Aptamer Conjugates: Nucleoapzymes

Subscriber access provided by University of Florida | Smathers Libraries

Article

Cu2+ or Fe3+ Terpyridine/Aptamer Conjugates: Nucleoapzymes Catalysing the Oxidation of Dopamine to Aminochrome Yonatan Biniuri, Bauke Albada, Mariusz Wolff, Eyal Golub, Dmitri Gelman, and Itamar Willner ACS Catal., Just Accepted Manuscript • DOI: 10.1021/acscatal.7b03454 • Publication Date (Web): 11 Jan 2018 Downloaded from http://pubs.acs.org on January 11, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Catalysis is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Cu2+ or Fe3+ Terpyridine/Aptamer Conjugates: Nucleoapzymes Catalysing the Oxidation of Dopamine to Aminochrome Yonatan Biniuri †, Bauke Albada ‡†, Mariusz Wolff †, Eyal Golub †, Dmitri Gelman †, and Itamar Willner* † †

Institute of Chemistry, The Hebrew University of Jerusalem, Jerusalem 91904, Israel

‡

Laboratory of Organic Chemistry, Wageningen University & Research, 6708 PB Wageningen,

The Netherlands

ABSTRACT

A concept to tailor catalytic nucleic acid structures is introduced. The method involves the covalent conjugation of catalytically active metal-ion complexes to sequence-specific ligandbinding nucleic acids (aptamers) yielding hybrids termed “nucleoapzymes” that act as enzyme mimicking nucleic acid-based structures. The concentration of the substrate by the aptamer binding site, in close proximity to the metal-ion complex catalytic site, models the active site structure of native enzymes, and yields catalytic systems. The possibility to tether the catalytic

ACS Paragon Plus Environment

1

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 30

sites to the 3’ or 5’ ends of the aptamer, to internal bases associated with the aptamer sequence, or the feasibility to introduce arbitrary flexible nucleic acid chains between the metal-ion complex catalyst and the aptamer binding site, provides a rich arsenal of diverse nucleoapzymes for each chemical transformation. The synthesis and characterization of Cu2+-terpyridine nucleoapzymes and of Fe3+-terpyridine nucleoapzymes that catalyze the oxidation of dopamine to aminochrome by H2O2 is presented. One of the Cu2+-terpyridine nucleoapzymes reveals a 60fold catalytic enhancement as compared to the separated catalyst/aptamer units. Similarly, one Fe3+-terpyridine nucleoapzyme reveals a 140-fold catalytic enhancement as compared to the separated catalyst/aptamer units. The different Cu2+-terpyridine nucleoapzymes reveal different activities, dominated by the relative spatial configurations of the catalytic site in respect to the dopamine (substrate) binding site. Molecular dynamics simulations were used to probe the association of the dopamine substrate to the different nucleoapzymes and to rationalize the experimental catalytic performance of the nucleoapzymes in terms of their computed structures. The nucleoapzyme concept bridges homogenous catalysis with the binding properties of nucleic acids to yield catalysts operating in aqueous media.

KEYWORDS: DNA, Catalyst, Binding, Metal-Complex, Molecular Dynamics, Kinetic Model

INTRODUCTION Catalytic nucleic acids (DNAzymes or ribozymes) attract substantial recent research efforts as a new class of biocatalysts1,2. Many different catalytic nucleic acids were reported, including


2

Page 3 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

DNAzymes mimicking native enzymes such as horseradish peroxidase3–5 and DNAzymes that stimulate ligation6, carbon-carbon bond formation7, Michael addition and Diels-Alder reactions8,9, phosphorylation of organic molecules10 and oxidation of organic substrates11 were reported. Despite the progress in developing catalytic nucleic acids, their catalytic performance is limited as compared to native enzymes. The lack of substrate binding sites that concentrate the substrates at the catalytic sites, besides the hybridization of oligonucleotide substrates that bind to different DNAzyme scaffolds, is one of the reasons for the limited activities of DNAzymes. A different approach to construct catalytic nucleic acids has involved the modification of the nucleic acid scaffolds with metal ions12,13 or metal-ion-ligand complexes13,14. Different catalyzed processes and chiro-selective reactions such as Michael addition, FriedelCrafts and Diels-Alder processes were driven by these systems15–20. Although these metal-ion complex/nucleic acid scaffolds were successfully applied for chiro-selective synthesis, the catalytic turnovers were limited due to inefficient binding of the reaction substrates to the catalysts. Aptamers are sequence-specific nucleic acids that bind low-molecular-weight substrates or macromolecules21–24. Recently we introduced a new concept to design nucleic acidbased catalysts that was termed by us “Nucleoapzyme”. Following to this concept, a catalytic site is conjugated to a sequence-specific nucleic acid exhibiting specific binding properties to a substrate (aptamer) to yield a hybrid structure that concentrates the reaction-substrate in close proximity to the catalytic site. That is, the “nucleoapzyme” mimics the selective binding site properties and the catalytic site functionalities of native enzymes25. Specifically, this concept was successfully applied to develop a dopamine oxidizing nucleoapzyme and an N-hydroxyarginine oxidizing nucleoapzyme by the conjugation of the hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme to the dopamine binding aptamer (DBA) or arginine binding aptamer


3

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 30

sequences26,27. The uniqueness of this approach rests on the diversity of possible nucleoapzymes that can be synthesized by the conjugation of the DNAzyme catalytic units at the 3’- or 5’-ends of the binding aptamer unit, by the insertion of the DNAzyme in between the aptamer sub-units, and by the insertion of arbitrary oligonucleotides between the DNAzyme units and the aptamer to yield enhanced flexibility or rigidity28 in the nucleoapzyme structure. Indeed, we have demonstrated the synthesis of a set of nucleoapzymes that revealed variable catalytic enhancement properties as compared to the separated hemin/G-quadruplex catalytic unit and aptamer sequence. Furthermore, we were able to rationalize the catalytic function-structure relationships of the different nucleoapzymes by molecular dynamics simulations. The scope of the nucleoapzyme concept can be, however, substantially extended by conjugating catalytic transition metal-ion complexes, acting as catalysts, to aptamer units to yield metal-complex/aptamer nucleoapzymes. The different possible structures of the metal-ioncomplex/aptamer nucleoapzyme structures would allow the evaluation of structure/catalytic function relationships in the different systems. Furthermore, the conjugation of homogeneous catalysts to aptamer binding sequences might lead to a rich arsenal of catalytic nucleic acids exhibiting selective binding of the substrate in spatial proximity to the catalytic site. Such nucleoapzymes would provide a new method to bridge homogeneous catalysis and the recognition properties of nucleic acids to yield a new class of enzyme-mimicking catalysts operating in aqueous media. Figure 1 outlines this concept by introducing a nucleoapzyme hybrid consisting of a transition metal complex that is linked to the anti-dopamine aptamer and is designed to catalyze the oxidation of dopamine to aminochrome by H2O2. Here we report on the superior catalytic functions of the Cu2+-terpyridine(Tpy)-dopamine binding aptamer conjugate, and of the Fe3+-terpyridine-dopamine binding aptamer, nucleoapzymes acting as effective


4

Page 5 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

catalysts for the oxidation of dopamine to aminochrome by H2O2. These nucleoapzymes mimic the functions of catechol oxidase29,30. We examine different isomers of the nucleoapzymes, and we correlate between the experimental catalytic functions of the systems and the structural features of the different metal-complex-aptamer conjugates predicted by molecular dynamics simulations. We wish to emphasize the difference between the nucleoapzyme concept and the previously reported methods that linked metal-ion complexes to nucleic acid scaffolds to yield functional catalysts13-21. In contrast to the previous methods that used the nucleic acid as a chiral scaffold or carrier of the metal-ion complex for operation in an aqueous environment, our approach couples between the binding functions of the aptamer units and the catalytic properties of the metal-ion complexes to yield hybrids that reveal structurally-controlled catalytic activities. RESULTS AND DISCUSSION Figure 2A depicts the different configurations of the Cu2+-terpyridine-aptamer conjugates (nucleoapzymes) that were investigated toward the catalyzed oxidation of dopamine by H2O2 to form aminochrome as shown in Figure 2B. In configurations I and II, the Cu2+-terpyridine complex is linked to the 5’- and 3’-ends of the aptamer units. In configuration III, the Cu2+terpyridine catalyst is conjugated to the internal amino-modified thymine (T) site at position 24 (24T) of the aptamer. In configurations IV and V, a four-thymine sequence (4xT) is inserted into the conjugates, I and II, consisting of the Cu2+-terpyridine catalyst that modifies the 5’ or 3’-ends of the aptamer, respectively. Figure 3 depicts the rates of the H2O2-driven oxidation of dopamine to aminochrome using the different nucleoapzymes (configurations (I) – (V)) as catalysts. For comparison, a control experiment that examined the H2O2-mediated oxidation of dopamine by the separated Cu2+-terpyridine and aptamer unit was examined, curve (g). Under similar conditions described for the nucleoapzymes I-V (concentration range of dopamine 1-1000 µM),


5

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 30

very inefficient oxidation of the substrate occurred in that case. The rates of oxidation of dopamine by H2O2, using the different nucleoapzymes reveal several important features: (i) All the Cu2+-terpyridine/aptamer conjugates show enhanced rates toward the oxidation of dopamine, as compared to the separated catalyst/aptamer units. The oxidation rates of dopamine by the different nucleoapzymes are, however, very sensitive to the structures of the catalyst/aptamer configurations of the nucleoapzymes. The most effective Cu2+-terpyridine/aptamer conjugate is the nucleoapzyme (IV) that includes the (4xT) unit added sequence that separates the Cu2+terpyridine catalyst from the 5’-end of the aptamer. (ii) All of the nucleoapzymes show a saturation kinetics curves (a)-(e), consistent with the saturation of the aptamer binding site by dopamine. Accordingly, the catalyzed oxidation processes of dopamine by H2O2, in the presence of the different nucleoapzymes, were analyzed in terms of the Michaelis-Menten model, eq. 1, where v is the rate of substrate oxidation, [S] is the substrate concentrations and KM is the Michaelis-Menten constant (that corresponds to the substrate concentration at which v = 0.5·Vmax.

(. 1) = ∗

= ∗ + +

Table 1 summarizes the kinetic parameters corresponding to the different Cu2+-terpyridinedopamine binding aptamer nucleoapzymes towards the catalyzed oxidation of dopamine by H2O2 to form aminochrome. The nucleoapzyme (IV) reveals a KM value of KM = 59 ± 12 µM and has the highest catalytic activity corresponding to kcat = 40·10-4sec-1, which is 60-fold higher as compared to the separated Cu2+-terpyridine and dopamine binding aptamer units. Interestingly, the addition of the (4xT) tethers to the nucleoapzyme structures (IV) and (V) leads to enhanced activities as compared to nucleoapzymes (I) and (II), where the catalytic sites are directly conjugated to the 5’- and 3’-ends of the dopamine binding aptamer unit respectively, this is


6

Page 7 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

attributed to an increased flexibility of the catalytic site in respect to the substrate binding site, presumably leading to a better alignment between substrate binding site and catalytic site (vide infra). The conjugation of the catalytic site at the internal position of the aptamer, configuration (III), yields a nucleoapzyme of decreased activity, albeit higher than the separated Cu2+terpyridine and DBA units. Furthermore, we note that from the concentration of aminochrome generated by nucleoapzyme (IV) within a time – interval of 1 hour, and knowing the molar ratio of the nucleoapzyme: aminochrome, the catalyst was recycled 14 times. Also, we note that although previous studies31 reported on the oxidative cleavage of DNA by Cu2+- complexes in the presence of H2O2, we did not trace any damage to the aptamer unit by the Cu2+-terpyridine complex, within a time interval of 18 hours, Figure S1. Nonetheless, although we find a 60 - fold catalytic efficiency enhancement of nucleoapzyme (IV) as compared to the separated complex/aptamer constituents, the control experiments highlight an apparent catalytic activity of the Cu2+-terpyridine complex tethered to a nucleotide sequence composed of the scrambled bases of DBA. This catalytic activity is attributed to electrostatic attraction and π- π interactions of dopamine to the nucleic acid sequence. Thus, the enhanced catalytic functions of (IV) might be attributed to the specific binding of dopamine to the aptamer’s binding site and to cooperative non-specific binding of dopamine to the nucleic acid bases. Several additional experiments were performed to understand the activities of the Cu2+terpyridine-DBA conjugates: (i) Previous studies have identified the nucleotide bases in the DBA domain that are required for the binding of dopamine26,32. Accordingly, the binding residues were substituted with thymine units that yielded the nucleoapzyme (Ia). This nucleoapzyme revealed a lower binding affinity toward dopamine and revealed 4-fold lower activity as compared to (IV) towards the oxidation of dopamine, Figure 3 curve (e) vs. curve (a). (ii) To


7

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 30

account for the contribution of the (4xT) elongated anti-dopamine aptamer sequence to the catalytic activities of the nucleoapzyme we examined the catalytic functions of: Cu2+-terpyridine conjugated to a four-base mutated aptamer, (Ia), and Cu2+-terpyridine conjugated to a nucleic acid composed of a scrambled sequence of the dopamine binding aptamer nucleotides, (Ib). We find that the rates are of identical, and similar to the rates of oxidation of dopamine by (Ia) or (Ib). One may realize that hybrids (Ia) and (Ib) exhibit an “apparent” (although small) catalytic activity towards the oxidation of dopamine to aminochrome by H2O2, when compared to the rate of oxidation of the separated complex/aptamer units, e.g. Figure 3 curve (g). This rate enhancement by non-aptamer strands is attributed to the non-specific electrostatic attraction of dopamine to the nucleic acid strands that leads to the inefficient concentration of dopamine in close proximity to metal-ion complex that catalyzes the reaction. (iii) Fluorescence anisotropy measurements demonstrate that the dissociation constants corresponding to the complex between the dopamine the nucleoapzyme I-V are very similar (Kd = 0.5 ± 0.2 µM, where Kd = 1/Ka). An example depicting the fluorescence anisotropy changes as a function nucleoapzyme concentrations for nucleoapzyme IV (highest catalytic activity is depicted in Figure S2, curve (b). From this curve the binding constant Ka was calculated, and the respective Kd value was derived. For the nucleoapzymes I-V the fluorescence anisotropy changes as a function of nucleoapzyme concentrations were almost overlapping, thus supporting similar Kd values for the different nucleoapzymes. Table S1 summarizes Kd values corresponding to the different nucleoapzymes. The results imply that the binding affinities of dopamine to the different nucleoapzymes are very similar. The results indicate that despite the similar Kd values characterizing the nucleoapzymes I-V they differ significantly in their catalytic activities. This suggests that the catalytic differences originate from variations in the spatial positions of the


8

Page 9 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

bound dopamine in respect to the catalytic Cu2+-terpyridine site (vide infra). It should be noted that for all nucleoapzyme structures that include an aptamer binding site conjugated to its catalytic site, we find similar Kd values, yet variable KM values. As expected, the KM values of the nucleoapzymes decrease as catalytic functions increase. The only exception is observed for the structure composed of a scrambled sequence of the bases comprising the anti-dopamine aptamer, conjugated to the Cu2+-terpyridine catalyst (structure Ib, Table 1), where an “apparent” KM = 53 ± 13 µM is observed and a very low catalytic rate is observed. This structure lacks any confined binding site and only non-specific electrostatic binding of the dopamine to the nucleic acid scaffold occurs, and thus, the system cannot be analyzed in terms of the Michaelis-Menten model. To account for the different activities of the nucleoapzymes I-V we have applied docking and molecular dynamics simulations using the YASARA Structure software package. Previous studies have successfully applied this software for computational analysis of aptamer-ligand complexes.33 Figure 4 depicts the minimum energy structural features of the nucleoapzymes I-V. The Cu2+-terpyridine catalytic site is labeled with a magenta color. Each of these images represent the energetically stabilized configuration of the respective nucleoapzyme after a simulation time that equals to 500 psec, (a ten-fold longer simulation time-interval did not affect the minimum-energy configuration of the nucleoapzyme) where the depicted image corresponds to an average structure of twenty snapshots of the respective nucleoapzyme (for each of the structures, very small fluctuations of the catalytic site in respect to the aptamer binding site are observed, and thus the averaging process is important). The computational simulations reveal important common features: (i) In all of the nucleoapzyme structures I-V the opposite face of the dopamine binding aptamer is blocked and


9

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 30

allows access of the dopamine ligand only along the open face (see supporting information, Figure S3). (ii) For all nucleoapzyme structures the docking of dopamine to the aptamer yields minimum energy dopamine-aptamer complexes, where the dopamine ligand binds to an identical oligonucleotide pocket, a domain that includes the bases that were suggested to form the substrate binding site32. The computed dissociation constants for the nucleoapzymes I-V are very similar to the dissociation constant evaluated for dopamine to the free aptamer and was similar to the previously reported value of Kd = 0.7 µM.26 Realizing that the binding affinity of dopamine to the aptamer domains is not the source for the variable observed catalytic functions, we searched for other possible explanations for the experimental results. For each of the nucleoapzyme structures we evaluate the average distance separating the catalytic site from a fixed phosphate residue at the opening of the aptamer binding. (This spatial separation is indicated with an arrow.) We consider this spatial separation as an important parameter that controls the catalytic activities of the different nucleoapzymes. The most active nucleoapzyme IV yields a spatial separation between the catalytic site and binding site that corresponds to 24Å. Configuration I reveals a lower catalytic activity and the computed structure indicates a higher spatial separation between the active site and the binding site of 30 Å. That is, the four-thymine residue sequence, 4xT, linking the Cu2+-terpyridine catalyst to the sequence specific aptamer, introduces a favored flexibility into the nucleoapzyme structure that allows the improved spatial positioning of the catalyst with respect to the binding site. The nucleoapzymes II and V that include the Cu2+-catalytic site linked to the 3’-end of the aptamer reveal significantly lower activities as compared to the configurations I and IV. The computed structural models indicate substantially higher separation distances between the catalytic site and active site, 50 Å and 32 Å, respectively. We realize that the nucleoapzyme V that includes the four-thymine base bridge


10

Page 11 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

between the Cu2+-terpyridine catalytic site and the aptamer reveals slightly improved catalytic functions as compared to II. Again, this is attributed to the flexibility of the bridging units that allows a spatially shorter distance between the catalytic and binding sites, as reflected by the computed structures. Finally, for the least active nucleoapzyme, III, that includes the Cu2+terpyridine catalytic site linked to an in-chain thymine position associated with the aptamer, the molecular dynamics simulations suggest the Cu2+-terpyridine complex intercalates into the aptamer double strand region which yields a hindered, presumably unfavorable configuration to catalyze the oxidation of dopamine associated with the dopamine binding site. It should be noted that the mechanism of oxidation of dopamine by Cu2+-terpyridine catalyst is mechanistically complex34 and does not essentially require intimate contact between the active site and the binding site. This is the rationale to correlate the average distance separating the catalytic site and binding site as the parameters that control the catalytic activities of the different nucleoapzymes. Nonetheless, the molecular dynamic simulations allow us to evaluate the frequency of events at which the distance separating the catalytic site and the binding site is shorter than 7Å, we find the frequency of proximity events correlates with the average distances of the minimized-energy structures separating the catalytic site and binding site (see Table S3, supporting information). Realizing that the conjugation of the catalytic site to the 5’- and 3’-ends of the dopamine binding aptamer through the 4xT flexible chain yields superior nucleoapzymes, we tried to expand the versatility of the nucleoapzyme concept. Accordingly, we studied the application of different metal-ion terpyridine complexes linked to 3’-end and 5’-end of the dopamine binding aptamer through a flexible 4T-linker towards the H2O2-mediated catalyzed oxidation of dopamine. We find that Co2+-, Ni2+-, Pd2+-terpyridine complexes did not catalyze the oxidation


11

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 30

process. We did find, however, that Fe3+-terpyridine and its derived nucleoapzymes act as effective catalysts for the oxidation of dopamine by H2O2. The Fe3+-terpyridine complex was covalently linked to the 3’- and 5’-amine-terminated DBA aptamers, using a flexible 4xT tether, to yield the Fe3+-terpyridine-dopamine binding aptamer nucleoapzyme structures, (X) and (XI), respectively, Figure 5A. The rates of the oxidation of dopamine by H2O2 of the two nucleoapzymes in the presence of variable concentrations of dopamine are depicted in Figure 5B, curves (a) and (b), respectively. These rates are compared to the rates of oxidation of dopamine by the Fe3+-terpyridine catalytic site tethered to 5’-end nucleic acid sequence that includes mutations of four bases associated with the dopamine binding site within the aptamer, configuration XIa, curve (c), and the Fe3+-terpyridine catalytic site tethered to the 5’-end of a nucleic acid sequence composed of the scrambled bases associated with the DBA, XIb, curve (d). Also, the rates of oxidation of dopamine by H2O2 in the presence of the separated Fe3+terpyridine catalyst and the DBA, in the presence of variable concentrations of dopamine, XII, are presented in Figure 5B, curve (e). Evidently the two nucleoapzymes X and XI reveal substantially higher rates toward the oxidation of dopamine by H2O2, as compared to the separated Fe3+-terpyridine catalyst and the DBA, suggesting that the concentration of the dopamine by the aptamer in close proximity to the catalytic site leads to the efficient catalyzed oxidation of dopamine to aminochrome. The significance of the binding of the dopamine substrate to the aptamer, that results in the effective oxidation of dopamine is further supported by the very inefficient oxidation of dopamine by H2O2 using the mutated aptamer, XIa, and the scrambled aptamer sequence, XIb, curves (c) and (d), respectively. The later sequences lack specific binding affinity towards the substrate, leading to inefficient concentration of the substrate in respect to the catalytic site. Note, however, that the structures XIa and XIb reveal


12

Page 13 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

some catalytic functions compared to the catalyzed oxidation of dopamine by the separated catalyst/aptamer system, XII. This inefficient catalyzed oxidation of dopamine by XIa and XIb is attributed to the non-specific association of the dopamine to the nucleic acid sequence via electrostatic attraction or π - π interactions. The two nucleoapzymes, X and XI, reveal a ca. 140-fold and 95-fold catalytic rate enhancement, as compared to the separated Fe3+-terpyridine-dopamine binding aptamer system (267·10-1 (nM·sec-1), 200·10-1 (nM·sec-1), and 1.3·10-1(nM·sec-1), respectively). Fluorescence anisotropy measurements indicate that dissociation constants of the nucleoapzyme and X nucleoapzyme XI are very similar to the dissociation constant of dopamine to the free dopamine binding aptamer, Kd = 0.5 ± 0.2 µM and Kd = 0.5 ± 0.1 µM respectively. These values are, also, very similar to the dissociation constants of the complexes between dopamine and the Cu2+terpyridine-dopamine binding aptamer nucleoapzymes. While the oxidation of dopamine by the separated Fe3+-terpyridine and aptamer reveal a pseudo first-order kinetics, k = 1.3·10-1(sec-1), the oxidation of dopamine by H2O2 in the presence of the nucleoapzymes show saturation kinetics consistent with the saturation of the aptamer binding site by dopamine.

Table 2

summarizes the kinetic parameters corresponding to the catalyzed oxidation processes driven by the nucleoapzyme X and XI, and the separated catalyst/aptamer units.

The nucleoapzyme

denoted as X reveals kcat = 267·10-4 (sec-1) and KM = 33 ± 12 µM values, whereas nucleoapzyme XI exhibits kcat = 200·10-4 (sec-1) and KM = 39 ± 18 µM values. Assuming that the substitution of the Cu2+ with Fe3+ does not significantly change the structure of the nucleoapzyme, we can conclude that the catalytic site in nucleoapzymes X and XI is a substantially more active catalyst toward the oxidation of dopamine by H2O2 (see Figure S4). Thus, the catalytic functions of the


13

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 30

nucleoapzyme are not only controlled by structural features, but, also by the nature of the metalions comprising the complexes.

CONCLUSIONS The present study has introduced a new concept to construct nucleoapzymes composed of catalytic metal-ion complexes conjugated to nucleic acids exhibiting specific binding properties for the reaction substrate. This concept expands other approaches to modulate the catalytic functions of nanoscale ensembles via the concentration of the substrate, such as the design of the intermolecular interaction outside the active site35, the conjugation of bio catalysts to auxiliary polymer

matrices36

and

the

interaction

of

enzymes

with

monolayer-functionalized

nanoparticles37. The study has highlighted several important results: (i) The hybrid nucleoapzyme can be generated by linking the catalytic metal-ion complex to different endpositions or internal sites associated with the aptamer sequence. The catalytic features of the resulting hybrid nucleoapzyme are controlled by the structures of the catalyst-aptamer conjugate. This established the diversity of potential catalysts. (ii) Different metal-ion complexes can be applied for the design of the nucleoapzymes. In the present study we have introduced two different complexes, e.g. the Cu2+-terpyridine and the Fe3+-terpyridine complex that were linked to the dopamine binding aptamer to yield catalytically-active nucleoapzymes mimicking catechol oxidase. In principle, this allows the application of other metal-complexes for designing


14

Page 15 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

nucleoapzymes for other chemical transformations. (iii) Molecular dynamics simulations were successfully applied to rationalize the different catalytic activities of the nucleoapzymes, and to establish structure-function relationships within this new class of catalysts. Beyond the novelty of introducing metal-complex/aptamer catalysts for the oxidation of dopamine, we believe that the nucleoapzyme approach has a substantially broader scope in catalysis. By using other nucleoapzymes consisting of metal-ion complexes conjugated to aptamers that bind substrates for other catalytic reactions, such as hydrogenation, hydrolysis, isomerization, nucleophilic substitution and cyclo-additions, e.g., Diels-Alder reaction, other nucleoapzyme-driven processes may be accomplished. In fact, preliminary results indicate that nucleoapzymes composed of metal-ion complexes/aptamer conjugation act as catalysts for the hydrolysis of esters and ATP.

EXPERIMENTAL SECTION Aptamer sequences The following nucleic acid sequences were used in the study (from Integrated DNA Technologies (IDT)) for preparing the Cu2+-terpyridine-DBA and Fe3+-terpyridine-DBA nucleoapzymes. In the sequences above, the DBA is presented in bold, spacers are in italic, and nucleotides participating in dopamine binding are underlined.

DBA:


15

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 30

5'-GTCTCTGTGTGCGCCAGAGACACTGGGGCAGATATGGGCCAGCACAGAAT GAGGCCC-3' Amino-DBA for 5’ linked Cu2+-terpyridine, Nucleoapzyme I: 5'-NH2-GTCTCTGTGTGCGCCAGAGACACTGGGGCAGATATGGGCCAGCACAG AATGAGGCCC -3' Amino-DBA for 3’ linked Cu2+-terpyridine, Nucleoapzyme II: 5'-GTCTCTGTGTGCGCCAGAGACACTGGGGCAGATATGGGCCAGCACAGAAT GAGGCCC-NH2-3' Amino-DBA for 24T-linked Cu2+-terpyridine, Nucleoapzyme III: 5'-GTCTCTGTGTGCGCCAGAGACACT-NH2-GGGGCAGATATGGGCCAGCACAG AATGAGGCCC-3' Amino-DBA for 5’-4xT-linked Cu2+-terpyridine, Nucleoapzyme IV and 5’-4xT-linked Fe3+terpyridine, Nucleoapzyme X. 5'-NH2-TTTT-GTCTCTGTGTGCGCCAGAGACACTGGGGCAGATATGGGCCAGCA CAGAATGAGGCCC-3' Amino-DBA for 3’-4xT-linked Cu2+-terpyridine, Nucleoapzyme V, and 3’-4xT-linked Fe3+terpyridine, Nucleoapzyme XI. 5'-GTCTCTGTGTGCGCCAGAGACACTGGGGCAGATATGGGCCAGCACAGAAT GAGGCCC-TTTT-NH2-3'


16

Page 17 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Mutated Amino- “DBA” for 5’-linked Cu2+-terpyridine, Nucleoapzyme Ia, and 5’-linked Fe3+terpyridine, Nucleoapzyme XIa. 5'-NH2-GTCTCTGTGTGCTTCAGAGACACTGGGGCAGATATGGGCCTGCACAGA ATTTGGCCC-3' Scrambled Amino- “DBA” for 5’-linked Cu2+-terpyridine, Nucleoapzyme Ib, and 5’-linked Fe3+terpyridine, Nucleoapzyme XIb. 5'-NH2-CGGTAGCTGGCGCGAGTGAGGCAGACGTCCGATGAACCCTGTACTGAGCC GAACTGA-3' Preparation of the Cu2+-terpyridine and Fe3+-terpyridine nucleoapzymes The carboxylic acid modified Cu2+-terpyridine and Fe3+-terpyridine complexes were prepared according to literature38, using 2,2':6',2''-Terpyridine-4'-carboxylic acid as a ligand (Alfa Aesar). The nucleoapzymes were prepared by reacting the Mn+-terpyridine complexes (200 µM) in 10 mM MES buffer solution pH 5.5, that included 5 mM 1-ethyl-3-(3-dimethylaminopropyl carbodiimide (EDC) and 5 mM N-hydroxysulfosuccinimide (NHS) and the mixture was incubated for a time interval of 30 minutes. To the solution, an equal volume of the amino modified nucleic acid sequence, 14 µM, in 100 mM phosphate buffer, pH 7.2 was added. The reaction mixture was allowed to react at 4 oC for 14 hours. The resulting mixture was washed four times using Amicon-Ultra Ultracel filters. The resulting complexes were characterized by ES-MS and the ratio of metal-ion complex to aptamer was evaluated by absorption spectroscopy. (For details on these experiments see supporting information Figure S5, Table S2).


17

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 30

Evaluation of the dissociation constants of the dopamine binding nucleoapzymes (or aptamer) complexes A 40 µM stock solution of the respective nucleoapzyme in 5 mM MES pH 5.5, 5 mM MgCl2, 100 mM NaCl was prepared. 15 aliquots of 6 µL each were added to a 100nM dopamine solution in a 1 ml quartz cuvette at 10-minute time intervals. The fluorescence anisotropy intensity of dopamine, λex=283 nm, λem=315 nm, was recorded at 25 oC (Perkin-Elmer LS55 Fluorimeter) and the data were fitted to eq. 2. ∗ (. 2) = + ∆ ∗ 1 + ∗ Where R is measured anisotropy, ∆R is the change in anisotropy from R0 representing free dopamine (no aptamer in solution) to DBA in solution. [DBA] is the aptamer concentration is solution, Ka is the association constant (=1/Kd) and n is the Hill coefficient (for the dopamine binding aptamer n=1).

Kinetics measurements Kinetic measurements were performed at 25 oC using a Biotek Synergy H1 microplate reader, equipped with a Biotek dual dispensing unit, and using Corning 3696 96 well plates. The nucleoapzymes (Cu2+-terpyridine or Fe3+-terpyridine) were dissolved in 5 mM MES pH 5.5, 5 mM MgCl2, 100 mM NaCl, and 10 µL of dopamine, consisting of variable concentrations which were added to the respective wells. The time-dependent absorbance of the product was measured in the range of 480 to 800 nm and monitored for 30 minutes. Subsequently, 10 µL of H2O2 (final conc. 1 mM) were dispensed into each well, and the absorbance values were measured in the


18

Page 19 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

different wells for a time interval of 60 minutes. The experimental data were linearly plotted using Origin Pro 8.5 to evaluate V0. Subsequently, the V0 vs. dopamine concentrations curves were fitted to eq. 1.

Figure 1. Schematic configuration of a nucleoapzyme consisting of a homogenous transition metal complex, acting as catalytic site, conjugated to an aptamer binding site. The nucleoapzyme concept is exemplified with the assembly of metal-ion complex (Mn+ = CuII, FeIII) conjugated to the anti-dopamine aptamer. The nucleoapzyme catalyses the oxidation of dopamine to aminochrome by H2O2.


19

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 30

Figure 2. (A) Schematic representation of the different Cu2+-terpyridine-dopamine binding aptamer conjugates (I-V) acting as nucleoapzymes for the oxidation of dopamine. Structure VI represents the non-modified dopamine binding aptamer. (B) The nucleoapzyme-driven oxidation of dopamine to aminochrome by H2O2.


20

Page 21 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Figure 3. Rates of dopamine oxidation to aminochrome by H2O2, in the presence of different concentrations of dopamine, using the different nucleoapzymes, separated catalyst/aptamer system and other control systems. (a) Nucleoapzyme IV, (b) Nucleoapzyme I, (c) Nucleoapzyme V, (d) Nucleoapzyme II, (e) Nucleoapzyme Ia, consisting of the Cu2+-terpyridine complex linked to a mutated anti-dopamine aptamer (f) Nucleoapzyme III, (g) Separated Cu2+-terpyridine complex and the dopamine binding aptamer. All experiments were performed in a 5 mM MES buffer solution, pH=5.5, that included 5 mM MgCl2, 100 mM NaCl and the nucleoapzyme or separated components, 1 µM, and H2O2 1 mM.


21

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 30

Figure 4. Examples of the simulated structures of the different Cu2+-terpyridine-dopamine binding aptamer. The Cu2+-terpyridine complex is coloured in magenta, the dopamine substrate is coloured yellow and the added 4xT sequence is coloured in green. The arrow indicates the distances between the Cu2+-terpyridine complex and a fixed phosphate group associated with a guanine base present in the opening of the aptamer binding site. Panel insert shows the enlarged structure of the dopamine binding aptamer in nucleoapzyme IV.


22

Page 23 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Figure 5. (A) The catalyzed oxidation of dopamine to aminochrome by H2O2 by the Fe3+terpyridine nucleic acid conjugates and the schematic structures of the Fe3+-terpyridine-DBA nucleoapzymes X and XI, and the reference system composed of the separated nucleoapzyme


23

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 30

components. (B) Rates of dopamine oxidation to aminochrome by H2O2, in the presence of different concentrations of dopamine, using the different 4xT nucleoapzymes and separated catalyst/aptamer system. (a) 5’ 4xT Fe3+-terpyridine nucleoapzyme, X (b) 3’ 4xT Fe3+terpyridine nucleoapzyme, XI (c) Separated Fe3+-terpyridine complex and the dopamine binding aptamer, XII. All experiments were performed in a 5 mM MES buffer solution, pH=5.5, that included 5 mM MgCl2, 100 mM NaCl and the nucleoapzyme, 1 µM, and H2O2 1mM. (C) Molecular dynamics simulation structures of the nucleoapzymes X and XI. The dopamine substrate is colored yellow, the Fe3+-terpyridine complex marked in magenta, and the 4xT domain is marked in green.

Table 1. Kinetic parameters of the different Cu2+-terpyridine-DBA nucleoapzymes with respect to the oxidation of dopamine to aminochrome.a Nucleoapzyme

Vmax·10-1 (nM·sec-1)

KM (µM)

kcat·10-4 (sec-1)

kcat/KM ( s-1·M-1)

IV-5’(4T) conjugate

40 ± 4

59 ± 13

40

67

V-3’(4T) conjugate

25 ± 2

45 ± 15

25

56

I-5' conjugate

24 ± 3

59 ± 21

24

40

II-3' conjugate

25 ± 1

83 ± 12

25

30

III-T (24) conjugate

9±1

71 ± 30

9

13

Ia-Mutant

15 ± 2

96 ± 28

15

19

Ib-Scrambled

11 ± 1

53 ± 13

11

16

Sep. Cu2+-Tpy-DBAb

0.6

-

0.6

-

a

All experiments performed in a 5 mM MES buffer solution, pH=5.5, that included MgCl2 5 mM, NaCl 100 mM and using 1 µM of the respective nucleoapzyme or control catalyst and 500 µM H2O2. b The separated Cu2+-terpyridine DBA system shows a pseudo first-order kinetics k = 0.6·10-4 sec-1.


24

Page 25 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Table 2. Kinetic parameters of the different Fe3+-terpyridine-dopamine binding aptamer nucleoapzymes with respect to the oxidation of dopamine to aminochrome.a Nucleoapzyme

Vmax·10-1 (nM·sec-1)

KM (µM)

kcat·10-4 (sec-1)

kcat/KM ( s-1·M-1)

X-5’(4T) conjugate

267 ± 2

33 ± 12

267

809

XI-3’(4T) conjugate

200 ± 3

39 ± 18

200

512

XIa- Mutant

77 ± 16

38 ± 5

77

202

XIb- Scrambled

60 ± 5

45 ± 15

60

133

XII- Sep. Fe3+-Tpy-DBAb

1.3

-

1.3

-

a

All experiments performed in a 5 mM MES buffer solution, pH=5.5, that include MgCl2 5 mM, NaCl 100 mM, and using 1 µM of the respective nucleoapzyme or control catalyst and 500 µM H2O2. b The separated Fe3+-terpyridine DBA system shows a pseudo first-order kinetics k = 1.3·10-4 sec-1.

AUTHOR INFORMATION Corresponding Author *E-mail: [email protected]. Tel: 972-2-6585272. Fax: 972-2-6527715. ASSOCIATED CONTENT Supporting Information. Gel electrophoresis; resistance of nuleoapzymes to Cu2+ oxidative cleavage, Fluorescence anisotropy figure, kd results, Molecular Dynamic simulation figure, Measurement of ratio between catalyst and aptamer units, Kinetics comparison between Cu2+terpyridine conjugated DBA and Fe3+-terpyridine conjugated DBA, ICP-MS results for nucleoapzymes.


25

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 30

ACKNOWLEDGMENT This research is supported by the Minerva Center for Complex Bio-hybrid Systems.

REFERENCES (1) (2)

Silverman, S. K. Acc. Chem. Res. 2009, 42, 1521-1531. (a) Breaker R. R.; Joyce G. F. Chem. Biol. 1994, 1, 223-229. (b) Silverman, S. K.

Trends Biochem. Sci., 2016, 41, 595-609. (3)

Sen, D.; Poon, L. C. H. Crit. Rev. Biochem. Mol. Biol. 2011, 46, 478-492.

(4)

Pavlov, V.; Xiao, Y.; Gill, R.; Dishon, A.; Kotler, M.; Willner, I. Anal. Chem. 2004, 76,

2152-2156. (5) Golub E.; Lu C. H.; Willner I. J. Porph. Phtal. 2015, 19, 65-91. (6)

Sreedhara, A.; Li, Y.; Breaker, R. R. J. Am. Chem. Soc. 2004, 126, 3454-3460.

(7)

Boersma, A. J.; Megens, R. P.; Feringa, B. L.; Roelfes, G. Chem. Soc. Rev. 2010, 39,

2083-2092. (8)

Wilking, M.; Hennecke, U. Org. Biomol. Chem. 2013, 11, 6940-6945.

(9)

Megens, R. P.; Roelfes, G. Chem. Commun. 2012, 48, 6366-6368.

(10) Walsh, S. M.; Sachdeva, A.; Silverman, S. K. J. Am. Chem. Soc. 2013, 135, 1492814931. (11) Travascio, P.; Li, Y.; Sen, D. Chem. Biol. 1998, 5, 505-517.


26

Page 27 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

(12) Fournier, P.; Fiammengo, R.; Jäschke, A. Angew. Chem. Int. Ed. 2009, 48, 4426-4429. (13) Oelerich, J.; Roelfes, G. Chem. Sci. 2013, 4, 2013-2017. (14) Boersma, A. J.; de Bruin, B.; Feringa, B. L.; Roelfes, G. Chem. Commun. 2012, 48, 2394-2396. (15) Caprioara, M.; Fiammengo, R.; Engeser, M.; Jäschke, A. Chem. - A Eur. J. 2007, 13, 2089-2095. (16) Ropartz, L.; Meeuwenoord, N. J.; van der Marel, G. A.; van Leeuwen, P. W. N. M.; Slawin, A. M. Z.; Kamer, P. C. J. Chem. Commun. 2007, 15, 1556-1558. (17) Park, S.; Zheng, L.; Kumakiri, S.; Sakashita, S.; Otomo, H.; Ikehata, K.; Sugiyama, H. ACS Catal. 2014, 4, 4070-4073. (18) Roelfes, G.; Feringa, B. L. Angew. Chem. Int. Ed. 2005, 44, 3230-3232. (19) Coquiere, D.; Feringa, B. L.; Roelfes, G. Angew. Chem. Int. Ed. 2007, 46, 9308-9311. (20) Boersma, A. J.; Feringa, B. L.; Roelfes, G. Angew. Chem. Int. Ed. 2009, 48, 3346-3348. (21) Tuerk, C.; Gold, L. Science. 1990, 249, 505-510. (22) Ellington, A. D.; Szostak, J. W. Nature 1990, 346, 818-822. (23) Osborne, S. E.; Ellington, A. D. Chem. Rev. 1997, 97, 349-370. (24) Willner, I.; Zayats, M. Angew. Chem. Int. Ed. 2007, 46, 6408-6418. (25) Golub, E.; Albada, H. B.; Liao, W. C.; Biniuri, Y.; Willner, I. J. Am. Chem. Soc. 2016, 138, 164-172.


27

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 30

(26) Walsh, R.; DeRosa, M. C. Biochem. Biophys. Res. Commun. 2009, 388, 732-735. (27) Napolitano, A.; Crescenzi, O.; Pezzella, A.; Prota, G. J. Med. Chem. 1995, 38, 917-922. (28) Albada, H. B.; Golub, E.; Willner, I. Chem. Sci. 2016, 7, 3092-3101. (29) Gerdemann, C.; Eicken, C.; Krebs, B. Acc. Chem. Res. 2002, 35, 183-191. (30) Koval, I. A.; Gamez, P.; Belle, C.; Selmeczi, K.; Reedijk, J. Chem. Soc. Rev. 2006, 35, 814-840. (31) Uma, V.; Kanthimathi, M.; Weyhermuller, T.; Nair, B. U. J. Inorg. Biochem. 2005, 99, 2299-2307. (32) Mannironi, C.; Di Nardo, A.; Fruscoloni, P.; Tochini-Valentini, G. P. Biochem., 1997, 36, 9726-9734. (33) Albada, H. B.; Golub, E.; Willner, I. J. Comput. Aided. Mol. Des. 2015, 29, 643-654. (34) Richter, H. W.; Waddell, W. H. J. Am. Chem. Soc. 1983, 105, 5434–5440. (35) Gao, Y.; Roberts, C. C.; Zhu, J.; Lin, J. L.; Chang, C. E. A.; Wheeldon, I. ACS Catal. 2015, 5, 2149–2153. (36) Murata, H.; Cummings, C. S.; Koepsel, R. R.; Russell, A. J. Biomacromolecules 2014, 15, 2817–2823. (37) You, C. C.; Agasti, S. S.; De, M.; Knapp, M. J.; Rotello, V. M. J. Am. Chem. Soc. 2006, 128, 14612–14618.


28

Page 29 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

(38) Wałsa-Chorab, M.; Stefankiewicz, A. R.; Ciesielski, D.; Hnatejko, Z.; Kubicki, M.; Kłak, J.; Korabik, M. J.; Patroniak, V. Polyhedron 2011, 30, 730–737.

Cu2+-terpyridine or Fe3+-terpyridine dopamine binding aptamer conjugates, nucleoapzymes, act as a homogenous catechol-oxidase mimicking catalyst towards the oxidation of dopamine to aminochrome.


29

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

414x230mm (96 x 96 DPI)


Page 30 of 30

Aptamer Conjugates: Nucleoapzymes

Recommend Documents