process called quorum sensing (QS) to modulate the expression of specific genes in a cell-density dependent manner. Quorum sensing signaling regulates genes related to virulence, bioluminescence, biofilm formation, swarming, sporulation, plasmid transfer, toxin production, and stimulating factors 1. The signaling molecules (autoinducers) include acyl-homoserine lactone (AHL), 4,5-dihydroxy-2-cyclopenten-1-one (DHCP), 4-hydroxy-5- methyl-furan-3-one (HMF), and specific peptides. Of them, AHLs with different lengths and substituents at the acyl side chain are the most prevalent in different pathogens

1-4

. Diverse

pathogenic bacteria use quorum sensing to trigger virulence pathways, and induce drug-resistance in their communities by forming biofilms, causing serious problems to humans, animals, and crops 2. The growing emergence of multiple drug-resistant pathogens has drawn significant attention to the development of alternatives to conventional antimicrobial agents 3. Over the last decade, significant effort has been made to develop quorum quenching (QQ) enzymes that block the quorum sensing signaling as alternative antimicrobial agents for controlling and preventing bacterial virulence and pathogenesis, and some promising effects have been reported 5, 6

. The disruption of QS can interfere with the ability of the bacteria to form biofilms, thus rendering

the bacteria more sensitive to antibacterial agents and the immune response of the host cells. Many QQ enzymes have been identified in a diverse range of organisms 7-9, and they have been subjected to engineering in terms of catalytic properties 10-12. Despite the great potential of QQ enzymes, however, their practical applications have been limited by their low catalytic efficiency for quorum sensing molecules. For directed evolution of QQ enzymes, several screening systems based on LuxI and LuxR as natural QS regulators have been reported

10, 13

. The LuxCDABE operon, whose expression is

dependent on AHL, was used for directed evolution of lactonases from various microorganisms. We previously developed a genetic circuit system composed of β-lactamase and its inhibitor in conjunction with LuxI and LuxR for directed evolution of AHL-lactone hydrolase 12. However, such 3



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 25

screening systems based on natural quorum-sensing regulators have certain drawbacks. For example, the basal expression levels of reporter genes were relatively high, resulting in a narrow screening window and high false-positive rates (Table S1). In addition, the signal intensity exhibited a low correlation with the catalytic activity of QQ enzymes. Herein, we present an antisense RNA-based high-throughput screen system for directed evolution of QQ enzyme. The screening system was constructed by incorporating an antisense RNA (RyhB) into a synthetic module to regulate the expression of a reporter gene fused with a sense RNA (sodB) in a proportional manner (Figure 1). For stringent control of the reporter gene expression in response to the catalytic activity of QQ enzymes, we designed and optimized the region of interaction and mode between a pair of antisense (RyhB) and sense (sodB) RNAs through the prediction of the secondary structure of the RNA pair. The resulting screening system enabled the selection of host cells expressing quorum quenching enzymes with high catalytic efficiency for quorum sensing molecules based on the level of fluorescence intensity. Our approach relies on the regulation of antisense-RNA transcription and the regulation of the reporter gene expression at the translation level, thereby leading to a significant reduction in the false-positive rates (average 42%). The utility and efficiency of the screening system were demonstrated by generating an AHL-degrading enzyme with a 31-fold higher catalytic efficiency than the wild-type through a directed evolution.

RESULTS AND DISCUSSION Design and construction of an antisense-sense RNA pair Small noncoding RNAs (sRNAs) have been known to play central regulatory roles in prokaryotes and eukaryotes

14, 15

. One such sRNA is ryhB, which was first identified as a sRNA of approximately 90

nucleotides in length, regulating the gene expression by base-pairing within or near the translation initiation region (TIR) of mRNAs in the 5’-UTR region

16, 17

. Two possible mechanisms for the

translational regulation by ryhB have been proposed: pairing with the TIR of the target mRNA, which interferes with the binding of the 30S ribosomes, and blocks the initiation of the translation 4


18, 19

.

Page 5 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Alternatively, the pairing of ryhB with the target mRNA stimulates degradation through RNaseE 20. In this case, sRNA and mRNA are co-silenced in a one-to-one manner, and the target mRNA level reaches below the threshold of the sRNA level for the down-regulation. Accordingly, the expression level of the target genes reflects the difference in the two transcription rates 21. To design a synthetic expression module comprising a pair of antisense and sense RNAs, an intact region pairing with ryhB (sRNA) is also required. Moreover, ryhB is known to regulate the expression of several genes including sdhCDAB, acnA, fumA, bfr, and sodB. Of them, we chose the binding region (sense RNA) of sodB as a pairing partner with ryhB, when considering that sodB, a related gene for in-cell iron homeostasis, is well known in terms of the base-pairing site and regulatory mechanism. On the other hand, the overexpression of RyhB was reported to inhibit the growth of E. coli, causing unexpected interference with innate genetic network within the cells

22, 23

.

To minimize such interference, we chose E.coli XL1-BLUE strain with mutated relA gene which shows a relatively low growth inhibition under the expression condition of RyhB 23. Effect of RyhB on the growth of host cells was observed to be negligible (Figure S1). To validate the selected antisense and sense RNA pair for controlling the gene expression in a synthetic module, the ryhB and sodB sequences of the E. coli genome were obtained from the Genbank (accession number, NC_000913) and Ecocyc (accession number, G0-8872 for ryhB and EG10954 for sodB) databases. It was revealed that ryhB binds to the 5’-untranslated region (5’-UTR) of sodB 20, 21. Next, to construct a synthetic module comprising both antisense and sense RNAs, we analyzed the secondary structure of RNA between ryhB and 5’-UTR of sodB using the RNAfold program (http://rna.tbi.univie.ac.at/cgibin/RNAfold.cgi) for maintaining the antisense activity, and selected +1 to +96 of the ryhB gene as an antisense RNA. The resulting gene was artificially fused with a transcriptional terminator (Figure 1 and Table 1). The 5’-UTR of sodB, from −1 to +88 including the first 11 codons of SodB, was chosen as a sense RNA based on the binding region and secondary structure prediction. Selected ryhB and sodB sequences were confirmed to preserve the binding region (and also plausible secondary structure) based on previous studies (Table S2). 5



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

To confirm the function of the antisense RNA in the translational regulation of the target gene, the antisense RNA ryhB was expressed from the pBAD vector under the control of the PBad promoter using arabinose. On the other hand, the sense RNA sodB was fused with a reporter gene GFPuv and expressed from the pMAL vector under the control of the PLac promoter using IPTG. The separate expressions of the antisense and sense RNAs from each construct were independently regulated without any interference between them. The recombinant cells harboring both plasmids were grown after induction with various IPTG concentrations ranging from 0 to 1 mM, and arabinose ranging from 0 to 13.3 mM, at an optical density of 0.5 for 6 h, and the fluorescence intensities and expression levels of GFPuv were analyzed (Figure 2). Cultivation of the host cells without IPTG resulted in a negligible fluorescence because only the basal level of sodB:gfpuv was expressed regardless of the induction of the antisense RNA ryhB using arabinose. With the increasing IPTG concentration, a distinct fluorescence signal was observed from the host cells, and gradually decreased as the concentration of arabinose increased. As shown in Figures 2A and 2B, the regulation of the gene expression at the translation level occurred in a more proportional manner at the induction stage with 1 mM IPTG. Although the fluorescence intensity of the host cells fluctuated at the saturation level when induced with 0.1 mM of IPTG, a dose-dependent pattern of arabinose was reproducibly observed. These results indicate that the antisense and sense RNA pair, namely, ryhB and sodB, can be effectively used as a regulatory module for controlling the expression of a target (reporter) gene in a proportional manner.

Construction of antisense-sense RNA module for screening the quorum quenching activity Based on the expression module comprising the antisense and sense RNAs, we attempted a highthroughput screen system for the quorum quenching activity. To this end, we constructed the expression module, pASRR, including the luxR, reporter gene (mCherry) fused with sense RNA (sodB) and antisense RNA (RyhB) under the control of a constitutive expression promoters (PBEM and PL-O) and inducible expression promoter (PLuxI) (Figure 1). The constitutively expressed LuxR binds to the 6


Page 6 of 25

Page 7 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


AHL, and the resulting complex induces the transcription of antisense RNA (RyhB). The expressed antisense RNA hybridizes with the mRNA of sodB fused with mcherry through a base-pairing between the antisense and sense RNAs, consequently causing the interference with the mRNA translation. Therefore, the expression level of a reporter gene will be inversely proportional to the level of the AHL in the host cells. At a given concentration of AHL, the AHL level will be affected by the catalytic activity of the quorum quenching enzymes, and the fluorescence intensity of the host cells will be dependent on the catalytic activity of these enzymes for a quorum sensing molecule. In the presence of a QQ enzyme with low catalytic activity, the host cells emit low fluorescence signals. In contrast, in the presence of a QQ enzyme with a high catalytic activity, the transcription level of the antisense RNA remains low, leading to high fluorescence signals from the host cells. To validate the constructed expression module, we first investigated the dependency of the reporter gene expression at the level of quorum sensing molecules. N-hexanoyl-L-homoserine lactone (C6-AHL) was used as a quorum sensing molecule, and the fluorescence intensities of the host cells were measured with respect to the C6-AHL concentration. The host cells harboring pASRR plasmid were cultured at various AHL concentrations in a 96-well plate, and subjected to a fluorescence analysis during the cultivation at 37oC. As a result, the fluorescence intensity was shown to decrease with the increasing AHL concentration within a range of 1 nM to 1 µM (Figure 3A), confirming the regulation of the reporter gene expression through the antisense-sense RNA module. Fluorescent signals were observed during the initial culture period for 2 h, probably owing to the expression of related proteins in the seed culture period; however, a distinct difference in the fluorescence intensity was monitored after cultivation for 4 h. The fluorescence intensities of the colonies supplemented with 1 µM C6-AHL were similar to those of the colonies harboring the empty vector as the control without C6-AHL. This result implies that the expression of the reporter gene can be controlled by the substrate concentration, and the antisense-sense RNA-based system can be used for screening the quorum quenching activity. In addition, pControl, as a control without LuxR, also supports the idea

7



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 25

that the fluorescent signals arise from the binding of C6-AHL to LuxR in the expression module as expected (Figure 3B). We tested whether the constructed system can be used for the screening of quorum quenching enzymes with different catalytic activities. For this, we used the wild type AiiA and its variants, V69L and V69L/I190F, showing 3- and 7-fold higher catalytic efficiencies than the wild type, respectively. These variants were selected in our previous work through an in-vitro evolution

12

. The host cells

expressing the wild-type and its variants were grown in an LB medium with different C6-AHL concentrations, and the fluorescence intensities were measured. As a result, the fluorescence intensity of the host cells increased along with the catalytic activity of the quorum quenching enzymes (Figure 4A). To further check the dependence of the fluorescence intensity on the catalytic efficiency of enzyme, we replotted the fluorescence signal at 8 hr with respect to a fold increase in catalytic efficiency of enzyme. As a result, a linear correlation was observed between the fluorescence signal and the catalytic efficiency of enzyme (Figure S2). Next, we tested the performance of the screening system in terms of the true-positive rate. The host cells expressing the respective enzymes were grown on agar plates containing various C6-AHL concentrations ranging from 0.5 to 20 µM. We selected 20 colonies showing distinct red fluorescence signals compared to other colonies on each agar plate supplemented with a predetermined concentration of C6-AHL, and analyzed their genotypes through DNA sequencing. As shown in Figure 4B, the frequency of positive rates significantly increased with the concentration of C6-AHL. When the C6-AHL concentration was 20 µM, 50% of the selected colonies were identified to be a V69L/I190F mutant, whereas 15% of them were identified as the wild type (three of the 20 colonies selected). This result implies that the constructed system leads to a significant reduction in the false positive rates in the screening of quorum quenching enzymes (Table S1) with high catalytic activity toward a quorum sensing molecule.

Directed evolution of quorum quenching enzyme using the screening system

8


Page 9 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


To examine the utility of the constructed screening system, we attempted a directed evolution of AHL hydrolase, AiiA, to increase its catalytic efficiency for C6-AHL. The wild type enzyme was used as the starting template for directed evolution. E. coli host cells expressing the wild type emitted a negligible fluorescence at a C6-AHL concentration of higher than 200 µM, and this seems to be due to a high transcription level of antisense RNA inside the cells followed by blocking of the expression of the reporter gene. A pool of the first mutant library was generated by error-prone PCR and incubated on an agar plate containing 200 µM of C6-AHL for the screening of mutants with improved catalytic activity. A mutant library of about 4.1 x 105 was subjected to screening using red fluorescence, and about 200 positive colonies showing higher fluorescence intensity than the wildtype were selected. The selected colonies were transferred to a liquid medium in 96-well plates and grown. Lysates from the cultures were assayed for C6-AHL. All the plasmids from each of 17 colonies showing a relatively high fluorescence were re-transformed into the cells, and six colonies showing a higher catalytic activity than the wild type were isolated. The genes from the selected colonies were used for the next round of evolution by combining ep-PCR and DNA shuffling. The resulting library was subjected to screening at a C6-AHL concentration of 500 µM. Similarly, 14 colonies with increased activity were subjected to the next round in the presence of 750 µM of C6AHL. During directed evolution of AiiA using pASRR, the average mutation rate of up to 3.5% (around 25 mutations in 756 bp, 3~5 substitution in 251 amino acids) was maintained, and the false positive rates were estimated to be 65% (11/17), 36% (8/22), and 24% (6/25) at the first, second, and third round, respectively. The best mutants were isolated at each round of directed evolution, and their kinetic constants were determined (Table 2). The 2E15 mutant from the first round was shown to have four changes in amino acids (E43G, V69L, K89R, and I190F), exhibiting a kcat/KM of 9.6x104 M-1 s-1 for C6-AHL, which corresponds to a ten-fold increase compared to the wild-type. The 8H7 mutant from the second round possessed two additional mutations, I10L and N86I, and one back mutation, G43E. The 15F3 mutant selected from the third round contained one back mutation, I86N, on the 8H7 mutant, showing a 31-fold higher catalytic efficiency than the wild type enzyme. 9



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Synthetic networks connecting natural regulators based on a regulator protein and a promoter pair have been recently used to construct a screening and selection system as well as synthetic circuits 24-26

. Such networks have been applied to improve the catalytic activity of enzymes and produce

valuable chemicals. However, natural regulators have been shown to be difficult to construct for a precise ON-OFF system because a pair of regulator protein and promoter gives rise to a basal expression of a target gene. For example, the pBAD system based on an arabinose-inducible araCpBAD promoter was revealed to show an unexpected bimodal distribution owing to a variable metabolic burden, despite a stringent regulation of the gene expression 27, 28. In contrast, our approach relies on regulation of an antisense RNA transcription and regulation of the gene expression at the translational level, leading to a precise control of a target gene expression. The present approach will find wide applications in the construction of synthetic networks for the stringent regulation of gene expression.

CONCLUSION We have demonstrated that the screen system based on antisense / sense RNAs can be effectively used for the detection of quorum sensing molecules and enzymes showing quorum quenching activity, thereby effectively used for directed evolution of AHL-lactone hydrolase with an improved catalytic activity. Antisense RNA RyhB is a well-known small RNA, and its regulation mechanism and target sequence of mRNA have been revealed. RyhB regulates the gene expression at the translation level in a proportional manner, and the use of RyhB as a regulating tool offers certain advantages over regulation at the transcription level

29, 30

. The present screening system composed of LuxR and

antisense-sense RNAs was shown to efficiently regulate the expression of a reporter gene in response to the level of a quorum sensing molecule, C6-AHL. It is interesting to note that the present screening system led to a true-positive rate of up to 76% on the directed evolution of AHL-lactone hydrolase. Based on the results, the present screening system can be effectively used for the screening of quorum

10


Page 10 of 25

Page 11 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


quenching activity and the directed evolution of quorum quenching enzymes as well as for the construction of synthetic networks for the stringent regulation of gene expression.

METHODS Design of an antisense-sense RNA pair for the regulation of gene expression To stringently control the expression of a reporter gene using an RNA pair in a dual vector system, two expression modules with different replication origins, selection markers, and inducible promoters were constructed. Briefly, an arabinose-inducible pBAD/myc-HisA vector was constructed as a module for expressing an antisense RNA, ryhB. Using a PCR with a primer BAD (+1)R (Table 1), the BamHI site in the downstream region of the PBAD promoter was removed and relocated at the +1 site close to the promoter. A set of primers, ryhB F and ryhB R, was designed to generate a construct that fuses ryhB (from +1 to +96) with a transcriptional terminator, which is then used for the PCR. The resulting construct was cloned in the downstream region of the PBAD promoter through digestion with the BamHI and SalI sites. For stable maintenance in a dual vector system, the selection marker of pBAD/myc-HisA was replaced with chloramphenicol acetyltransferase (CAT). The CAT gene was amplified with CATF and CATR primers from pACYC184 and inserted into the vector described above by the SalI and AseI sites (pBAD/ryhB(Cam)). The replication origin, p15A, was also amplified by a PCR with p15AF and R primers from pACYC184, digested with the NdeI and NsiI sites, and then ligated with the AseI and NsiI sites of the vector, yielding a pBAD/ryhB(Cam/p15A) vector. To construct an IPTG-inducible sense RNA (sodB) fused with a reporter gene, a pMAL-c2x vector was used as a template. Primarily, the region from the Ptac promoter to the malE gene is replaced with Pl-O, which contains a lac operator between the -35 region and -10 region of PLlocO-1 31, by PCR with a set of primers (Pl-O F and R). The resulting construct provided an XbaI site at six bases upstream from the +1 site of the Pl-O promoter. In addition, crsodB, a control region on the 5’ UTR of sodB (from the −1 to +88 sites corresponding to the transcriptional start site of sodB, including the 11 codons of the N-terminal region) 24, was obtained using a PCR with crsodB F and crsodB R primers 11



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 25

from the genomic DNA of Escherichia coli K12. An amplified crsodB was then inserted into the downstream of P1-o by the XbaI and HindIII sites (pMAL/sodB). Finally, each one of reporter genes, GFPuv and mCherry, was subcloned into the EcoRI and HindIII sites of the vector described above. The resulting vectors expressed the sense RNA (sodB) fused with a reporter gene depending on the IPTG induction and the amount of antisense RNA (RyhB) from pBAD/ryhB (Cam/p15A).

Construction of antisense and sense RNAs- based screening system The lux promoter and luxR gene were acquired through a PCR from pQS

12

, and were ligated into

pBAD/ryhB(Cam) as follows. The promoter of luxI containing six additional bases upstream from +1 was amplified through the PCR using a set of primers (Table 1) from pQS. The resulting PluxI was ligated with the pBAD/ryhB(Cam) vector digested with NsiI/ BamHI, leading to a replacement of the araC gene with a lux promoter in the vector. In this step, the primer PluxIF was designed to possess the NheI site upstream of NsiI, which was used to ligate with Pl-O:sodB:mcherry (sense RNA and reporter fusion construct). In addition, Pl-O:sodB:mcherry with a transcriptional terminator was amplified from pMAL/sodB through the PCR with a set of primers and subcloned into NheI and NsiI sites, yielding a vector pControl in which sodB:mcherry was constitutively expressed owing to a lack of the lacI gene in the vector. In this step, the reverse primer terminator, R, was designed to contain a SpeI site, which was used to ligate with PBEM-RBS:LuxR. Finally, to introduce the gene encoding LuxR in response to AHL into pControl, the upstream region of luxR in pQS was replaced with PBEM-RBS through a PCR using a set of primers (Table 1). The PBEM-RBS was a constitutive promoter derived from metagenomic DNA 32. The resulting construct was digested with two restriction enzymes, NsiI and SpeI, to obtain a DNA fragment containing PBEM-RBS:LuxR. This fragment was subcloned into the same sites of pControl, yielding a vector, pASRR (GenBank No. KM350158).

Enzyme library construction and screening

12


Page 13 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The wild-type AHL lactonase (AiiA) was used as a template for the construction of a mutant library through an error-prone (EP) PCR. The EP-PCR mixture consisted of a dNTP mixture (0.2 mM ATP, 0.2 mM GTP, 1 mM CTP, and 1 mM TTP), a reaction buffer (7 mM MgCl2, 0.1 mM MnCl2, 50 mM KCl, and 10 mM Tris, pH 8.0), a set of primers (AiiA F and R), Taq polymerase (0.5 U/mL), and template DNA (0.2ng/µl) in a final volume of 50 µl. The reaction was conducted through denaturation at 95 oC for 60 s, followed by 25 cycles of denaturation at 95 oC for 30 s, annealing at 45 oC for 30 s, extension at 72 oC for 45 s, and the final incubation at 72 oC for 150 s. The resulting PCR product was purified using Wizard SV gel and a PCR clean up system (Promega, USA). For in-vitro shuffling, the purified genes were digested with a 0.005 unit of DNase1 (NEB). DNA fragments from 50 to 250 bp were recovered from agarose gel and assembled using a PCR in the absence of primers. The assembled DNA products were amplified using Ex Taq DNA polymerase (Takara) under general reaction conditions and cloned into a pZS*24DN plasmid using the restriction enzyme recognition sites, NcoI and XbaI. The resulting recombinant plasmids were transformed into E. coli XL1-BLUE harboring pASRR plasmid. The recombinant E. coli XL1-BLUE cells were grown in LB plates containing 50 ppm ampicillin, 30 ppm kanamycin, 0.2 mM ZnSO4, and 200 to 750 µM C6-AHL (Cayman, USA). After growing at 37oC overnight, colonies emitting a red fluorescence were primarily screened by a fluorescent plate reader (LAS-3000, Fuji Film), and then re-inoculated in 96-deep-well plates containing the same media (500 µl). The cultured cells were disrupted with a cell lytic B buffer (sigma), and the supernatants were used for measuring the activity of AiiA mutants toward the hydrolysis of C6-AHL using a microplate reader (Infinite M200, Tecan) at 557 nm. The 200 µl reaction mixture contained 90 µl of deionized water, 100 µl of a 2X dye solution (2 mM HEPES, pH 7.5), 200 mM Na2SO4, 0.4 mM ZnSO4, Phenol red, 10 µl of lysate, and 0.5 mM C6-AHL (dissolved in DMSO). Plasmids from the screened clones in each round were extracted, sequenced, and used as templates for the subsequent rounds of in-vitro mutagenesis.

13



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Determination of kinetic parameters To determine the kinetic parameters, the genes encoding the mutant enzymes were subcloned into the vector pMAL-c2x and expressed in MBP-fusion form for purification. To do so, a set of specific primers, mAiiA F and AiiA R, containing restriction sites EcoRI and XbaI, respectively, were used in the PCR reaction under typical conditions. The resulting products were digested and ligated with pMAL-c2x plasmids, followed by transformation into E. coli XL1-BLUE. The transformed cells were grown at 37 oC in an LB medium containing ampicillin (50 ppm), ZnSO4 (0.2 mM), and glucose (0.2%, w/v). When the optical density (600 nm) reached 0.4, isopropyl-β-D-1-thiogalactopyranoside (IPTG) (0.3 mM) was added, followed by further incubation at 30oC for 6 hr. The MBP-fused proteins were purified using the amylose resin (NEB), as described in a previous work 12. The enzyme activity was determined by measuring the decrease in absorbance at 557 nm, as reported previously 12. The kinetic parameters were calculated from triplicate experiments using a double reciprocal plot and Michaelis-Menten kinetics of the substrate concentration and the initial reaction rate of the enzyme.

ACKNOWLEDGEMENTS This research was supported by the National Research Foundation of Korea (NRF) grant (2014R1A2A1A01004198), Bio & Medical Technology Development Program of the National Research Foundation (NRF) grant (2013M3A9D6076530), and the Intelligent Synthetic Biology Center (2011-0031950) funded by the Korea government (MEST) and Ministry of Science, ICT, and Future Planning.

14


Page 14 of 25

Page 15 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


REFERENCES 1.

Miller, M. B., and Bassler, B. L. (2001) Quorum sensing in bacteria, Annu Rev Microbiol 55, 165-199.

2.

Nadell, C. D., Xavier, J. B., Levin, S. A., and Foster, K. R. (2008) The evolution of quorum sensing in bacterial biofilms, Plos Biol 6, 171-179.

3.

LaSarre, B., and Federle, M. J. (2013) Exploiting Quorum Sensing To Confuse Bacterial Pathogens, Microbiol Mol Biol R 77, 73-111.

4.

de Kievit, T. R. (2009) Quorum sensing in Pseudomonas aeruginosa biofilms, Environ. Microbiol 11, 279-288.

5.

Van Gennip, M., Christensen, L. D., Alhede, M., Phipps, R., Jensen, P. O., Christophersen, L., Pamp, S. J., Moser, C., Mikkelsen, P. J., Koh, A. Y., Tolker-Nielsen, T., Pier, G. B., Hoiby, N., Givskov, M., and Bjarnsholt, T. (2009) Inactivation of the rhlA gene in Pseudomonas aeruginosa

prevents

rhamnolipid

production,

disabling

the

protection

against

polymorphonuclear leukocytes, APMIS 117, 537-546. 6.

Skindersoe, M. E., Alhede, M., Phipps, R., Yang, L., Jensen, P. O., Rasmussen, T. B., Bjarnsholt, T., Tolker-Nielsen, T., Hoiby, N., and Givskov, M. (2008) Effects of antibiotics on quorum sensing in Pseudomonas aeruginosa, Antimicrob. Agents. Chemother 52, 3648-3663.

7.

Dong, Y. H., Wang, L. Y., and Zhang, L. H. (2007) Quorum-quenching microbial infections: mechanisms and implications, Philos. Trans. R. Soc. Lond. B. Biol. Sci. 362, 1201-1211.

8.

Clatworthy, A. E., Pierson, E., and Hung, D. T. (2007) Targeting virulence: a new paradigm for antimicrobial therapy, Nat. Chem. Biol. 3, 541-548.

9.

Cegelski, L., Marshall, G. R., Eldridge, G. R., and Hultgren, S. J. (2008) The biology and future prospects of antivirulence therapies, Nat. Rev. Microbiol.6, 17-27.

10.

Chow, J. Y., Wu, L., and Yew, W. S. (2009) Directed evolution of a quorum-quenching lactonase from Mycobacterium avium subsp. paratuberculosis K-10 in the amidohydrolase superfamily, Biochemistry 48, 4344-4353.

11.

Aharoni, A., Amitai, G., Bernath, K., Magdassi, S., and Tawfik, D. S. (2005) High-throughput screening of enzyme libraries: thiolactonases evolved by fluorescence-activated sorting of single cells in emulsion compartments, Chem. Biol.12, 1281-1289.

12.

Kim, J. H., Lee, S. C., Kyeong, H. H., and Kim, H. S. (2010) A genetic circuit system based on quorum sensing signaling for directed evolution of quorum-quenching enzymes, Chembiochem 11, 1748-1753.

15



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

13.

Chow, J. Y., Xue, B., Lee, K. H., Tung, A., Wu, L., Robinson, R. C., and Yew, W. S. (2010) Directed evolution of a thermostable quorum-quenching lactonase from the amidohydrolase superfamily, J. Biol. Chem. 285, 40911-40920.

14.

Masse, E., and Gottesman, S. (2002) A small RNA regulates the expression of genes involved in iron metabolism in Escherichia coli, P Natl Acad Sci USA 99, 4620-4625.

15.

Mattick, J. S., and Makunin, I. V. (2005) Small regulatory RNAs in mammals, Hum. Mol. Gen., Hum. mol., R121-132.

16.

Wassarman, K. M., Repoila, F., Rosenow, C., Storz, G., and Gottesman, S. (2001) Identification of novel small RNAs using comparative genomics and microarrays, Gene Dev 15, 1637-1651.

17.

Argaman, L., Hershberg, R., Vogel, J., Bejerano, G., Wagner, E. G. H., Margalit, H., and Altuvia, S. (2001) Novel small RNA-encoding genes in the intergenic regions of Escherichia coli, Curr Biol 11, 941-950.

18.

Masse, E., Vanderpool, C. K., and Gottesman, S. (2005) Effect of RyhB small RNA on global iron use in Escherichia coli, J Bacteriol 187, 6962-6971.

19.

Desnoyers, G., Morissette, A., Prevost, K., and Masse, E. (2009) Small RNA-induced differential degradation of the polycistronic mRNA iscRSUA, Embo J 28, 1551-1561.

20.

Prevost, K., Desnoyers, G., Jacques, J. F., Lavoie, F., and Masse, E. (2011) Small RNAinduced mRNA degradation achieved through both translation block and activated cleavage, Gene Dev 25, 385-396.

21.

Levine, E., Zhang, Z., Kuhlman, T., and Hwa, T. (2007) Quantitative characteristics of gene regulation by small RNA, Plos Biol 5, e229.

22.

Zhang, A., Wassarman, K. M., Rosenow, C., Tjaden, B. C., Storz, G., and Gottesman, S. (2003) Global analysis of small RNA and mRNA targets of Hfq, Mol. Microbiol. 50, 1111-1124.

23.

Argaman, L., Elgrably-Weiss, M., Hershko, T., Vogel, J., and Altuvia, S. (2012) RelA protein stimulates the activity of RyhB small RNA by acting on RNA-binding protein Hfq, P Natl Acad Sci USA 109, 4621-4626.

24.

Wang, H. H., Isaacs, F. J., Carr, P. A., Sun, Z. Z., Xu, G., Forest, C. R., and Church, G. M. (2009) Programming cells by multiplex genome engineering and accelerated evolution, Nature 460, 894-898.

25.

Lee, S. K., Chou, H., Ham, T. S., Lee, T. S., and Keasling, J. D. (2008) Metabolic engineering of microorganisms for biofuels production: from bugs to synthetic biology to fuels, Curr. Opin. Biotechnol. 19, 556-563.

16


Page 16 of 25

Page 17 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


26.

Jeong, Y. S., Choi, S. L., Kyeong, H. H., Kim, J. H., Kim, E. J., Pan, J. G., Rha, E., Song, J. J., Lee, S. G., and Kim, H. S. (2012) High-throughput screening system based on phenolicsresponsive transcription activator for directed evolution of organophosphate-degrading enzymes, PEDS 25, 725-731.

27.

Schaerli, Y., and Isalan, M. (2013) Building synthetic gene circuits from combinatorial libraries: screening and selection strategies, Mol. Biosyst. 9, 1559-1567.

28.

Tan, C., Marguet, P., and You, L. (2009) Emergent bistability by a growth-modulating positive feedback circuit, Nat. Chem. Biol. 5, 842-848.

29.

Kang, Z., Wang, X., Li, Y., Wang, Q., and Qi, Q. (2012) Small RNA RyhB as a potential tool used for metabolic engineering in Escherichia coli, Biotechnol. Lett. 34, 527-531.

30.

Li, F., Wang, Y., Gong, K., Wang, Q., Liang, Q., and Qi, Q. (2014) Constitutive expression of RyhB regulates the heme biosynthesis pathway and increases the 5-aminolevulinic acid accumulation in Escherichia coli, FEMS Microbiol. Lett. 350, 209-215.

31.

Lutz, R., and Bujard, H. (1997) Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements, Nucleic Acids Res. 25, 1203-1210.

32.

Han, S. S., Lee, J. Y., Kim, W. H., Shin, H. J., and Kim, G. J. (2008) Screening of promoters from metagenomic DNA and their use for the construction of expression vectors, J. Microbiol. Biotechnol. 18, 1634-1640.

17



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

FIGURE LEGENDS

Figure 1. Schematic of the screening system composed of antisense and sense RNAs and LuxR. (a) Chemical structure of C6-AHL. (b) AHL binds to LuxR, inducing the expression of antisense RNA, and consequently, the expression of a reporter gene is suppressed. Therefore, fluorescent signals from the host cells are dependent on the level of AHL or AHL-lactone hydrolase.

Figure 2. Regulation of a reporter gene expression by antisense/sense RNA module. (a) Expression of the reporter gene was assayed by measuring the relative fluorescence unit (RFU) at 390 nm excitation and 500 nm emission (GFPuv) after cultivation for 7 h at different concentrations of arabinose and IPTG which were added to induce the expression of ryhB and sodB-fused reporter genes, respectively. (b) SDS-PAGE analysis of a reporter gene expression. E. coli cells harboring dual vectors were grown in an LB medium supplemented with different concentrations of IPTG and arabinose.

Figure 3. Expression of a reporter gene in response to the level of quorum sensing molecule C-6 AHL. (a) Fluorescence intensities of the host cells harboring a synthetic expression module after incubation with different C6-AHL concentrations. Fluorescence intensities from the host cells were measured at excitation and emission wavelengths of 587 nm and 620 nm, respectively. (b) Fluorescence intensities of the host cells without LuxR (pControl). The experiments were carried out in triplicate.

Figure 4. Performance of the screening system. (a) Fluorescence intensities of the host cells expressing quorum quenching enzymes with different catalytic efficiencies at 20 µM C6-AHL. (b) Relative portions of the host cells expressing the wild-type and its variants with respect to the C6AHL concentration. Twenty colonies showing high red fluorescence signals were selected from each agar plate supplemented with a predetermined concentration of C6-AHL, and the distribution of each genotype was determined through DNA sequencing. The experiments were carried out in triplicate.

18


Page 18 of 25

Page 19 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1. Primer sequences used in this study

Primer BAD F BAD(+1) R ryhB F ryhB R CAT F CAT R P15A F P15A R Pl-o F Pl-o R crsodB F crsodB R PluxI F PluxI R Pl-O:sodB:mcherry F

Sequence (5’ – 3’) GGCGATATCAAAATTGCTGTCTGCCAGGTGA CTGGTCGACGAAGAAGGATCCGAGAAACAGTAGA GAGTTGCGA ATAGGATCCGCGATCAGGAAGACCCTCGCGGAGAA TTCGTCGACGGCGGCGGATTT ATAGTCGACGAATAAATACCTGTGACGGAAGATCA CTT ATAATTAATTATTAACGAAGCGCTAACCGTTTTT GGCCATATGATCAGTGCCAACATAGTAAGCCCA GGCATGCATGAGAATTACAACTTATATCGTAT GCGGATATCTCGGTAGTGGGATACGACGATACCGA CGCTCTAGATGTGCTCAGTATCTTGTTATCCGCTCA CAATGTCAACAGCTCATTTCAGAATATTTGCCAG GCCTCTAGAATACGCACAATAAGGCTATTGTA CTTAAGCTTAAGGGCGAATTCAGCATATGGTAGTGC A ATAATGCATCCGCGCGCTAGCCCCCGAAAAGTGCC ACCTGACGT CTTGGATCCCGACTATAACAAACCATTTTCTTGCGT AAACC ATACGTAGCGCGCCGACATCATAACGG

terminator R

CAAATGCATAAGCATACTAGTGGGTTATTGTCTCAT GAGCGGATAC

PBEM:RBS F

CGACTCGAGATGCATTTCATATCCCTTCGACCAGAA CACT

pBEM:RBS R

CGCGGTACCGGTCAACCTCAATTTGTAGTGATCAGT AATTACCATGGGAACAGTAAAGAAACTTTATTTCAT AiiA F C AiiA R AATTATCTAGATTATATATATTCCGGGAACACTCTAC mAiiA F AATATGAATTCATGGGAACAGTAAAGAAACTTTAT Restriction enzyme sites are underlined.

19


Restriction enzyme site EcoRⅤ SalⅠ and BamHⅠ BamHⅠ SalⅠ SalⅠ AseⅠ NdeⅠ NsiⅠ EcoRⅤ XbaⅠ XbaⅠ HindⅢ and EcoRⅠ NsiⅠand NheⅠ BamHⅠ NheⅠ NsiⅠand SpeⅠ XhoⅠ and NsiⅠ KpnⅠ NcoⅠ XbaⅠ EcoRⅠ


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 25

Table 2. Kinetic parameters of the wild-type and evolved mutants for C6-AHL kcat

KM

kcat/KM

Fold

s-1

mM

M-1 s-1

Increase

-

85±17

8.1±1.4

1x104

1

2E15b

E43G/V69L/K89RI190F

55±5.3

0.5±0.1

9.6x104

10

8H7b

I10L/V69L/N86I/K89R/I190F

68.2±5.7

0.4±0.2

1.5x105

15

15F3b

I10L/V69L/K89R/I190F

78.7±9.6

0.2±0.1

3.1x105

31

Clone

Mutations

wt a

a

Kinetic parameters for wild type AiiA were from a previous work12

b

Values represent the average and standard deviation in the triplicate experiments.

20


Page 21 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1

21



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 2

22


Page 22 of 25

Page 23 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3

23



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 4

24


Page 24 of 25

Page 25 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TABLE OF CONTENTS (TOC) GRAPHIC 232x103mm (300 x 300 DPI)


Antisense RNA-based High-Throughput Screen System for Directed

Recommend Documents