Chem. Res. Toxicol. 1991,4, 277-281
277
Mapping of (f)-antl-Benzo[ a Ipyrene Diol Epoxide Adducts to Human c-Ha-rasl Protooncogene Karen A. Dittrichf and Thomas R. Krugh* Department of Chemistry, University of Rochester, Rochester, New York 14627-0216 Received October 5, 1990 T h e relative reactivity of the chemical carcinogen (*)-7P,8a-dihydroxy-9a,lOa-epoxy7,8,9,10-tetrahydrobenzo[a]pyrene [ (&)-anti-BPDE] to the guanine bases of the first two coding exons of the human c-Ha-rasl protooncogene is determined to test if (*)-anti-BPDE reactivity is correlated with mutations reported for human c-Ha-rasl protooncogene activation. Plasmid DNA containing the sequence for the human c-Ha-rasl gene is modified with (&)-anti-BPDE to provide approximately 1covalent adduct per 250 bp. High-resolution mapping of the covalent adducts is achieved by laser-induced photolysis of 32P-labeled restriction fragments of the BPDE-modified plasmid DNA. The (*)-anti-BPDE binding profiles to exons 1 and 2 of the human c-Ha-rasl protooncogene show enhanced reactivity to guanine-rich regions. The guanine bases of oncogene-activating codons 12 (GGC) and 13 (GGT) are 5 times more reactive than the least reactive guanine analyzed within this region of the gene. The guanine base of oncogene-activating codon 61 (CAG) exhibits intermediate reactivity relative to the guanines analyzed within this region of the gene. Although preferential chemical reactivity plays a role in the activation of the c-Ha-rasl protooncogene, the in vivo activation of the c-Ha-rasl protooncogene by (&)-anti-BPDEis a complex process, with other important factors involved in the chemically induced activation.
Introduction Activation of an oncogene can cause a normal cell to undergo transformation to a malignant one by a variety of mechanisms (1). Activation of the ras family of oncogenes is associated with point mutations in the DNA sequence at or near codon 12, 13, or 61, resulting in the production of an altered 21p ras protein product (2). Chemical modification of a DNA base within a critical region of a ras oncogene can lead to base mutation and is believed to be a primary event in the transformation of a normal cell to a malignant one (3). Activation of the Ha-rasl gene by the polyaromatic hydrocarbon benzo[alpyrene, and its active metabolite (*)-7&8a-dihydroxy-9a,10a-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene [ (&)-anti-BPDE],l has been extensively documented (4-10). Studies by Marshall et al. (11) and Vousden et al. (12) show a direct correlation between the chemical modification of c-Ha-rasl DNA with (*)-anti-BPDE, in vitro, and activation of this gene leading to a transformed phenotype in vitro. In recent papers Marien et al. (13) and Reardon et al. (14) have used primer extension assays to identify BPDE binding sites in exon 1 of the human c-Ha-rasl gene (13) and in exons 1and 2 of the rat c-Ha-rasl gene (14). In this paper we use the photochemical mapping technique developed by Hogan and co-workers (15, 16) [and see the preceding paper (1 7)] to locate the binding sites and relative reactivity of (*)-anti-BPDE to the guanine bases within the regions of codons 12 and 61 of the human cHa-rasl gene to determine if there is a correlation between preferential chemical reactivity and t h e mutations associated with activation of the oncogene. The general conclusions of the photochemical mapping experiments reported in this paper are consistent with the primer extension assays of Marien et al. (13) and Reardon et al. (14).
Experimental Procedures Plasmid pbcNl containing the human c-Ha-rasl gene, described in ref 18, was obtained from American Type Tissue Culture Collection (Rockville, MD). (f)-7@,8a-Dihydroxy-9a,lOa-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene [(*)-anti-BPDE] was obtained from the NCI Reference Standard Repository (Bethesda, MD). Restriction and DNA-modifying enzymes were obtained from LKB-Pharmacia (Piscataway, NJ). Singly 32P-labeled restriction fragments containing the first and second exons of cHa-rasl were prepared by XbaI digestion, followed by 32P-labeling (5’ or 39, followed by restriction with SmaI. Two singly endlabeled fragments are generated: a 258 bp fragment containing the first exon which includes codons 12 and 13 and a 343 bp fragment containing the second exon which includes codon 61. These 32P-labeledfragments were separated by low-melt agarose (FMC Corp., Rockland, ME) gel electrophoresis and purified on Elutip-d columns (Schleicher & Schuell, Keene, NH). 5’-32PLabeling of the XbaI site of pbcNl produces labeling of the anticoding strand of exon 1 and the coding strand of exon 2; 3’-32P-labelingof the XbaI site produces labeling of the coding strand of exon 1 and the anticoding strand of exon 2. The 32Plabeled fragments were modified with (i)-anti-BPDE in the presence of carrier DNA as described in the preceding paper (17). BPDE-modified samples were irradiated with 355-nm laser light to induce DNA strand breaks at the site of BPDE covalent attachment as previously described (15, 16). Irradiated DNA samples were denatured and run on 6% polyacrylamide/7 M urea gels along with the Maxam-Gilbert sequencing reactions for these fragments; the gels were dried and exposed to Kodak XAR-5 film, without intensifying screens, for 1-3 days. Autoradiograms were scanned with an LKB 2222-010 Ultroscan XL laser densitometer.
Results and Discussion The binding of the (A)-anti-BPDE t o the coding strand of exon 1and to the coding and anticoding strands of exon 2 of the c-Ha-rasl gene is shown in Figures 1 and 2, respectively. The bands in the gel represent sites where breaks occur in the fragment as a result of photochemical strand cleavage [e.g., see the preceding paper (17) or Boles
* Author to whom correspondence should be addressed.
t Present
address: The Center for Biotechnology, Baylor College
of Medicine, 4000 Research Forest Dr., The Woodlands, TX 77380.
Abbreviations: (i=)-anti-BPDE,(f)-7~,8a-dihydroxy-9a,lOa-epoxy7,8,9,10-tetrahydrobenzo[a]pyrene; bp, base pair(s).
0 1991 American Chemical Society
Dittrich and Krugh
278 Chem. Res. Toxicol., Vol. 4, No. 3, 1991 1 2 3 4 5 6 7
codon9 GTG
v
1 2 3 4 5 6 7
*h' *L.
codon10 GGC codon 11 GCC
codon 12 GGC+ codon13 GGT codon14 GTG -.* *
codon15 GGC Figure 1. Gel analysis of the 258 bp XbaI/SmaI restriction fragment containing exon 1. Lane 1, unmodified irradiated fragment of the coding stran4 lane 2, BPDE-modified irradiated fragment of the coding strand; lane 3, Maxam-Gilbert G for the coding strand; lane 4,Maxam-Gilbert GA for the coding strand; lane 5, Maxam-Gilbert C for the coding strand; lane 6, BPDEmodified irradiated fragment of the anticoding strand; lane 7, unmodified irradiated fragment of the anticoding strand.
et al. (16) for details]. The banding patterns produced by BPDEmediated photolysis of these restriction fragments of the c-Ha-rasl gene reflect preferential binding to guanine residues, which is consistent with the pattern of (&)-anti-BPDE binding observed with other DNAs (15, 16,19-23). Bar charts showing peak heights of the guanine residues of the coding strands of exon 1 and exon 2 are presented in Figures 3 and 4, respectively. These charts were constructed from laser densitometer scans of the BPDE-mediated photolysis patterns in each gel, where peak height is taken as a measure of the extent of reaction of (*)-anti-BPDE. The locations of the first bases of the oncogene-activating codons 12,13, and 61 are designated with arrows. The sequence surrounding codon 12 is very guanine-rich. Twelve out of nineteen bases on the coding strand from nucleotides 1690-1708 are guanines (numbering system of human c-Ha-rasl in GenBank). Five of the nineteen bases on the coding strand are cytosine, and thus seventeen of the nineteen base pairs in this region of the gene are G-C base pairs. As shown in Figure 3, the reactivities of guanines in this guanine-rich region of exon 1are higher than the reactivities of isolated guanines. The guanine residues of codons 12 (GGC) and 13 (GGT) exhibit the highest reactivity measured for this region of exon 1 (also see lane 2 in Figure 1). These bases are as much as 5 times more reactive than isolated guanines such as nucleotides 1678 and 1711. The anticoding strand of exon 1 also shows enhanced reactivity of (*)-anti-BPDE within guanine-rich regions (see ref 231, including the region around codon 12. Guanines of codon 61 (CAG) (see lane 6 in Figures 2 and 4) and anticodon 61 (CTG) (lane 2 in Figure 2) exhibit an intermediate reactivity relative to the guanine bases analyzed within this region of the gene. These guanines each
TAC
codon 64
GAG
codon63
GAG
codon 62
cCAG
codon 61
GGC
codon60
GCC
codon59
ACC
codon58
Figure 2. Gel analysis of the 343 bp XbaI/SmaI restriction fragment containing exon 2. Lane 1, unmodified irradiated fragment of the anticoding strand; lane 2, BPDE-modified irradiated fragment of the anticoding strand; lane 3,Maxam-Gilbert G anticoding strand; lane 4, Maxam-Gilbert GA, anticoding strand; lane 5, Maxam-Gilbert C, anticoding strand (cleavage a t C 2113 is suppressed); lane 6, BPDEmodified irradiated fragment of the coding strand; lane 7, unmodified irradiated fragment of the coding strand. The single bands in lanes 1and 7 arise from incomplete separation of the 343 bp XbaIISmaI restriction fragment from the 258 bp XbaI/SmuI restriction fragment during agarose gel electrophoresis. Although the 258 bp bands appear very clearly in lanes 1 and 7, the 258 bp band "impurity" is estimated to be less than 2% of the 343 bp fragment. This slight impurity makes a negligible contribution to the intensities (less than background) of the bands in lanes 2-6 in the region of codons
58-61.
have 5' guanine neighbors showing nearly the same degree of reactivity. As described in the preceding paper and by others (14, 16, 19-22, 24-28), guanines with adjacent guanine neighbors exhibit higher reactivities than isolated guanines. There was little reactivity of (*)-anti-BPDE for either the adenine base of codon 61 or the thymine base of anticodon 61 as evidenced by the lack of bands on the gel in the BPDE-mediated photolysis reactions. BPDE photochemical strand cleavage shows an enhanced reactivity of (*)-anti-BPDE to the guanine bases of codon 12 (GGC).and codon 13 (GGT); these bases are among the most reactive guanines in these experiments and are as much as 5 times more reactive than the ieast reactive guanine in this region of the c-Ha-rasl gene. The most reactive guanine bases of the coding and anticoding strands of exon 1and exon 2 are found, as expected, within guanine-rich sequences. The enhanced reactivity of (*)-anti-BPDE to the guanine-rich region containing co-
(&)-anti-BPDE Adducts to c-Ha-raslProtooncogene
h
j 0.3 4
codon 12
Chem. Res. Toxicol., Vol. 4,No.3, 1991 279
codon 13
0.2 0.1
0 G A A T A T A A C G C T G G T G G T G G T G G C C C C C G ( j C G C i r ( i T G A T
nucleotides #1670-1770 Figure 3. Bar graph representation of the base-line-corrected peak heights obtained from laser densitometer analysis of the BPDE-mediated photolysis for the coding strand of exon 1. The first bases of codons 12 and 13 are indicated with arrows. Only the peak heights of the guanine nucleotides are shown.
h
0.2
0.1
0 AGGATTCCTACCOGAAGCAGGTGGTCATTGATGGGGAGACGTOCCTGTTOGACATCCTOGATACCOCCOGCCAOOAGO
nucleotides 2040-2117 Figure 4. Bar graph representation of the base-line-corrected peak heights obtained from laser densitometer analysis of the BPDE-mediated photolysis for the coding strand of exon 2. The third base of codon 61 is indicated with an arrow. Only the peak heights of the guanine nucleotides are shown.
dons 12 and 13 of the human c-Ha-rasl gene is consistent with the pattern of reactivity we observed for the guanine-rich sequences in pBR322 DNA (17) and with the pattern of enhanced reactivity to guanine-rich sequences In addiobserved in other DNAs (14,16,19-22,24-26). tion, our results using BPDE-mediated photolysis to identify BPDE binding sites corroborate with those of Marien et al. (13)for exon 1 of the human c-Ha-rasl gene and with those of Reardon et al. (14)for exon 1and exon 2 of the rat c-Ha-rasl gene, where primer extension assays were used to identify BPDE binding sites. Mutations at codon 12 have been implicated in the activation of the c-Ha-rasl gene in chemically induced animal tumors (10). In vivo activation of the mouse K-ras gene by mutation at codon 12 induced by benzo[a]pyrene has been reported (29).Although mutational activation of the protooncogene at codon 12 is consistent with the preferential reactivity seen for codon 12, the majority of oncogene-activating mutations occur within codon 61 in animal tumor systems (7-9)and the human c-Ha-rasl gene in NIH3T3 cells (11,12). The observation of preferred mutation at codon 61 contrasts with the enhanced chemical reactivity observed for the guanine bases of codon 12 relative to the more moderate reactivity we observe at codon 61. Identification of the mutations that occur in codon 61 reveal that 50% are at the second position [adenine for codon 61 and thymine for anticodon 61 (30)].The occurrence of a significant fraction of mutations at the A.T base pair contrasts with the present data which show little reaction at this base pair. Less than 10% of the total covalent (*)-anti-BPDE adducts have been found to occur at adenine and cytosine residues, and thymine is reported to be unreactive (31).Dipple and co-workers (14)also found
little reactivity of (&)-anti-BPDEat the A-T base pair in codon 61 (CAA) and anticodon 61 (TTG) for the rat cHa-rasl gene. We conclude that the preferential chemical reactivity seen in the jt)-anti-BPDE binding to the human Ha-rasl gene in vitro is not well correlated with mutations which are associated with oncogene activation. The 5-fold enhancement of (*)-anti-BPDE chemical reactivity for the guanine bases of codons 12 and 13 and the 2- to 3-fold enhancement of (A)-anti-BPDE chemical reactivity for the guanine bases of codon 61 seem hardly sufficient to account for the high frequency of mutational oncogene activation observed at codon 61. Also, the frequency of mutations at the second position of codon 61 (A and T) clearly does not correlate directly with (*)-anti-BPDE activity. It is possible that BPDE adducts at, or surrounding, codon 12 are repaired more efficiently than BPDE adducts at, or surrounding, codon 61. It is also possible that mutations induced by BPDE adducts may occur at sites adjacent to the modified base, which may explain the high number of mutations that occur at the chemically unreactive second base of codon 61. In fact, mutations induced by the chemical carcinogen 24Nacety1amino)fluorene (AF) occur at unmodified hases adjacent to the AF adduct (32-35)and are repaired selectively (36).We also note that there are guanine-rich regions of DNA in transcriptional control regions of eukaryotic genes (24,25,37).Since these guanine-rich regions are expected to exhibit preferential chemical reactivity for (A)-anti-BPDE, there exists the possibility of interplay between mutational activation of protooncogenes and enhancement of oncogene expression due to a chemically induced mutation in a control region. Lastly, the presence of nuclear proteins (e.g., histones) may have a significant
280 Chem. Res. Tonicol., Vol. 4, No. 3, 1991
impact on the chemical reactivity of (f)-anti-BPDE with specific bases of DNA; however, the effect of histone proteins on the covalent attachment of (*)-anti-BPDE is not straightforward to analyze and is beyond the scope of this paper (e.g., see refs 38-40, and references therein). In summary, while preferential chemical reactivity is a factor in the activation of the c-Ha-rasl protooncogene by (*)-anti-BPDE, the in vivo mechanism of c-Ha-rasl activation is a complex process. The structure of the adduct and fidelity of the DNA repair systems, as well as other cooperating events, likely play a role in (*)-anti-BPDEinduced protooncogene activation. Acknowledgment. This work was supported by a research grant from the National Cancer Institute (CA35251), American Cancer Society Institutional Grant IN-l8C, and an NSF grant (CHE-86-17361) for the purchase of the laser system. We are grateful to Dr. Michael E. Hogan for helpful discussions regarding technical details of photomapping BPDE adducts and to Mark Prichard for his assistance with the operation of the Nd-YAG laser. Registry No. Guanine, 73-40-5.
References (1) Bishop, J. M. (1983) Cellular Oncogenes and Retroviruses. Annu. Reu. Biochem. 52, 301-354. (2) Barbacid, M. (1987) ras genes. Annu. Reu. Biochem. 56,779-782. (3) Maher, V. M., and McCormick, J. J. (1978) Mammalian Cell Mutagenesis by Polyaromatic Hydrocarbons and Their Derivatives. In Polycyclic Hydrocarbons and Cancer (Gelboin, H. V., and Ts’o, P. 0. P., Ed.) pp 137-160, Academic Press, New York. (4) Parada, L. F., and Weinberg, R. A. (1983) Presence of a Kirsten Murine Sarcoma Virus ras Oncogene in Cells Transformed by 3-Methylcholanthrene. Mol. Cell. Bid. 3, 2298-2301. (5) Eva, A., and Aaronson, S. A. (1983) Frequent Activation of c-kis as a Transforming Gene in Fibrosarcomas Induced by 3-Methylcholanthrene. Science 220, 955-956. (6) Sukumar, S., Pulciani, S., Donige, J., DiPaolo, J., Evans, C. H., Zbar, B., and Barbacid, M. (1984) A Transforming ras Gene in Tumorigenic Guinea Pig Cell Lines Initiated by Diverse Chemical Carcinogens. Science 223, 1197-1199. (7) Wiseman, R. W., Stowers, S. J., Miller, E. C., Anderson, M. W., and Miller, J. A. (1986) Activating Mutations of the c-Ha-ras Protooncogene in Chemically Induced Hepatomas of the Male B6C3 F1 Mouse. h o c . Natl. Acad. Sci. U.S.A. 83, 5825-5829. (8) Bizub, D., Wood, A. W., and Skalka, A. M. (1986) Mutagenesis of the Ha-ras Oncogene in Mouse Skin Tumors Induced by Polycyclic Aromatic Hydrocarbons. Proc. Natl. Acad. Sci. U.S.A. 83,6048-6052. (9) Dandekar, S., Sukumar, S., Zarbl, H., Young, L., and Cardiff, R. D. (1986) Specific Activation of the Cellular Harvey-ras Oncogene in Dimethylbenzanthracene-Induced Mouse Mammary Tumors. Mol. Cell. Biol. 6, 4104-4108. (10) Zarbl, H., Sukumar, S., Arthur, A. V., Martin-Zanca, D., and Barbacid, M. (1985) Direct Mutagenesis of Ha-ras-1 Oncogenes by N-Nitroso-N-Methylurea during Initiation of Mammary Carcinogenesis in Rats. Nature 315, 382-385. (11) Marshall, C. J., Vousden, K. H., and Phillips, D. H. (1984) Activation of c-Ha-ras-1 Protooncogene by in vitro Modification with a Chemical Carcinogen, Benzo[a]pyrene Diol-epoxide. Nature 310, 586-589. (12) Vousden, K. H., Bos, J. L., Marshall, C. J., and Phillips, D. H. (1986) Mutations Activating Human c-Ha-rasl Protooncogene (HRAS1) Induced by Chemical Carcinogens and Depurination. Roc. Natl. Acad. Sci. U S A . 83,1222-1226. (13) Marien, K., Mathews, K., van Holde, K., and Bailey, G. (1989) Replication Blocks and Sequence Interaction Specificities in the Codon 12 Regions of the c-Ha-ras Proto-oncogene Induced by Four Carcinogens in vitro. J. Biol. Chem. 264, 13226-13232. (14) Reardon, D. B., Bigger, A. H., Strandberg, J., Yagi, H., Jerina, D. M., and Dipple, A. (1989) Sequence Selectivity in the Reaction of Optically Active Hydrocarbon Dihydrodiol Epoxides with Rat H-ras DNA. Chem. Res. Toricol. 2, 12-14. (15) Boles, T. C., and Hogan, M. E. (1984) Site-Specific Carcinogen Binding to DNA. Proc. Natl. Acad. Sci. U.S.A. 81, 5623-5627.
Dittrich and Krugh (16) Boles, T. C., and Hogan, M. E. (1986) High-Resolution Mapping of Carcinogen Binding Sites on DNA. Biochemistry 25, 3039-3043. (17) Dittrich, K. A,, and Krugh, T. R. (1991) Analysis of Site-Specific Binding of (A)-anti-Benzo[a]pyrene Diol Epoxide to Restriction Fragments of pBR322 DNA via Photochemical Mapping. Chem. Res. Torocol. (preceding paper in this issue). (18) Pulciani, S., Santos, E., Lauver, A. V., Long, L. K., and Barbacid, M. (1982) Transforming Genes in Human Tumors. J.Cell. Biochem. 20, 51-61. (19) Haseltine, W. A., Lo, K. M., and D’Andrea, A. D. (1980) Preferred Sites of Strand Scission in DNA Modified by anti-Diol Epoxide of Benzo[a]pyrene. Nature 209, 929-931. (20) Sage, E., and Haseltine, W. A. (1984) High Ratio of AlkaliSensitive Lesions to Total DNA Modification Induced by Benzo[alpyrene Diol Epoxide. J. Bid. Chem. 259, 11098-11102. (21) Lobanenkov, V. V., Plumb, M., Goodwin, G. H., and Grover, P. L. (1986) The Effect of Neighboring Bases on G-Specific DNA Cleavage Mediated by Treatment with the anti-Diol Epoxide of Benzo[a]pyrene in vitro. Carcinogenesis 7, 1689-1695. (22) Rill, R. L., and Marsch, G. A. (1990) Sequence Preferences of Covalent DNA Binding by anti-(+)- and anti-(-)-Benzo[a]pyrene Diol Epoxides. Biochemistry 29, 6050-6058. (23) Dittrich, K. A. (1989) The Site-Specific Binding of Benzo(a)pyrene diol epoxide to Native DNA in vitro, Ph.D. Thesis, University of Rochester. (24) Mattes, W. B., Hartley, J. A., Kohn, K. W., and Matheson, D. W. (1988) GC-Rich Regions in Genomes as Targets for DNA Alkylation. Carcinogenesis 9 ( l l ) , 2065-2072. (25) Osborne, M. R. (1990) Sequence Specificity in the Reaction of Benzopyrene Diol Epoxide with DNA. Chem.-Biol. Interact. 75, 131-140. (26) Geacintov, N. E., Cosman, M., Ibanez, V., Birke, S. S., and Swenberg, C. E. (1990) Characteristics of Noncovalent and Covalent Interactions of (t)and (-) anti-Benzo[a]pyrene Diol Epoxide Stereoisomers of Different Biological Activities with DNA. In Molecular Basis of Specificity in Nucleic Acid-Drug Interactions (Pullman, B., and Jortner, J., Ed.) pp 433-450, Kluwer Academic Publishers, Dordrecht. (27) Miller, K. J., Taylor, E. R., and Dommen, J. (1985) A mechanism for the stereoselectivity and binding of benzo[a]pyrene diol epoxides. In Polycyclic Hydrocarbons and Carcinogenesis (Harvey, R. G., Ed.) pp 239-288, American Chemical Society, Washington, DC. (28) Zakrzewska, K., and Pullman, B. (1987) Sequence selectivity, a test of the nature of the covalent adduct formed between benzo[a]pyrene and DNA. J. Biomol. Struct. Dyn. 4, 845-858. (29) You, M., Candrian, V., Widegren, B., Maronpot, R., Stoner, G. D., and Anderson, M. W. (1988) Activation of the K-ras Oncogene in Spontaneously Occurring and Chemically-Induced Lung Tumors of Strain A Mice. Proc. Am. Assoc. Cancer Res. 29, 143. (30) Vousen, K. H., Bos, J. L., and Phillips, D. H. (1986) Mutations Activating Human c-Ha-ras 1 Proto-oncogene (HRAS1) Induced by Chemical Carcinogenes and Depurination. Proc. Natl. Acad. Sci. U.S.A. 83, 1222-1226. (31) Straub, K. M., Meehan, T., Burlingame, A. L., and Calvin, M. (1977) Identification of the Major Adducts Formed by Reaction of Benzo[a]pyrene Diol Epoxide with DNA in vitro. Proc. Natl. Acad. Sci. U.S.A. 74, 5285-5289. (32) Saghur, D., and Strauss, B. (1985) Abasic Sites from Cytosine as Termination Signals for DNA Synthesis. Nucleic Acids Res. 13,4285-4298. (33) Gupta, P. K., Johnson, D. L., Reid, T. M., Lee, M. S., Romano, L., and King, C. M. (1989) Mutagenesis by Single Site-Specific Arylamine-DNA Adducts. J. Biol. Chem. 264, 20120-20130. (34) Mitchell, N., and Stoher, G. (1986) Mutagenesis Originating in Site-Specific DNA Damage. J. Mol. Biol. 191, 177-180. (35) Hoffmann, G. R., and Fuchs, R. P. P. (1990) DNA Sequence Analysis of Mutations Induced by N-2-Acetylamino-7-iodofluorene in Plasmid pBR322 in Escherichia coli. J. Mol.Biol. 213, 239-246. (36) Seeberg, E., and Fuchs, R. P. P. (1990) Acetylaminofluorene Bound to Different Guanines of the Sequence -GGCGCC- is Excised with Different Efficiencies by the UvrABC Excision Nuclease in a Pattern not Correlated to the Potency of Mutation Induction. Proc. Natl. Acad. Sci. U.S.A. 87, 191-194. (37) Kootstra, A., Lew, L. K., Nairn, R. S., and Macleod, M. C. (1989) Preferential modification of GC boxes by benzo(a)pyrene7,8-diol-9,10-epoxide. Mol. Carcinogen. 1, 239-244.
Chem. Res. Toxicol. 1991,4, 281-289 (38) Mitchell, C. E., and Akkaraju, S. (1989) Binding of polycyclic and nitropolycyclicaromatic hydrocarbone to specific fractions of rat lung chromatin. Cancer Lett. 48, 129-134. (39) MacLeod, M.C.,Smith, B., and Lew, L. K. (1989) Interaction of an ultimate chemical carcinogen, benzo(a)pyrene diol epoxide,
28 1
with nucleosome core particles: apparent lack of protection of DNA by histone proteins. Mol. Carcinogen. 1,245-252. (40) MacLeod, M. C. (1990) The importance of intercalation in the covalent binding of benzo(a)pyrene diol epoxide to DNA. J . Theor. Biol. 142, 113-122.
Inhibition of Hepatic Microsomal Cytochrome P-450 Dependent Monooxygenation Activity by the Antioxidant 3- tert -Butyl-4- hydroxyanisole A. D. Rodrigues,? D. Fernandez,? M. A. Nosarzewski,? W. M. Pierce, Jr.,j and R. A. Prough*J Departments of Biochemistry and of Pharmacology and Toxicology, University of Louisville School of Medicine, Louisville, Kentucky 40292 Received October 19, 1990 The efficacy of 3-tert-butyl-4-hydroxyanisole(BHA) as a chemopreventive agent against chemically induced cancer or toxicity may involve the direct modulation of cytochrome P-450 dependent monooxygenase function. This hypothesis was investigated by using purified rabbit cytochrome P-450IA2 and P-450IIB4 in a reconstitution system with purified NADPH:cytochrome P-450 oxidoreductase and L-a-dilauroylphosphatidylcholine.BHA caused a concentration-dependent decrease in cytochrome P-450IIB4 dependent 7-ethoxycoumarin 0-deethylation, cyclohexane hydroxylation, and benzphetamine N-demethylation activities (ICN; 28,75, and 290 pM,respectively) and in cytochrome P-450IA2 dependent 7-ethoxyresorufin 0-deethylation and acetanilide para hydroxylation activities (ICm approximately 225 pM). The inhibition of monooxygenation activity was accompanied by redox cycling due to the tert-butylquinone produced during BHA metabolism, as measured by increased NADPH and oxygen consumption or hydrogen peroxide and superoxide anion production. Glutathione was shown to reverse this redox cycling phenomenon but did not reverse the BHA-dependent inhibition of monooxygenation activity. Using standard steady-state kinetic analyses, BHA was shown to be a mixed-type competitive inhibitor of benzphetamine metabolism by cytochrome P-45OIIB4, suggesting that BHA does not simply compete as an alternate substrate for the hemoprotein but must also bind to another catalytically functional form of cytochrome P-450. BHA was shown to bind as a ligand to both purified and microsomal cytochrome P-450IA2, resulting in a low to high (type I) spin-state perturbation. In contrast, no heme spin-state perturbation was evident with purified cytochrome P-45OIIB4, but the binding of other substrates to cytochrome P-450IIB4 and to a lesser extent to P-450IA2 was reversed by addition of BHA. Since redox cycling due to BHA metabolites is prevented when glutathione is present, these results indicate that the redox cycling of the principle BHA metabolites (tert-butylquinone and tert-butylhydroquinone) does not solely bring about the inhibition of monooxygenase activity. However, BHA preferentially inhibits metabolism of other substrates by a mechanism other than simple competition for substrate binding and is itself facilely metabolized by mammalian cytochromes P-450 during this process.
I ntroductlon
electrophilic intermediates formed by metabolism of xenobiotics (4, 5 ) .
* To whom correspondence should be addressed. 'Department of Biochemistry. 8 Department of Pharmacology and Toxicology.
However, the administration of BHA just prior to ex-
Abbreviations: DLPC, L-a-dilauroylphoephatidylcholine; BHA, 3tert-butyl-4hydroxyanisole; GSH, reduced glutathione;SOD, superoxide dismutase; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-lpropanesulfonatq PB, phenobarbital; pNF, 6-naphthoflavone. C y b chrome P-450, from Pseudomonas putida and rabbit hepatic microsomal cytochromes P-450LM2 and P-450LM4 are designated aa P450CIA1, P-450IIB4, and P-450IA2, respectively ( I ) .
0893-228~/91/2704-0281$02.50/0 0 1991 American Chemical Society
