Apigenin suppresses IL-1Î²-induced expression of ... - ACS Publications

Subscriber access provided by University of South Dakota

Bioactive Constituents, Metabolites, and Functions

Apigenin suppresses IL-1#-induced expression of urokinasetype plasminogen activator receptor by inhibiting MAPK-mediated AP-1 and NF-#B signaling in human bladder cancer T24 cells Yong Xia, Miaomiao Yuan, Shinan Li, Ung Trong Thuan, Thi Thinh Nguyen, Taek Won Kang, Wenzhen Liao, Sen Lian, and Do Young Jung J. Agric. Food Chem., Just Accepted Manuscript • Publication Date (Web): 27 Jun 2018 Downloaded from http://pubs.acs.org on June 27, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 35

Journal of Agricultural and Food Chemistry

Apigenin suppresses IL-1β-induced expression of urokinase-type plasminogen activator receptor by inhibiting MAPK-mediated AP-1 and NF-кB signaling in human bladder cancer T24 cells Yong Xia†, ¶, Miaomiao Yuan#, Shinan Li†, Ung Trong Thuan†, Thi Thinh Nguyen†, Taek Won Kang†, Wenzhen Liao˧, *, Sen Lianǁ, §, *, and Young Do Jung†, * †

Research Institute of Medical Sciences, Chonnam National University Medical School, G

wangju 501-190, Republic of Korea ¶

Department of Urology, New York University School of Medicine, New York, NY, 1001

6, USA #

Cancer Research Institute, Guangdong Provincial Key Laboratory of Cancer Immunothera

py Research, School of Basic Medical Sciences, Southern Medical University, Guangzhou, Guangdong 510515, Guangdong, China ˧

Department of Nutrition and Food Hygiene, Guangdong Provincial Key Laboratory of Tr

opical Disease Research, School of Public Health, Southern Medical University, Guangzhou 510515, Guangdong, China; ǁ

Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, S

outhern Medical University, Guangzhou 510515, Guangdong, China § Guangdong

Provincial Key Laboratory of Biochip, Guangzhou 510515, Guangdong, China;

*

Corresponding authors:

Young Do Jung, MD, PhD Research Institute of Medical Sciences, Chonnam National University Medical School, Gwangju 501-190, Republic of Korea

ACS Paragon Plus Environment


Tel: (+82)-61-3792772 Fax: (+82)-61-3792781 E-mail: [email protected] Wenzhen Liao, PhD Department of Nutrition and Food Hygiene, School of Public Health, Southern Medical University, No.1023 South Shatai Road, Guangzhou 510515, China. Tel: (+86) 20-61648309; Fax: (+86) 20-61648324; E-mail: [email protected] Sen Lian, PhD Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Southern Medical University, No. 1023 South Shatai Road, Guangzhou 510515, China. Tel: (+86) 20- 62789385; Fax: (+86) 20- 62789385; Email: [email protected]


Page 2 of 35

Page 3 of 35


Abstract Urokinase-type plasminogen activator receptor (uPAR), a glycoprotein localized on cell surface with a glycosylphosphatidylinositol anchor, plays a crucial role in cell invasion and metastasis of several cancers including bladder cancer, and its expression is significantly negatively correlated with patient survival rate. Apigenin, a naturally produced phytochemical compound found in fruits, vegetables and plant leaves, has been shown to mediate a variety of cancer metastasis-related molecules in various cancers. The effect of apigenin on uPAR expression is still unknown up to date. In this study, we examined the effects of apigenin on IL-1β-induced uPAR expression and investigated its potential mechanisms. It is discovered in this study that IL-1β could remarkably induce uPAR expression in bladder cancer T24 cells, and apigenin inhibited IL-1β-induced uPAR expression concentration-dependently. Interestingly, NF-κB and AP-1 transcription factors were critically required for IL-1β-induced high uPAR expression. Apigenin suppressed the transcriptional activity of both AP-1 and NF-κB by inhibiting ERK1/2 and JNK signaling pathways. These results suggest that apigenin can exert anti-invasion effects by inhibiting uPAR expression via mediating (ERK1/2, JNK)/AP-1 and (ERK1/2, JNK)/NF-κB signaling pathways in human T24 cells. Our present study have generated novel and valuable biological insight onto anti-invasion through treatment by small native compound.

Keywords: Apigenin, uPAR, MAPKs, AP-1, NF-κB



Page 4 of 35

Introduction Bladder cancer has been known as the seventh most common cancer in men worldwide. And it is the fourth and ninth most common cancer in men and women respectively in developed country 1. Muscle-invasive bladder cancer (MIBC) is a poly-phase cancer including T2 tumours to T4 tumours (may metastasize to uterus, prostate, vagina or bowel). Unlike non-muscle-invasive bladder cancer (NMIBC), MIBC is much more malignant and has much lower five year survival rate 2. Tumor cell invasion has been considered as a multifactorial process that requires coordinated process of proteolytic enzymes which can destroy extracellular barrier and the inhibitors for protease

3-4

. The system consisted of urokinase-type

plasminogen activator (uPA) and its receptor play very crucial role in fibrinolysis extracellular matrix and facilitating tumor cell invasion

5-6

. Urokinase-type

plasminogen activator receptor (uPAR) can increase pericellular proteolysis and destroy cellular barrier, in turn inducing cell migration 7 and invasion 8. High uPAR expression is observed in tumor extracts of patients with high metastasis and poor prognosis cancer

9-10

. In contrast, expression of antisense cDNA which blocks

uPAR expression decreases the invasive capacity of cancer cells

11-12

. Therefore,

agents that suppress uPAR expression may be useful for developing anti-tumorinvasion therapies. Studies indicate that inflammation plays an important role in tumor progression

13

. Interleukin-1β (IL-1β), an important pro-inflammatory cytokine,

mediates a number of physiological responses such as inflammation, fever or lymphocyte activation

14

. Besides the inflammation response, IL-1β can also

induce uPA and matrix metalloproteinases (MMPs) expression thus promotes proteolysis extracellular matrix in different cells through PKCα, MAPK, and NF-


Page 5 of 35


κB pathways

15-17

. However, the relationship between IL-1β and uPAR and its

potential mechanisms are poorly understood in bladder cancer. Apigenin (4ʹ,5,7-trihydroxyflavone), a phytoestrogenic compound

18

, is a

naturally generated nontoxic and non-mutagenic plant flavonoid widely existed in various vegetables and fruits 19. The richest natural sources of apigenin are celery, parsley, tomato, apple, chamomile, lemon balm, peppermint, red wine, and so on. Recently, apigenin has gained importance as functional food ingredient because of its striking health care effect

20

. Moreover, apigenin has been reported to exert

antitumor effects on breast cancer cells via suppression of cell proliferation via arresting cell cycle and mediated p21WAF1/CIP1 expression

21

. It also has been

reported that Apigenin reduced NF-κB and Snai1 expression, suppressed epithelial-mesenchymal transition (EMT) related molecules levels, increased cellular adhesion, regulated cell migration, and inhibited cell invasion in hepatocellular carcinoma cells

22

. However, the anti-invasion effects of apigenin

and the mechanism in bladder cancer cells has not been reported. In our current study, we detected the effect of apigenin on IL-1β-induced uPAR expression and explored its underlying molecular mechanisms. This is the first study to reveal that apigenin suppresses uPAR expression by blocking MAPK (ERK1/2 and JNK) signaling pathway-induced transcriptional activity of AP-1 and NF-κB, thus inhibiting the invasion of human bladder cancer T24 cells, which could provide a novel insight into develop a new medicinal strategy for MIBC treatment.

Materials and Methods Chemicals Apigenin and the other chemicals were purchased from Sigma-Aldrich (St. Louis,



MO, USA). Clinical Data Analysis and Specimen Collection IL-1β and uPAR RNA array data for comparison between NMIBC and MIBC were from database GSE89. The co-expression RNA profile data were from database GSE31189. The de-identified bladder tumor specimens were from by Chonnam National University Hospital. The specimens were collected under institutional review board (IRB) approval from Chonnam National University Hwasun Hospital (CNUH06-070). H&E Staining 5μm-thickness sections were cut from formalin-fixed paraffin embedded block for staining. The sections on slides were first steeped in xylene and immersed in 100% ethanol and 90% ethanol respectively. After washing with running water, the sections were incubated in hematoxylin solution for 5 min, following rinsing by running water. Eosin staining was then performed by incubation in Eosin solution for 1 min, following washing with 95% ethanol, 100% ethanol and 100% xylene successively. Finally, the sections were mounted for observing under microscope (AxioPlan 2; Zeiss, Germany). Immunofluorescence Staining After sections dewaxing, microwave heating method was employed for unmasking the antigen. Non-specific binding sites in the sections were blocked of in 1% BSA in PBS. Primary antibodies were added onto samples and incubated at 4°C for 14 hours in staining tray: Anti-uPAR (1:400, PA1344, Boster Biological Techenology, Pleasanton, CA USA), Anti-IL-1β (1:200, LS-C169431, LifeSpan BioScience, Seattle,


Page 6 of 35

Page 7 of 35


WA, USA). The sections were then incubated in secondary antibody with alexa-488

or alexa-594 (1:500, Invitrogen, Eugene, OR, USA). Then the slides were imaged with a microscope (AxioPlan 2; Zeiss, Germany). Cell Culture and Culture Conditions Bladder cancer T24 cells were from ATCC (Manassas, VA, USA) and were cultured in DMEM (high glucose; Hyclone, Logan, UT, USA) mixed with 10 percent FBS and 0.6 percent antibiotics penicillin-streptomycin in 5% CO2 at 37°C. Effect of apigenin (Sigma-Aldrich, St. Louis, MO, USA), PD98059 (PD; Calbiochem, San Diego, CA, USA), SP600125 (SP; Calbiochem, San Diego, CA, USA), SB203580 (SB; Calbiochem, San Diego, CA, USA), BAY-11-7082 (BAY; Calbiochem, San Diego, CA, USA) and SR 11302 (SR; Tocris Bioscience, Ellisville, MO, USA) on uPAR expression was tested through pretreating T24 cells with different concentrations of these chemicals, followed treating cells with IL-1β (R&D, Minneapolis, MN, USA). Cell Viability Assay 5×103 T24 cells were planted in a 96-well plate containing DMEM supplemented with different concentration of apigenin for 12 hours. The cell viability was examined by performing an MTT assay (Sigma-Aldrich, St. Louis, MO, USA) as our previous paper described 23. Reverse Transcription-PCR Total RNA was extracted from T24 cells with TRIzol reagent (#15596026, Invitrogen, Carlsbad, CA, USA). Next, 1 μg total RNA in each sample was used for



Page 8 of 35

synthesizing the cDNA by M-MLV reverse transcriptase kit (Promega, Madison, WI, USA). The cDNA obtained was amplified using primer sets against genes encoding GAPDH and uPAR using PCR master kit (iNtRON, Seongnam, Gyeonggi-do, Korea). Sequences of primers used for performing PCR are as follows: GAPDH sense, 5ʹTTGTTGCCATCA

ATGACCCC-3ʹ;

TGACAAAGTGGTCGTTGAGG-3ʹ

(798

GATTGCCGTGTGGAAGAGTG-3ʹ; TCAGGAAGTGGAAGGTGTCG

GAPDH bp);

uPAR

uPAR -3ʹ

(480

bp);

GGAAACGACCTTCTATGACGATGCCCTCAA-3ʹ;

antisense, sense,

5ʹ5ʹ-

antisense,

5ʹ-

c-jun

sense,

5ʹ-

antisense,

5ʹ-

c-jun

GAACCCCTCCTGCTCATCTGTCACGTTCTT-3ʹ (287 bp); c-fos sense, 5ʹCAGTCAGATCAAGGGAAGCCACAGACATCT-3ʹ;

c-fos

antisense,

5ʹ-

GAATAAGATGGCTGCAGCCAAATGCCGCA-3ʹ (246 bp). PCR products were electrophoresed on agarose gel with ethidium bromide as DNA probe. Real-time PCR was employed for detecting the uPAR mRNA expression using Fast SYBR Green Master Mix Kit (Applied Biosystems, Forster city, CA, USA), with following primers: uPAR

sense,

5’-TGGGAAGAAGGAGAAGAGC-3’;

uPAR

anti-sense

5’-

CACACACAACCTCGGTAAGG;

GAPDH

sense,

5’-

TGGTATCGTGGAAGGACTCA-3’;

GAPDH

anti-sense,

5’-

GGATGATGTTCTGGAGAGCC -3’. Western Blotting After being washed with PBS, T24 cells were detached with trypsin, and stored at -80°C for further use. Proteins present in the cells were extracted using whole-cell lysis


Page 9 of 35


buffer (PRE-PERP protein extraction kit, iNtRON, Korea). Next, 50 μg proteins were separated by performing SDS-PAGE and then were transferred onto 0.45 μM PVDF membranes (Millipore Corporation, Billerica, MA, USA). The transferred membranes were firstly blocked using TBST solution containing 5% skimmed milk, and then were incubated at 4°C with a primary antibody for 14 hours. After being rinsed three times with TBST, horseradish peroxidase labelled secondary antibody (Cell Signaling Technology, Danvers, MA, USA) was employed to detect immuno-reactive signals in a luminescence detection system. The primary antibodies were used as following: antiuPAR antibody (#9692; Cell Signaling Technology, Danvers, MA, USA), antiphosphorylated NF-κB p65 antibody (#3031; Cell Signaling Technology, Danvers, MA, USA), anti-phosphorylated IκBα (Ser32) antibody (#2859; Cell Signaling Technology, Danvers, MA, USA), anti-IκBα antibody (#9242; Cell Signaling Technology, Danvers, MA, USA), anti-phosphorylated c-jun antibody (#3270; Cell Signaling Technology, Danvers, MA, USA), anti-phosphorylated c-fos antibody (#5348; Cell Signaling Technology, Danvers, MA, USA), anti-phosphorylated p38 MAPK antibody (#9211; Cell Signaling Technology, Danvers, MA, USA), anti-phosphorylated ERK antibody (#4377; Cell Signaling Technology, Danvers, MA, USA), and anti-phosphorylated JNK antibody (#9251; Cell Signaling Technology, Danvers, MA, USA). The loading quantity of samples were tested by stripping the blotted membrane in 62.5 mM Tris– HCl (pH 7.4) containing 2% SDS and 100 mM 2-mercaptoethanol, followed hybridization with β-actin antibody (sc-130656; Santa Cruz, Dallas, Texas, USA) or antibodies against total NF-κB p65 or total ERK1/2 (#8242 and #9102, respectively;



Cell Signaling Technology, Danvers, MA, USA). uPAR Promoter Activity Measurement UPAR promoter activity was examined by transiently transfecting T24 cells with an uPAR promoter-luciferase reporter construct (pGL3-uPAR) which was obtained from Dr. Y. Wang (Australian National University, Canberra, Australia). When T24 cells grew to confluency of 60%-70%, the cells were transfected with the pGL3-uPAR promoter construct by using FuGENE 6 (Promega, Madison, WI, USA) transfection reagent, according to the manufacturers' protocol. For the internal control, the cells were transfected with pRL-TK plasmid containing herpes simplex virus type 1 thymidine kinase promoter together with Renilla luciferase. After transfection overnight, T24 cells were treated with IL-1β for 4 hours. Then, the effect of apigenin on the activity of the uPAR promoter was determined by pretreating the cells with apigenin for 1 hour, followed by treatment with IL-1β. Dominant-negative mutants of p38 MAPK (pMCL-mP38), JNK (pMCL-TAM67) or MEK-1 (pMCL-K97M) were respectively transfected into T24 to investigate the MAPK signaling in IL-1β treatment. The constructs of mP38, TAM67 and K97M which were kindly provided by Dr. J. Han (Scripps Research Institute, CA, USA), Dr. MJ. Birrer (NCI, Rockville, MD, USA), and Dr. NG. Ahn (University of Colorado-Boulder, CO, USA), respectively. The importance of NF-κB and AP-1 in IL-1β-induced uPAR expression was determined by transfecting the cells with pGL-uPAR promoter vector with mutated AP-1 and NF-κB binding sites. After incubation and treatment with apigenin, T24 cells were detached and crushed by lysis reagent (Promega, Madison, WI, USA). Then, the luciferase


Page 10 of 35

Page 11 of 35


activity in the cell lysis supernatant was examined using a luminometer (Centro XS lb960, Berthold Technologies, Oak Ridge, TN, USA). Transient Transfection of AP-1 and NF-κB Promoter-Driven Reporter Plasmids AP-1 and NF-κB promoter-driven reporter plasmids were purchased from Clontech (Palo Alto, CA, USA). T24 cells showing 60%-70% confluency were washed with Opti-MEM and were transfected with the AP-1 or NF-κB promoter-driven reporter plasmid by FuGENE 6 transfection kit. Apigenin-pretreated and AP-1 or NF-κB promoter-driven reporter plasmid-transfected cells were co-incubated with IL-1β (1 ng/ml), and then the luciferase activity was detected. Cells Invasion Assay A 10-well chemotaxis chamber (Neuro Probe, Gaithersburg, MD, USA) inserted with membranes having micro-pores (Neuro Probe) was used for cell invasion assay. T24 cells in 200μl medium were planted into upper chamber containing IL-1β, apigenin, MAPK signaling pathway inhibitors, or uPAR antibody respectively. DMEM supplemented with 10% FBS in the lower chamber to serve as a chemoattractant. After incubation for 24 hours, the non-invading cells on the upper surface of the membrane were scraped using a cotton swab, and on the lower surface, invading cells were stained with Diff-Quick kit (Becton-Dickinson, Franklin Lakes, NJ, USA). After rinsing twice using distilled water and dried in air, the invading cell numbers were counted. Gelatin Zymography T24 cells pretreated with (or without) apigenin for 1 hour were incubated with 1



ng/ml IL-1β for 24 hours. Then the media supernatant were collected for gelatin zymography experiment to check the MMPs activity. 2×sample loading buffer was mixed with the above cell culture supernatant. After boiling for 10 min, the samples were loaded into a 7.5% acrylamide: bisacrylamide (29:1; Sigma, St. Louis, MO, USA) gel which contained 625 μg/ml gelatin (Sigma, St. Louis, MO, USA). The electrophoresis was performed in 80v for 150min. Then the gel was rinsed in 2.5% (v/v) Triton X-100 water solution for 3 times. Next, the gel was incubated in 50 mM Tris (pH 7.5) containing 5 mM CaCl2, 1 μM ZnCl2 and 100 mM NaCl for 24 hours (37°C). Finally, Coomassie Brilliant Blue R250 (Bio-Rad, Richmond, CA, USA) was used to stain the gels. The pellucid bands against the brilliant blue background indicate the activated MMP2 and MMP9 bands. Statistical Analysis All values were shown as mean ± standard deviation (SD), and represented the mean of three times experiments repeats. The comparison between two groups was analyzed by t-test. And data with three or more groups were analyzed by one-way ANOVA with LSD post-hoc test. The differences were considered significant at P < 0.05. Results and Discussion Overexpression and Correlation of IL-1β and uPAR in Bladder Cancer Bladder cancer is a complicated disease induced by genetic or non-genetic risk factors contributing to its etiology. One of the non-genetic risk factor is inflammation


Page 12 of 35

Page 13 of 35


24

. Inflammation is an adaptive immune response responsible for protecting the body

against endogenous or extrinsic stress as well as mediating the repair process or clearance process 25. In urinary bladder, factors which predispose the urothelium to a sustained inflammation environment also appear to increase bladder cancer risk

26-27

.

Recently, Lee analyzed and compared the neutrophil-to-lymphocyte ratio (NLR) in MIBC and NMIBC patients, and inferred that NLR might be an efficient measurable marker for MIBC diagnose 28. Besides, a variety of inflammatory biomarkers has been discovered to have close correlation to MIBC

29

, however few paper reported the

relationship between inflammation cytokine IL-1β and MIBC. In our study, IL-1β and uPAR expression data were obtained from public available RNA sequencing (RNA-seq) data 30 and was analyzed in 40 samples of bladder cancer patients. We observed that the expression of IL-1β and uPAR is upregulated in MIBC than NMIBC (Fig. 1A). In order to investigate whether uPAR co-expresses with IL-1β in urothelial cancer, we analyzed 92 human samples (52 samples of human urothelial cancer cells, and 40 samples of human non-cancer urothelial cells 31). As shown in Fig. 1B, both IL-1β and uPAR highly expresses in urothelial cancer cells than non-cancer urothelial cells, the score of Pearson correlation is 0.97, indicating that the correlation of IL-1β and uPAR expression is high. In specimen section (Fig. 1C and 1D), we verified that 1) the expression of IL-1β and uPAR in MIBC is extremely higher than in NMIBC; 2) the correlation between IL-1β and uPAR is indeed high in the MIBC. IL-1β Induces uPAR Expression in T24 cells T24 cells were incubated by IL-1β with different concentrations to examine the



Page 14 of 35

effect of IL-1β on the induction of uPAR expression. uPAR protein and mRNA was tested by performing western blotting，RT-PCR and Real-time PCR respectively. We observed that IL-1β dose-dependently induced uPAR expression (Fig. 1E, 1F and 1G), indicating that IL-1β might upregulate uPAR transcription. Furthermore, we examined the uPAR promoter activity. It has been observed that IL-1β enhanced the uPAR promoter in a dose-dependent manner, which indicates IL-1β may stimulate uPAR transcription (Fig. 1H). Apigenin Inhibits IL-1β-induced uPAR Expression Plant-derived natural chemicals are an epochmaking source of antitumor agents, with various available therapies involving or stemming from these natural generated products

32

. Apigenin is a kind of natural flavonoid which can take part in several

physiological course, including suppression of tumorigenesis

33-35

. For the purpose of

detecting the inhibitory effect of apigenin on IL-1β-induced uPAR highly expression, apigenin-pretreated T24 cells were stimulated by IL-1β. Then western blotting, RT-PCR and Real-time PCR were performed to determine uPAR protein and mRNA expression respectively. The results showed that pretreatment of T24 cells with apigenin inhibited IL-1β-upregulated uPAR protein (Fig. 2A) and mRNA (Fig. 2B and 2C) concentrationdependently. The inhibitory effect of apigenin on uPAR expression was further investigated by promoter-luciferase assay. Moreover, the results (Fig. 2D) showed that apigenin suppressed IL-1β-activated uPAR promoter concentration-dependently. Apigenin used in the present study (0-50 mM) did not damage T24 cells viability (Fig. 2E). The above results conclusively portend that apigenin have the biological function


Page 15 of 35


of inhibiting IL-1β-stimulated uPAR highly expression in human T24 cells by suppressing uPAR transcription. AP-1 and NF-κB Activation is Important for IL-1β-induced uPAR Expression Our previous studies demonstrated that transcription factors AP-1 and NF-κB were essential for uPAR transcription in stomach cancer cells and uPAR gene regulatory fragments contain binding sites for these transcription factors (AP-1-binding site, -235; NF-κB-binding site, -278/-96)

36

. In this study, we discovered that uPAR promoter

lacking its upstream region did not show an obvious difference between -453 and -346 but showed remarkable differences between -346 and -270, -270 and -221, as well as 221 and -77 (Fig. 3A). These results indicated that uPAR gene regulatory fragments contained AP-1- and NF-κB-binding sites from -346 to -77, suggesting that AP-1 and NF-κB were indispensable for IL-1β-activated uPAR transcription. To further verify the role of these two transcription factor in uPAR gene transcription, we used site-specific mutants of the uPAR promoter. As shown in Fig. 3B, the mutatant uPAR promoter in AP-1- and NF-κB site showed significantly lower activity than the uPAR promoter with intact sequence, which was consistent with our findings presented in Fig. 3A. Furthermore, the role of AP-1 and NF-κB in uPAR highly expression was examined by pretreating T24 cells with 5μM BAY-11-7082 which is a NF-κB inhibitor, and 1μM SR11302 which is an AP-1 inhibitor. Treatment with both BAY and SR abrogated IL1β-induced uPAR expression (Fig. 3C-3E). These above results indicate that transcription factors AP-1 and NF-κB are essential for IL-1β-stimulated uPAR expression.



Page 16 of 35

Apigenin Suppresses IL-1β-induced AP-1 and NF-κB Activation As demonstrated above that transcription factors AP-1 and NF-κB play critical roles in IL-1β-induced uPAR expression, we then investigated their roles in apigenininduced suppression of uPAR expression. AP-1-dependent transcription studies showed that apigenin inhibited IL-1β-activated AP-1 dose-dependently (Fig. 4A). As known that c-jun and c-fos are the elements of AP-1, we examined the effect of apigenin on cjun and c-fos by performing western blotting to obtain further insights on the mechanism underlying apigenin-mediated downregulation of AP-1 activity. We found that apigenin did not affect c-jun and c-fos expression but clearly inhibited the IL-1βincreased phosphorylation of c-jun and c-fos (Fig. 4B). Compared with normal cells, many types of cancer cells contain high levels of NF-κB in the nucleus, which enhance the transcription of target genes that lead to tumorigenesis or metastasis. Active NF-κB whole complex is a hetero- or homo- dimer containing NF-κB p65 and p50 or other related molecules. The active subunit of NF-κB can be segregated by IκBs, while phosphorylation of IκB can lead to the translocation of NF-κB subunit into the nucleus, in turn activate NF-κB, which is critical for target genes expression

37

. These data

showed that apigenin could suppress IL-1β-induced NF-κB activation dosedependently (Fig. 4C). In order to investigate the mechanism underlying apigenininduced inhibition of NF-κB transcriptional activity, we performed western blotting to assess the phosphorylation of NF-κB components. It was observed that apigenin suppressed IL-1β-enhanced phosphorylation of NF-κB p65 and IκBα in a concentration-dependent manner (Fig. 4D and 4E).


Page 17 of 35


Apigenin Suppresses IL-1β-activated MAPK (ERK1/2 and JNK) Pathways That are Crucial for uPAR Induction MAPKs are involved in signal transduction pathways that transfer signals from the extracellular environment to the nuclei of various cells and that involve a large number of proteins that regulate several cellular processes

38

. Our previous study has

reported that in gastric cancer cells, macrophage-stimulating protein (MSP) stimulates uPAR through the ERK1/2 and JNK pathways

36

, and cadmium induced uPAR high

expression via ERK1/2 pathway 39. Here, we examined MAPK signaling pathways to determine the mechanism underlying uPAR induction. IL-1β activated MAPK signaling pathways by increasing the phosphorylation of p38 MAPK, ERK1/2, and JNK in time-dependently (Fig. 5A). However, analysis by using MAPK inhibitors indicated that only ERK1/2 as well as JNK pathways, but not the p38 MAPK were essential for IL-1β-stimulated uPAR highly expression (Fig. 5B). To verify this hypothesis, we co-transfected T24 cells with plasmids expressing dominant-negative mutants construct K97M, TAM67 and mP38 along with the uPAR promoter-luciferase pGL3-uPAR. Analysis of reporter activities showed that only K97M and TAM67 decreased IL-1β-induced uPAR promoter activity but that mutant mP38 did not significantly affect IL-1β-induced activity of uPAR promoter (Fig. 5C), which was consistent with the results of analysis by using MAPK inhibitors. To further examine the underlying mechanism, we treated human T24 cells with IL-1β in the presence or absence of MAPK inhibitors and tested the phosphorylation of NF-κB p65. Treatment of T24 cells with the ERK1/2 inhibitor PD and JNK inhibitor SP suppressed IL-1β-



Page 18 of 35

induced p65 phosphorylation (Fig. 5D), indicating that ERK1/2 and JNK but not p38 MAPK were the upstream signaling molecules involved in IL-1β-activated NF-κB pathway. Meanwhile, we also examined the effect of pretreatment with the MAPK inhibitors on IL-1β-induced c-fos and c-jun phosphorylation. Co-incubation of T24 cells with the JNK inhibitor SP decreased IL-1β-enhanced c-jun phosphorylation; and ERK1/2 inhibitor PD and JNK inhibitor SP decreased IL-1β-induced c-fos phosphorylation (Fig. 5E), suggesting that during IL-1β increased uPAR expression ERK1/2 and JNK might play their role at upstream of AP-1. Because the above data indicated that ERK1/2 and JNK were important for NF-κB and AP-1 activation, we hypothesized that apigenin might affect the ERK1/2 and JNK signaling pathways. To verify this, T24 cells pretreated with apigenin were co-incubated with IL-1β and the phosphorylated ERK1/2 and JNK were tested by performing western blotting. We discovered that apigenin suppressed IL-1β-induced ERK1/2 and JNK phosphorylation dose-dependently (Fig. 5F and 5G). Besides activation of MAPKs, IL-1β may also enhance the ROS production, which is a group of oxidizing, ambulant, small molecules with highly reactive in a large number of cell types

40-41

. Metabolism of several

carcinogens may also partially induce cancer progression by generating ROS

42

.

Therefore, further studies might be performed to investigate and reveal the role of ROS in uPAR expression. Apigenin Inhibits IL-1β-induced Cell Invasion The activity of apigenin on suppressing cell invasion was examined by performing Boyden chamber invasion assay. Incubation of T24 cells with IL-1β increased invading


Page 19 of 35


cells which drilled through the matrigel barrier. We found that pretreatment of the cells with apigenin or anti-uPAR antibody decreased the cells number which drilled through the matrigel barrier (Fig. 6A), indicating that apigenin inhibited cell invasion by suppressing uPAR expression. Using gelatin zymography, we found apigenin dosedependently decreased the MMP-2 and MMP-9 which are downstreams of uPA/uPAR (Fig. 6B). Next, we examined whether MAPK inhibitors affect IL-1β-induced invasion of T24 cells. Treatment of T24 cells with anti-uPAR antibody, apigenin, PD, SP, BAY, or SR inhibited IL-1β-induced invasion of these cells (Fig. 6C), suggesting that apigenin partially inhibited the cell invasion by suppressing IL-1β-induced uPAR expression. Based on all the above discoveries, we developed a diagrammatic drawing to illustrate the mechanism underlying apigenin-induced inhibition of IL-1β-induced uPAR expression (Fig. 7). In conclusion, IL-1β induces uPAR expression through the (ERK or JNK)/AP-1 and (ERK or JNK)/NF-κB signaling pathways and apigenin suppressed IL-1β-induced uPAR expression by inhibiting ERK1/2/JNK pathway and ERK1/2/JNK-dependent transcription factor AP-1 and NF-кB. This research on signaling transduction mediators and transcription factors involved in the inhibition of IL-1β-induced uPAR expression may help in developing specific inhibitors of tumor metastasis and in turn new anticancer therapies. These results indicated that apigenin might be a potential functional food ingredient with the feature of anti-tumor activities.

Acknowledgments

This study was supported by a Basic Science Research Program grant through the National Research Foundation of Korea (NRF), funded by the Ministry of Education,



Science, and Technology (2018049918) and National Natural Science Foundation of China (nos.81702413, 81701836), and 2017 High Level University Program-Research Foundation for Advanced Talents (C1034220, C1034214).

References 1.

Burger, M.; Catto, J. W.; Dalbagni, G.; Grossman, H. B.; Herr, H.; Karakiewicz, P.; Kassouf, W.;

Kiemeney, L. A.; La Vecchia, C.; Shariat, S.; Lotan, Y., Epidemiology and risk factors of urothelial bladder cancer. Eur Urol 2013, 63 (2), 234-41. 2.

Kaufman, D. S.; Shipley, W. U.; Feldman, A. S., Bladder cancer. Lancet 2009, 374 (9685), 239-49.

3.

Steeg, P. S., Targeting metastasis. Nat Rev Cancer 2016, 16 (4), 201-18.

4.

Wei, Y.; Tang, C. H.; Kim, Y.; Robillard, L.; Zhang, F.; Kugler, M. C.; Chapman, H. A., Urokinase

receptors are required for alpha 5 beta 1 integrin-mediated signaling in tumor cells. J Biol Chem 2007, 282 (6), 3929-39. 5.

Mondino, A.; Blasi, F., uPA and uPAR in fibrinolysis, immunity and pathology. Trends Immunol

2004, 25 (8), 450-5. 6.

Roelofs, J. J.; Rowshani, A. T.; van den Berg, J. G.; Claessen, N.; Aten, J.; ten Berge, I. J.; Weening,

J. J.; Florquin, S., Expression of urokinase plasminogen activator and its receptor during acute renal allograft rejection. Kidney Int 2003, 64 (5), 1845-53. 7.

Schiller, H. B.; Szekeres, A.; Binder, B. R.; Stockinger, H.; Leksa, V., Mannose 6-phosphate/insulin-

like growth factor 2 receptor limits cell invasion by controlling αVβ3 integrin expression and proteolytic processing of urokinase-type plasminogen activator receptor. Molecular biology of the cell 2009, 20 (3), 745-756. 8.

Lian, S.; Xia, Y.; Ung, T. T.; Khoi, P. N.; Yoon, H. J.; Lee, S. G.; Kim, K. K.; Jung, Y. D.,

Prostaglandin E2 stimulates urokinase ‐ type plasminogen activator receptor via EP2 receptor ‐ dependent signaling pathways in human AGS gastric cancer cells. Molecular carcinogenesis 2016. 9.

Sidaway, P., Bladder cancer: uPAR expression indicates worse prognosis of urothelial carcinoma.

Nat Rev Urol 2015, 12 (3), 120. 10. Illemann, M.; Laerum, O. D.; Hasselby, J. P.; Thurison, T.; Hoyer-Hansen, G.; Nielsen, H. J.; Christensen, I. J.; Detection, D. S. G. E., Urokinase-type plasminogen activator receptor (uPAR) on tumor-associated macrophages is a marker of poor prognosis in colorectal cancer. Cancer Med-Us 2014, 3 (4), 855-864. 11. Wang, Y.; Liang, X.; Wu, S.; Murrell, G. A.; Doe, W. F., Inhibition of colon cancer metastasis by a 3′‐end antisense urokinase receptor mRNA in a nude mouse model. International journal of cancer 2001, 92 (2), 257-262. 12. Rao Malla, R.; Gopinath, S.; Alapati, K.; Gorantla, B.; Gondi, C. S.; Rao, J. S., Knockdown of cathepsin B and uPAR inhibits CD151 and α3β1 integrin‐mediated cell adhesion and invasion in glioma. Molecular carcinogenesis 2013, 52 (10), 777-790. 13. Balkwill, F.; Mantovani, A., Inflammation and cancer: back to Virchow? The lancet 2001, 357


Page 20 of 35

Page 21 of 35


(9255), 539-545. 14. Apte, R. N.; Dotan, S.; Elkabets, M.; White, M. R.; Reich, E.; Carmi, Y.; Song, X.; Dvozkin, T.; Krelin, Y.; Voronov, E., The involvement of IL-1 in tumorigenesis, tumor invasiveness, metastasis and tumor-host interactions. Cancer and Metastasis Reviews 2006, 25 (3), 387-408. 15. Liang, K. C.; Lee, C. W.; Lin, W. N.; Lin, C. C.; Wu, C. B.; Luo, S. F.; Yang, C. M., Interleukin1beta induces MMP-9 expression via p42/p44 MAPK, p38 MAPK, JNK, and nuclear factor-kappaB signaling pathways in human tracheal smooth muscle cells. J Cell Physiol 2007, 211 (3), 759-70. 16. Cheng, C. Y.; Hsieh, H. L.; Sun, C. C.; Lin, C. C.; Luo, S. F.; Yang, C. M., IL-1 beta Induces Urokinse-Plasminogen Activator Expression and Cell Migration Through PKC alpha, JNK1/2, and NFkappa B in A549 Cells. Journal of Cellular Physiology 2009, 219 (1), 183-193. 17. Lian, S.; Xia, Y.; Ung, T. T.; Khoi, P. N.; Yoon, H. J.; Kim, N. H.; Kim, K. K.; Jung, Y. D., Carbon monoxide releasing molecule-2 ameliorates IL-1beta-induced IL-8 in human gastric cancer cells. Toxicology 2016, 361-362, 24-38. 18. Shukla, S.; Gupta, S., Molecular targets for apigenin-induced cell cycle arrest and apoptosis in prostate cancer cell xenograft. Molecular cancer therapeutics 2006, 5 (4), 843-852. 19. Birt, D. F.; Hendrich, S.; Wang, W., Dietary agents in cancer prevention: flavonoids and isoflavonoids. Pharmacology & therapeutics 2001, 90 (2), 157-177. 20. Ali, F.; Rahul; Naz, F.; Jyoti, S.; Siddique, Y. H., Health functionality of apigenin: A review. International Journal of Food Properties 20 (6), 1197-1238. 21. Tseng, T. H.; Chien, M. H.; Lin, W. L.; Wen, Y. C.; Chow, J. M.; Chen, C. K.; Kuo, T. C.; Lee, W. J., Inhibition of MDA-MB-231 breast cancer cell proliferation and tumor growth by apigenin through induction of G2/M arrest and histone H3 acetylation-mediated p21(WAF1/CIP1) expression. Environmental Toxicology 2017, 32 (2), 434-444. 22. Qin, Y.; Zhao, D.; Zhou, H. G.; Wang, X. H.; Zhong, W. L.; Chen, S.; Gu, W. G.; Wang, W.; Zhang, C. H.; Liu, Y. R.; Liu, H. J.; Zhang, Q.; Guo, Y. Q.; Sun, T.; Yang, C., Apigenin inhibits NF-kappaB and snail signaling, EMT and metastasis in human hepatocellular carcinoma. Oncotarget 2016, 7 (27), 4142141431. 23. Xia, Y.; Lian, S.; Khoi, P. N.; Yoon, H. J.; Joo, Y. E.; Chay, K. O.; Kim, K. K.; Do Jung, Y., Chrysin inhibits tumor promoter-induced MMP-9 expression by blocking AP-1 via suppression of ERK and JNK pathways in gastric cancer cells. PLoS One 2015, 10 (4), e0124007. 24. Gakis, G., The role of inflammation in bladder cancer. Adv Exp Med Biol 2014, 816, 183-96. 25. Chaplin, D. D., Overview of the immune response. J Allergy Clin Immunol 2010, 125 (2 Suppl 2), S3-23. 26. Kundu, J. K.; Surh, Y. J., Inflammation: gearing the journey to cancer. Mutat Res 2008, 659 (1-2), 15-30. 27. Nesi, G.; Nobili, S.; Cai, T.; Caini, S.; Santi, R., Chronic inflammation in urothelial bladder cancer. Virchows Arch 2015, 467 (6), 623-633. 28. Lee, S. M.; Russell, A.; Hellawell, G., Predictive value of pretreatment inflammation-based prognostic scores (neutrophil-to-lymphocyte ratio, platelet-to-lymphocyte ratio, and lymphocyte-tomonocyte ratio) for invasive bladder carcinoma. Korean J Urol 2015, 56 (11), 749-55. 29. Masson-Lecomte, A.; Rava, M.; Real, F. X.; Hartmann, A.; Allory, Y.; Malats, N., Inflammatory biomarkers and bladder cancer prognosis: a systematic review. Eur Urol 2014, 66 (6), 1078-91. 30. Dyrskjot, L.; Thykjaer, T.; Kruhoffer, M.; Jensen, J. L.; Marcussen, N.; Hamilton-Dutoit, S.; Wolf, H.; Orntoft, T. F., Identifying distinct classes of bladder carcinoma using microarrays. Nat Genet 2003,



33 (1), 90-96. 31. Urquidi, V.; Goodison, S.; Cai, Y. P.; Sun, Y. J.; Rosser, C. J., A Candidate Molecular Biomarker Panel for the Detection of Bladder Cancer. Cancer Epidem Biomar 2012, 21 (12), 2149-2158. 32. Cragg, G. M.; Newman, D. J., Natural products: a continuing source of novel drug leads. Biochim Biophys Acta 2013, 1830 (6), 3670-95. 33. Shukla, S.; Gupta, S., Molecular mechanisms for apigenin-induced cell-cycle arrest and apoptosis of hormone refractory human prostate carcinoma DU145 cells. Mol Carcinog 2004, 39 (2), 114-26. 34. Way, T. D.; Kao, M. C.; Lin, J. K., Apigenin induces apoptosis through proteasomal degradation of HER2/neu in HER2/neu-overexpressing breast cancer cells via the phosphatidylinositol 3-kinase/Aktdependent pathway. Journal of Biological Chemistry 2004, 279 (6), 4479-4489. 35. Shi, M. D.; Shiao, C. K.; Lee, Y. C.; Shih, Y. W., Apigenin, a dietary flavonoid, inhibits proliferation of human bladder cancer T-24 cells via blocking cell cycle progression and inducing apoptosis. Cancer Cell Int 2015, 15, 33. 36. Park, J. S.; Park, J. H.; Khoi, P. N.; Joo, Y. E.; Do Jung, Y., MSP-induced RON activation upregulates uPAR expression and cell invasiveness via MAPK, AP-1 and NF-κB signals in gastric cancer cells. Carcinogenesis 2011, 32 (2), 175-181. 37. Estève, P. O.; Chicoine, É.; Robledo, O.; Aoudjit, F.; Descoteaux, A.; Potworowski, E. F.; St-Pierre, Y., Protein kinase C-ζ regulates transcription of the matrix metalloproteinase-9 gene induced by IL-1 and TNF-α in glioma cells via NF-κB. Journal of Biological Chemistry 2002, 277 (38), 35150-35155. 38. Cargnello, M.; Roux, P. P., Activation and Function of the MAPKs and Their Substrates, the MAPKActivated Protein Kinases (vol 75, pg 50, 2011). Microbiol Mol Biol R 2012, 76 (2), 496-496. 39. Khoi, P. N.; Xia, Y.; Lian, S.; Kim, H. D.; Kim, D. H.; Joo, Y. E.; Chay, K. O.; Kim, K. K.; Jung, Y. D., Cadmium induces urokinase-type plasminogen activator receptor expression and the cell invasiveness of human gastric cancer cells via the ERK-1/2, NF-κB, and AP-1 signaling pathways. International Journal of Oncology 2014, 45 (4), 1760. 40. Brigelius-Flohé, R.; Banning, A.; Kny, M.; Böl, G.-F., Redox events in interleukin-1 signaling. Archives of biochemistry and biophysics 2004, 423 (1), 66-73. 41. Kaur, J.; Dhaunsi, G. S.; Turner, R. B., Interleukin-1 and nitric oxide increase NADPH oxidase activity in human coronary artery smooth muscle cells. Medical Principles and Practice 2004, 13 (1), 26-29. 42. Waris, G.; Ahsan, H., Reactive oxygen species: role in the development of cancer and various chronic conditions. Journal of carcinogenesis 2006, 5 (1), 14.

Figure Legends Figure 1. IL-1β induced uPAR high expression plays significant role in bladder cancer cells invasion. (A) Comparison of IL-1β and uPAR mRNA between NMIBC and MIBC. RNA Array data are from database GSE89. The fold change of IL-1β and uPAR between NMIBC and MIBC are 11.943 and 7.076 respectively. P < 0.001. (B) IL-1β


Page 22 of 35

Page 23 of 35


and uPAR mRNA expression correlation analysis. RNA expression profile data are from database GSE31189 (C=cancer, N=non-cancer). Pearson correlation score=0.97. (C) H&E staining for NIMBC and MIBC bladder tumor sections. The The photographs were

taken

under

a

microscope

with

400×

magnificance.

(D)

Double

immunofluorescence staining was performed to detect IL-1β and uPAR in NIMBC and MIBC bladder tumor sections. IL-1β positive cells were stained in red and uPAR positive cells were stained in green. The photographs were taken under a fluorescence microscope with 400× magnificance. (E-H) T24 cells were treated with 0-10 ng/ml IL1β for 4 hours, and uPAR protein level (E), mRNA level (F and G), and promoter activity (H) were measured by performing western blotting, RT-PCR, Real-time PCR and promoter-luciferase reporter assay respectively. * P

Apigenin suppresses IL-1Î²-induced expression of ... - ACS Publications

Recommend Documents