AptazymeâGold Nanoparticle Sensor for Amplified Molecular Probing

Subscriber access provided by UNIV OF PITTSBURGH

Article

An Aptazyme-Gold Nanoparticle Sensor for Amplified Molecular Probing in Living Cells Yanjing Yang, Jin Huang, Xiaohai Yang, Ke Quan, He Wang, Le Ying, Nuli Xie, Min Ou, and Kemin Wang Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.6b00999 • Publication Date (Web): 11 May 2016 Downloaded from http://pubs.acs.org on May 15, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

An Aptazyme-Gold Nanoparticle Sensor for Amplified Molecular Probing in Living Cells Yanjing Yang, Jin Huang*, Xiaohai Yang, Ke Quan, He Wang, Le Ying, Nuli Xie, Min Ou, Kemin Wang*

State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Key Laboratory for Bio-Nanotechnology and Molecular Engineering of Hunan Province, Hunan University, Changsha 410082, P. R. China.

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT: To date, a few of DNAzyme-based sensors have been successfully developed in living cells, however, the intracellular aptazyme sensor has remained underdeveloped. Here, the first aptazyme sensor for amplified molecular probing in living cells is developed. A gold nanoparticle (AuNP) is modified with substrate strands hybridized to aptazyme strands. Only the target molecule can activate the aptazyme and then cleave and release the fluorophore labelled substrate strands from the AuNP, resulting in fluorescence enhancement. The process is repeated so that each copy of target can cleave multiplex fluorophore labelled substrate strands, amplifying the fluorescence signal. Results show that the detection limit is about 200 nM, which is 2 or 3 magnitude lower than that of the reported aptamer-based ATP sensors used in living cells. Furthermore, it is demonstrated that the aptazyme sensor can readily enter living cells and realize intracellular target detection.


Page 2 of 28

Page 3 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION

DNAzymes, which were first discovered in 1994 through a process called in vitro selection,1 are sequences of DNA with catalytic activity. Due to the merits of being easy to synthesize and functionalize, programmability, significant catalytic efficiency, and stability, DNAzymes have been converted into fluorescent,2-4 colorimetric,5-7 electrochemical,8,9 and electrochemiluminescent sensors.10,11 But the majority of these DNAzyme-based sensors are limited to the sensing of targets in extracellular environments, only with few demonstrated the application in living cells. Challenges include the delivery of DNAzyme into desired locations in cells and still maintaining the catalytic activity of DNAzyme strands in living cells. In 2013, the first gold nanoparticle (AuNP)-based DNAzyme probe in living cells was reported by Y. Lu and co-workers, who subsequently developed other two DNAzyme sensors for intracellular metal ions.12-14 After that, L. Zhang and co-workers demonstrated the strategy for imaging Pb2+ in living cells by using dendritic polymers as carriers.15 J. Zhu and co-workers designed a split DNAzyme nanodevice for multiplexed intracellular microRNA Imaging and logic operation.16 Recently, B. Tang and co-workers realized a two-color DNAzyme-modified gold nanoparticle probe for the simultaneous imaging of Zn2+ and Cu2+ in living cells.17 However, exploration of DNAzymes with intracellular analysis still remains at a very early stage. Up to now, only metal ions and nucleic acids were imaged in living cells by DNAzyme-based sensors. Aptamers, selected single-stranded oligonucleotides that have been shown to



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

recognize a broad range of targets including small molecules, metal ions, proteins, have several intrinsic properties including high affinity and selectivity, simple synthesis, and good stability.18 One elegant way of simultaneously exploiting aptamer and DNAzyme is the development of aptazyme technology, in which a DNA aptamer is connected to a DNAzyme in such a way that the DNAzyme can only be activated by the aptamer binding to the target analytes. Aptazymes, taking the advantages of both aptamers and DNAzymes, which can recognize specific targets with high selectivity and catalyze multiple-turnover reactions for signal amplification, respectively, have shown their great promise in many analytical applications.19-23 However, despite significant efforts in developing aptazyme based sensors, there is no report focusing on the method based on aptazyme technology for intracellular biological molecules detection and imaging. Herein we report the demonstration of an aptazyme-AuNP sensor for amplified molecular probing in living cells. Because adenosine triphosphate (ATP) aptamer has been well studied for its sequence, structure, configuration, and functions in past decades due to the significance of ATP in living system,24,25 ATP aptamer is selected to elucidate the feasibility of this principle. Thus, a well-characterized ATP-specific aptazyme strand,26-28 composed of Mg2+-dependent 10-23 DNAzyme29 and ATP aptamer, is used. As illustrated in Figure 1, a 13 nm AuNP is functionalized with 3’-fluorophore (TAMRA) labeled substrate strands, which are hybridized to 5’-quencher (BHQ-2) labeled ATP-specific aptazyme strands. Without target ATP, the aptazyme could not form a stable and active structure, and the fluorescence of the


Page 4 of 28

Page 5 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


fluorophore is quenched by both AuNP and molecular quencher. Once with the target ATP, the aptamer domain will bind to ATP and form a compact structure, which will activate the aptazyme by promoting the formation of the active secondary structure in the catalytic cores. The activated aptazyme can then cleave the fluorophore-labelled substrate strand, releasing the shorter fluorophore labeled DNA fragment. The active aptazyme can then bind to another substrate strand on the AuNP, causing the cleaving of another substrate strand. Thus, these cleaved fluorophore labeled DNA fragments are separated from both BHQ-2 and AuNP, resulting in fluorescence enhancement. During this cyclic process, a very small number of ATP molecules can initiate the cleavage of many fluorophore-labelled substrate strands from the AuNP surface, providing an amplified fluorescent signal for the target ATP.

Figure 1. The working mechanism of the aptazyme-AuNP Sensor.

EXPERIMENTAL SECTION



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Chemicals and Materials. Trisodium citrate was obtained from Sinopharm Chemical Reagent Co., Ltd. (China). Chloroauric acid (HAuCl4·4H2O) was obtained from Shanghai Chemical Reagent Company (Shanghai, China). oligomycin, ATP, cytidine triphosphate (CTP), guanosine triphosphate (GTP), and uridine triphosphate (UTP) were obtained from Sangon Biotech Co., Ltd. (Shanghai, China). DNA loading buffer was purchased from TaKaRa Bio Inc. (Dalian, China). SYBR Gold was purchased from Invitrogen (USA). Hela cells were obtained from Cell Bank of the Committee on Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). Other reagents from commercial suppliers were analytical grade and used without further purification. All aqueous solutions were prepared using ultrapure water (≥18 MΩ, Milli-Q, Millipore). All the oligonucleotides were synthesized and HPLC purified by Sangon Biotechnology Co., Ltd (Shanghai, China). The sequences of the oligonucleotides were described as follows: Aptazyme with BHQ-2: BHQ-2CATCTCTTCAGCGATCTAGGGGGAGTATTGCGGAGGATAGCACCCAT GTTA GTTGGTGAA; Aptazyme without BHQ-2: CATCTCTTCAGCGATCTAGGGGGAGTATTGCGGAGGATAGCACCCATGTTA GTTGGTGAA; Mismatched aptazyme: BHQ-2-CATCTCTTCAGCGATCTAGGGGGAGTAATGCCGAGGATAGCACCCA TGTTAGTTGGTGAA;


Page 6 of 28

Page 7 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Substrate: SH-A (10) TTCACCAACTATrAGGAAGAGATG-TAMRA. Apparatus. A JEM-2100 TEM (JEOL Ltd., Japan) was used to record the TEM images of AuNPs. The fluorescence spectra were obtained on a Hitachi F-7000 fluorescence

spectrometer

(Hitachi

Ltd.,

Japan).

A Biospec-nano

UV-vis

spectrophotometer (Japan) was used to measure the absorption spectra. The cells were visualized under an Olympus IX-70 inverted microscope with an Olympus FluoView 500 confocal scanning system. The intracellular concentrations of Au were determined by ICP-MS (Thermo Fisher, X Series II). A FEI Tecnai G2 Spirit was used to perform the cellular TEM images at an accelerating voltage 120 kV. Preparation of Gold Nanoparticle. The classical sodium citrate reduction method was used to prepare the 13 nm AuNPs.30 31 Briefly, 100 mL of 0.01% HAuCl4 was heated with vigorous stirring, when boiling 3.5 mL trisodium citrate (1%) was quickly added under stirring. Then the solution color was observed to turn from pale yellow to colorless and then deep red. Before allowed to cool down to room temperature, the system was refluxed for an additional 15 min. The prepared AuNPs solution was concentrated to 10nM by centrifugation. The sizes of the AuNPs were verified by TEM. Functionalization of AuNP with aptazymes and substrates. The thiolated substrate strands were reduced by Tris (2-carboxyethyl) phosphine hydrochloride (TCEP·HCl). After 1h, the substrate strands were mixed with aptazyme strands in PBS solution. Then the mixture was heated to 85 °C and maintained 10 min, slowly cooled down to room temperature, and stored in the dark for overnight to allow complete



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

hybridization. On the second day, the solution was added to the 13 nm AuNPs at a concentration of 2 µmol of oligonucleotide per 1 mL of 10nM AuNPs and shaken overnight. After 16 h, 0.2 M Phosphate buffer was added to the above solution to reach a 0.01 M Phosphate concentration. In the subsequent salt aging process, the NaCl concentration of the mixture was slowly increased to 0.3 M over an eight-hour period. Finally, the solution was centrifuged (13,000g, 30min) and washed three times with 0.01 M PBS containing 0.3 M NaCl. Concentrations of functionalized AuNPs were determined via the absorption of AuNPs. Calculation of substrates loading on AuNP. Based on the previous method, the substrate strands on surface of AuNPs were calculated.32 12 First, mercaptoethanol (ME) was brought to the sensor solution (2 nM) to achieve a final concentration of 20 mM. To obtain the released substrate strands, the mixture was incubated overnight with shaking at room temperature. After centrifugation, the fluorescence of the substrate strands was measured. The fluorescence of TAMRA labelled substrate was excited at 543 nm and measured at 580 nm. By comparing to a standard curve generated with the same conditions, the concentration of substrate strands was determined. In vitro detection of ATP. Aptazyme-AuNP was diluted to a concentration of 2 nM in 25 mM HEPES buffer (pH 7.4) containing 100 mM NaCl and 20mM MgCl2. A 95 µL aliquot of the above sample was transferred into the fluorometer thermostated at 37 °C. Then a 5 µL aliquot of concentrated ATP stock solution was added quickly before reading. The detection was recorded in kinetics mode. Control groups were


Page 8 of 28

Page 9 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


tested in a same manner. The excitation and emission were set at 543 nm and 580 nm respectively. For working range study, the fluorescence change was monitored for 5000 s with time intervals of 2 s. For comparative kinetic study of different modified ratio of substrate to aptazyme, the fluorescence change was monitored for 13000 s with time intervals of 2 s. For end-point method, the fluorescent spectra were recorded after the samples were incubated 5h, at 37 °C Selectivity test. Aptazyme-AuNP was concentrated to 2 nM in 25 mM HEPES buffer (pH 7.4) containing 100 mM NaCl and 20mM MgCl2. A certain concentration of ATP, CTP, GTP, and UTP stock solution was added to the Aptazyme -AuNP solution to reach a final concentration of 3mM, respectively. After 5 h incubation (37 °C), the fluorescence spectra of TAMRA were measured with appropriate excitation and emission wavelength. Nuclease Assay. Two groups of the aptazyme-AuNP were diluted to 2nM, and then 1.3 µL of DNase I was added to one of them to achieve a final concentration of 2 U/L. The other untreated group was served as control. The prepared two groups of solution were monitored for a period of 3600s. Cytotoxicity Assay. 96-well microtiter plates were used to culture HeLa cells (200µL, 1×105 cells·well−1) at 37°C for overnight. The original medium was discarded, and new media containing aptazyme-AuNP (0, 2, and 5 nM) was added into each well. After culture for 6, 12, 18, and 24 h respectively, the supernatant was removed and 0.1 mL of MTT solution (0.5 mg·mL−1 in PBS) was added with incubation at 37 °C for 4



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 28

h. The cells were washed, and DMSO (100 µL·well−1) was added. Finally, the mixture was shaken and measured at 490 nm with a microplate reader. Gel electrophoresis. A mixture solution (10 µL) containing 2 µM aptazyme, 2 µM substrate 25 mM HEPES (pH 7.4) and 100 mM NaCl was heated to 85 °C, maintained 10 min, then slowly cooled to room temperature before use. Aliquots of solution were incubated with 3 mM ATP in the presence or absence of MgCl2. The three analogues CTP, GTP, and UTP were also analyzed. The products were separated using 15% denaturing polyacrylamide gel for analysis. Cell Culture. Hela cells and SMMC-7721 cells were cultured in RPMI-1640 medium supplemented

with

10%

fetal

bovine

serum,

100

U/ml

1%

antibiotics

penicillin/streptomycin and incubated at 37 °C in a humidified atmosphere of 5% CO2 and 95% air. AuNPs uptake. To estimate the amount of aptazyme-AuNPs per cell, Hela cells and SMMC-7721 cells were seeded at 1×106/mL in a 6-well plate. After 24 h, cells were incubated with the aptazyme-AuNP (2 nM) for different time. Then cells were washed and trypsinized. The trypsinized cell dispersion was collected by centrifugation and further sonicated in a hot water bath (60 °C) to completely disrupt the cell membranes. Finally, the aptazyme-AuNPs were dissolved by successfully adding 0.3 mL hydrochloric acid and 0.1 mL nitric acid to the solution. After incubation overnight, the sample was diluted to 10 mL using ultrapure water. Based on the previous protocol,

33,34

the concentration of Au, determined by ICP-MS (Thermo Fisher, X

Series II), was converted to the number of aptazyme-AuNPs per cell.


Page 11 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Cellular TEM Image. According to our previous literature,31

35

HeLa cells were

incubated with 2 nM aptazyme-AuNPs for 4 h, and then were trypsinized. After that, the cells were fixed (2.5% glutaraldehyde and 1% osmic acid in PBS) and rinsed. Then, the cells were dehydrated in series of acetone (50, 70, 90, and 100%). After dehydration, a mixture of resin and ethanol (1:1) was added for 40 min, and then 100% resin was added to infiltrate into the cell pellet for overnight. 100% Epon-Araldite was used to infilter the cell pellet and then stored at 55 °C for 48 h. Finally, the sectioned samples (80 nm) were finally deposited on grids. To stain, 3% uranyl acetate and lead nitrate were used. A FEI Tecnai G2 Spirit was used to obtain the TEM images. Imaging intracellular ATP. Hela cells were plated on glass dishes and grown to 80% confluence before imaging. For comparative experiment, one of the groups was first treated with 5 µM calcimycin and PBS containing 20 mM Mg2+. After 30 min, all groups including untreated cells were incubated with 2 nM aptazyme-AuNP or mismatch aptazyme-AuNP at different times. After the incubation, the cells were washed three times with PBS (pH 7.4). The cells were observed under an Olympus IX-70 inverted microscope with an Olympus FluoView 500 confocal scanning system. TAMRA fluorescence image was recorded in red channel with 543 nm excitation and a 560 nm (±10 nm) bandpass filter. In the experiments for expression levels of ATP, one group of Hela cells was treated with 5 mM 2-deoxy-D-glucose and 10 µg/mL oligomycin for 30 min. Another group of Hela cells was treated with 5 mM Ca2+. One



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

group without regulation was served as control. Then all the cells were incubated with 2 nM aptazyme-AuNP for 5 h before imaging.

RESULTS AND DISCUSSION AuNPs with diameter of 13 nm were used for the nanocarrier because it has been reported that it is efficiently quenching fluorophores, easily modified oligonucleotides, and rarely scattering visible light.36,37 The preparation of 13 nm AuNP and aptazyme-AuNP were carried out and characterized (Figure S1). The TEM image and UV−vis absorption spectra indicated that the average size of 13 nm AuNPs and aptazyme-AuNP sensors were well prepared. The fluorescence quantification experiment showed that there were about 65 copies of substrate strands on each AuNP (Figure S2), and the controllable aptazyme strands could hybridize to those substrate strands. As shown in Figure 2, only the fluorophore-labeled substrate strand immobilized on AuNP showed relatively low fluorescent background. According to Nie’s previous report,38 the conformation of the fluorophore-labeled substrate strand immobilized on AuNP surface is an arch-like structure, in which both ends are attached to the particle but the DNA chain does not contact the surface. Thus, the fluorophore could be quenched by the AuNP with high-efficiency while the exposed oligo sequence is available for specific hybridization (I). If addition of aptazyme to the state (I), the aptazyme can bind to the substrate strand and destroy the arch-like structure, keeping the fluorophore away from the AuNP, resulting in partially fluorescence recovery (II).


Page 12 of 28

Page 13 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


In order to avoid the higher background from the state (II), we labeled the aptazyme with BHQ-2 quencher at the 5’ end. Even the aptazyme binds to the substrate strand, the fluorophore is still quenched by the BHQ-2 (III). In order to insure one target molecule can initiate the cleavage of multiplex substrate strands, we should keep excess substrate strands on AuNP comparing to aptazyme strands (IV). In this state, the combination of AuNP and BHQ-2 can effectively quench the fluorophore at both state (I) and state (III). We kept the number of substrate strands and changed the ratio of substrate to aptazyme strands, and then compared the signal-to-noise ratio, finally got the optimal 3:1 ratio (Figure S3). Further, the kinetics study showed that the excess substrate strands to aptazyme strands could induce higher signal turnover capability but lower reaction velocity, which indicates that the active aptazyme could be regenerated after catalyzing the cleavage reaction (Figure S4). Additionally, DNA hybridization, aptamer–ATP binding and aptazyme catalytic efficiency were affected by the concentration of Mg2+. Therefore, the appropriate Mg2+ concentration is the key factor in optimal performance. The result showed that the optimal concentration of Mg2+ was found to be 20 mM (Figure S5).



A Au

Au

Au

Au

I

II

III

IV

B 500

Fluorescence intensit(a.u)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 28

I II III IV

400

300

200

100

0 570

580

590

600

610

620

630

Wavelength(nm)

Figure 2. (A) Scheme of four different states of aptazyme-AuNP sensors: (I) only substrate strands are functionalized onto AuNP, (II) equal proportion of aptazyme and substrate strands are functionalized onto AuNP, (III) equal proportion of aptazyme modified with BHQ-2 and substrate strands are functionalized onto AuNP, (IV) BHQ-2 modified aptazyme strands and excess substrate are functionalized onto AuNP. (B) Fluorescent background of above four different states of aptazyme-AuNP sensors.

To our knowledge, most of the developed aptazyme (or DNAzyme) sensors are based on one aptazyme (or DNAzyme) strand to one substrate strand, which would limit the signal enhancement and sensitivity. In our design, it is possible to fulfill that one aptazyme strand can catalyze mutilplex substrate strands, maximizing the amplification effects. Figure 3A shows the catalytic steps of our aptazyme-AuNP sensor. Upon addition of target ATP, the aptamer region could bind to ATP and form a


Page 15 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


compact structure, which will activate the aptazyme by restoring the stem-loop structure of the aptazyme. The activated aptazyme strand can then look like walking scissors, which can cut the fluorophore-labeled substrate strands one after another, releasing numerous fluorophore depart from the AuNP and resulting in stronger fluorescence enhancement. This cyclic process results in an amplification effect whereby a very small number of ATP molecules can initiate the cleavage of many substrate strands. To demonstrate the signal amplification effect of the aptazyme-AuNP sensor with 3:1 substrate-to-aptazyme ratio on AuNP, we choose the aptazyme-AuNP sensor with 1:1 substrate-to-aptazyme ratio as a control. The curve and detection limit of the above two different sensors are compared by the end-point method. For the sensor with 3:1 substrate-to-aptazyme ratio, the signal enhancements dependent on the concentration of target ATP over the range from 500 nM to 3 mM are observed with the calculated detection limit to be 100 nM, which yields about 10-fold signal amplification than that of the sensor with 1:1 ratio (Figure S6). Meanwhile, time-dependent fluorescence enhancements arising from different concentrations of target ATP are measured in buffer solution. Figure 3B and Figure 3C show that the observed rate of fluorescence increase is accelerated with additional ATP, until saturation at about 3 mM ATP. The detection limit is determined to be 200 nM (3σ/slope) by measuring the initial velocity, which is similar to the end-point method (Figure S6) and about 2 or 3 magnitude lower than that of reported aptamer-based ATP sensors used in living cells.39,40 While the whole process will take a few hours to complete, for living cell application, we choose the end-point method



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

to investigate the sensing ability of our sensors. To validate the selectivity of the sensor for ATP, we prepared ATP and its analogues (CTP, UTP, and GTP) to test. As shown in Figure 3D, the target ATP led to the enhancement of the fluorescence of the sensor, while none of the tested analogues showed a significant change in fluorescence signal. Gel electrophoresis was also employed to confirm the activity and selectivity of the aptazyme-AuNP sensor. A larger extent of cleavage can be observed with addition of 3mM ATP, while little cleavage occurred when CTP, UTP, and GTP was added (Figure 4). It is evident that when binding to the ATP, the aptazyme strands are capable of cleaving the intended substrate strands in an Mg2+-dependent fashion and exhibit the specific cleavage ability. The excellent selectivity of aptazyme is similar to that of the ATP aptamer, and this result successfully facilitates the following ATP sensing in living cells.


Page 16 of 28

Page 17 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Scheme, sensitivity, and selectivity of the aptazyme-AuNP sensor. (A) Scheme of catalytic steps of the aptazyme-AuNP sensor. (B) Fluorescence increase of the sensor over time at different ATP concentrations. (C) Initial rate of fluorescence enhancement. (Inset) Linear response at ATP concentrations lower than 20 µM. The error bars represent the SD calculated from three independent experiments. (D) Response of the sensor to different analogues. The rate of fluorescence enhancement was measured in the presence of 3mM of ATP, UTP, GTP, CTP, respectively.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

substrate aptazyme Mg2+ ATP UTP CTP GTP

+ -

+ -

+ + + + -

+ + + + -

+ + + +

+ + + + -

Page 18 of 28

+ + + -

+ + + aptazyme

substrate

cleaved products

Figure 4. Gel electrophoresis image assay of the cleavage activity and selectivity of the aptazyme. A major cleavage band was observed only in the presence of ATP and Mg2+, which confirmed the cleavage activity and high selectivity of the aptazyme.

Applying the aptazyme-AuNP sensors in living cell, the bio-compatibility, stability and cellular uptake are required to be studied. Firstly, the cytotoxicity of the sensors was determined by MTT assay according to the literature protocol,41 which indicated that the sensors showed almost no cytotoxicity or side effects toward cells (Figure S7). Secondly, the nuclease stability of the sensors was investigated under physiological

condition

with

fluorescence

analysis.

Here,

the

enzyme

deoxyribonuclease I (DNase I) was used to evaluated the nuclease stability of the sensors. The results (Figure S8) showed that the introduction of DNase I did not lead to the obvious fluorescence enhancement of the sensors, suggesting their stability is excellent. Thirdly, to confirm the uptake of the sensors in Hela cells, an approach based on ICP-MS was employed. The results showed that the amounts of intracellular


Page 19 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


AuNPs were gradually increased with the incubation time until 3-4 h (Figure S9). In addition, the concentrations for AuNPs in these cells were estimate to be ~6.4×104 particles per cell. Such a high cytosolic concentration suggested a high internalization efficiency of the sensors in living cells, implying its potential for live cell detection. Furthermore, TEM imaging of the cells was performed to show a more precise localization of the sensors. It was observed that most particles resided in cytosol as individual particles (Figure S10). These above experiments confirmed that the aptazyme-AuNP sensor was an approving candidate to be applied in intracellular sensing. The in vitro response and efficient cytosolic delivery of the sensors provided us the possibility for fluorescent imaging of ATP in living cells. While for detection of ATP in cellular environments, it is important that the aptazyme- AuNP sensors can function efficiently under physiological Mg2+, as Mg2+ is an important cofactor to aptazyme. To investigate whether this sensor could be used for intracellular sensing of ATP at physiological conditions, we divided Hela cells into three groups. The group (A) was only incubated with the aptazyme-AuNP sensors, without additional Mg2+. The group (B) was treated with 20 mM MgCl2 and 5 µM calcimycin, a divalent cation ionophore which allows Mg2+ to cross the cell membrane,42 and then incubated with the aptazyme-AuNP sensors. The group (C) was incubated with the control sensors, containing a mismatched aptazyme sequence (two base substitutions). The results (Figure 5) showed the real-time monitoring of the above three groups using confocal laser scanning microscopy (CLSM). Comparing the group (A) and (B), both of their



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 28

fluorescence signals increased with the incubation time until about 4-5 h, while the group (A) has a little slower rate of cleavage reaction. It was obvious that the sensors could be used for intracellular sensing of ATP at physiological concentration of Mg2+, with no additional Mg2+ required. For the group (C), there was no fluorescence activation for the cells cultured with control sensors at all times. The result manifested the specificity of the sensors for target ATP imaging and also indicated the stability of the sensors in living cells for 6h.

2h

3h

4h

5h

6h

A

B

C

Figure 5. Real-time monitoring of fluorescence images for Hela cells in three groups. (A) Incubation with the aptazyme-AuNP sensors only; (B) Pretreated with 20mM MgCl2 and 5µM calcimycin for 30 min, followed by incubation with the sensors, (C) Incubation with control sensors only. Scale bar: 10µm. To further confirm the fluorescence signal resulting from the endogenously produced ATP of the HeLa cells, we used the proposed aptazyme-AuNP sensors to measure intracellular ATP changes upon drug stimulation. Before incubate with the sensors, the cells were treated with doses of oligomycin and 2-deoxy-D-glucose (a


Page 21 of 28

drug combination that is known to reduce ATP)

43

or with Ca2+ (a commonly used

ATP inducer) 44 for 30 min. An untreated group served as a control. Figure 6 showed that the fluorescent intensity was lower in the Hela cells treated with doses of oligomycin and 2-deoxy-D-glucose (A), while higher in the cells pre-incubated with Ca2+(C), relative to that in the untreated cells (B). These results indicated that the sensor is capable of detecting changes in intracellular ATP levels. Moreover, ATP is the primary energy molecule in all living cells, to investigate whether this sensor could be used for intracellular sensing of ATP in other cells, SMMC-7721 cells were used to be incubated with the sensors and control sensors for 5h, respectively. Then the cells were imaged using CLSM. The bright fluorescence signal was observed in the cells treated with aptazyme-AuNP sensors, while almost no fluorescence signal was detected from cells treated with control sensors (Figure S11). All these data clearly demonstrate that the aptazyme-AuNP sensor is a viable and reliable tool for high-contrast fluorescence imaging of small molecule ATP in living cells. B

C

TAMRA

A

Merge

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. Fluorescence images of HeLa cells treated with (A) medium, 10µg/mL oligomycin and 5mM 2-deoxy-D-glucose; (B) medium only; (C) medium and 5 mM Ca2+, followed by incubation with 2 nM aptazyme-AuNp sensors for 5 h at 37 °C.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Scale bar: 10µm.

CONCLUSIONS

In summary, we have developed the first aptazyme-based sensor for amplified detection of biomolecules in living cells. The aptazyme-AuNP sensor was a new design, in which the ratio of the aptazyme strand and the substrate strand modified onto the AuNPs was not limited to 1:1, and the signal could be amplified by cycling and regeneration of the aptazyme. The in vitro assays show that this sensor affords efficient signal amplification for fluorescence detection of ATP and exhibits high selectivity, good biocompatibility and stability. Live cell studies suggested that the sensor was efficiently delivered into living cells and worked for specific, high-contrast imaging of target molecules. Furthermore, it was demonstrated that the aptazyme-based sensor could be used for intracellular sensing of ATP at physiological concentration of Mg2+, with no additional Mg2+ required. More importantly, with more other aptamers for different targets have been achieved, we expect that the strategy could provide a new platform to convert different aptazymes into intracellular sensors for amplified detecting and imaging of other specific molecules in living cells.


Page 22 of 28

Page 23 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


AUTHOR INFORMATION Corresponding Authors *Email: [email protected] (J. Huang).

*Email: [email protected] (K. Wang).

Notes The authors declare no competing financial interest. ASSOCIATED CONTENT

ACKNOWLEDGMENTS This work was supported by the National Natural Science Foundation of China (21190044), the Foundation for Innovative Research Groups of NSFC (21521063), and the Fundamental Research Funds for the Central Universities. Supporting Information

Characterization of AuNPs and aptazyme-AuNPs; evaluation of amounts of substrate strands on each AuNP; optimation of the ratio of substrate strands to aptazyme strands; kinetic study of different ratio of substrates to aptazyme; optimation of the concentration of Mg2+; demonstration of the signal amplification effect of aptazyme-AuNP; MTT; studies of nuclease stability of the aptazyme-AuNP; ICP-MS for cellular uptake amount of the aptazyme-AuNPs; TEM images of cellular uptake of aptazyme-AuNPs; fluorescence imaging for SMMC-7721 cells. This material is available free of charge via the Internet at http://pubs.acs.org.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

REFERENCES 1.

Breaker, R. R.; Joyce, G. F. Chem. Biol. 1994, 1, 223-229.

2.

Zhao, X. H.; Gong, L.; Zhang, X. B.; Yang, B.; Fu, T.; Hu, R.; Tan, W.; Yu, R. Anal. Chem. 2013, 85, 3614-3620.

3.

Zhou, W.; Chen, Q.; Huang, P. J.; Ding, J.; Liu. J. Am. Chem. Soc. 2015, 87, 4001-4007.

4.

Lu, L. M.; Zhang, X. B.; Kong, R. M.; Yang, B.; Tan, W. J. Am. Chem. Soc. 2011, 133, 11686-11691.

5.

Ali, M. M.; Li, Y. Angew. Chem., Int. Ed. 2009, 48, 3512-3515.

6.

Huang, Y.; Ma, Y.; Chen, Y.; Wu, X.; Fang, L.; Zhu, Z.; Yang, C. Anal. Chem. 2014, 86, 11434-11439.

7.

Huang, Y.; Chen, J.; Zhao, S.; Shi, M.; Chen, Z. F.; Liang, H. Anal. Chem. 2013, 85, 4423-4430.

8.

Yuan, Y.; Yuan, R.; Chai, Y.; Zhuo, Y.; Ye, X.; Gan, X.; Bai, L. Chem. Commun. 2012, 48, 4621-4623.

9.

Hu, R.; Fu, T.; Zhang, X. B.; Kong, R. M.; Qiu, L. P.; Liu, Y. R.; Liang, X. T.; Tan, W.; Shen, G. L.; Yu, R. Q. Chem. Commun. 2012, 48, 9507-9509.

10. Cheng, Y.; Huang, Y.; Lei, J.; Zhang, L.; Ju, H. Anal. Chem. 2014, 86, 5158-5163.

11. Chen, Y.; Yang, M.; Xiang, Y.; Yuan, R.; Chai, Y. Nanoscale. 2014, 6, 1099-1104.


Page 24 of 28

Page 25 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


12. Wu, P.; Hwang, K.; Lan, T.; Lu, Y. J Am Chem Soc. 2013, 135, 5254-5257.

13. Hwang, K.; Wu, P.; Kim, T.; Lei, L.; Tian, S.; Wang, Y.; Lu, Y. Angew Chem Int Ed. 2014, 53, 13798-13802.

14. Torabi, S. F.; Wu, P.; McGhee, C. E.; Chen, L.; Hwang, K.; Zheng, N.; Cheng, J.; Lu, Y. PNAS. 2015, 112, 5903-5908.

15. Zhang, L.; Huang, H.; Xu, N.; Yin, Q. J. Mater. Chem. B. 2014, 2, 4935-4942.

16. Zhang, P.; He, Z.; Wang, C.; Chen, J.; Zhao, J.; Zhu, X.; Li, C.-Z.; Min, Q.; Zhu, J. J. ACS nano. 2014, 9, 789-798.

17. Li, L.; Feng, J.; Fan, Y.; Tang, B. Anal. Chem. 2015, 87, 4829-4835.

18. Famulok, M.; Hartig, J. S.; Mayer, G. Chem. Rev. 2007, 107, 3715-3743.

19. Zhang, X.-B.; Wang, Z.; Xing, H.; Xiang, Y.; Lu, Y. Anal. Chem. 2010, 82, 5005-5011.

20. Zhang, Z.; Balogh, D.; Wang, F.; Willner, I. J Am Chem Soc. 2013, 135, 1934-1940.

21. Huang, J.; He, Y.; Yang, X.; Wang, K.; Quan, K.; Lin, X. Analyst. 2014, 139, 2994-2997.

22. Chen Y., Corn, R. M. J. Am. Chem. Soc. 2013, 135, 2072−2075.

23. Gong, L.; Zhao, Z.; Lv, Y. F.; Huan, S. Y.; Fu, T.; Zhang, X. B.; Shen, G. L.; Yu, R. Q. Chem. Commun. 2015, 51, 979-995.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

24. Huizenga, D. E.; Szostak, J. W. Biochem. 1995, 34, 656-665.

25. Nutiu, R.; Li, Y. J. Am. Chem. Soc. 2003, 125, 4771-4778.

26. Wang, D. Y.; Lai, B. H. Y.; Sen, D.J. Mol. Biol. 2002, 318,33-43.

27. Wang, D. Y.; Sen, D.J. Mol. Biol. 2001, 310, 723-734.

28. Wang, D. Y.; Lai, B. H. Y.; Feldman, A. R.; Sen, D. Nucleic Acids Res. 2002, 30, 1735-1742.

29. Mei, S. H.; Liu, Z.; Brennan, J. D.; Li, Y. J. Am. Chem. Soc. 2003, 125 , 412-420.

30. Grabar, K. C.; Freeman, R. G.; Hommer, M. B.; Natan, M. J. Anal. Chem. 1995, 67 , 735-734.

31. Huang, J.; Ying, L.; Yang, X.; Yang, Y.; Quan, K.; Wang, H.; Xie, N.; Ou, M.; Zhou, Q.; Wang, K. Anal. Chem. 2015, 87, 8724-8731.

32. Demers, L. M.; Mirkin, C. A.; Mucic, R. C.; Reynolds, R. A.; Letsinger, R. L.; Elghanian, R.; Viswanadham, G. Anal. Chem. 2000, 72, 5535-5541.

33. Chithrani, B. D.; Ghazani, A. A.; Chan, W. C. Nano Lett. 2006, 6, 662-668.

34. Giljohann, D. A.; Seferos, D. S.; Patel, P. C.; Millstone, J. E.; Rosi, N. L.; Mirkin, C. A. Nano Lett. 2007, 7, 3818-3821.

35. Yang, Y.; Huang, J.; Yang, X.; Quan, K.; Wang, H.; Ying, L.; Xie, N.; Ou, M.; Wang, K. J. Am. Chem. Soc. 2015, 137, 8340-8343.


Page 26 of 28

Page 27 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


36. Mirkin, C. A.; Letsinger, R. L.; Mucic, R. C.; Storhoff, J. J. Nature. 1996, 382, 607-609.

37. Seferos, D. S.; Giljohann, D. A.; Hill, H. D.; Prigodich, A. E.; Mirkin, C. A. J. Am. Chem. Soc. 2007, 129, 1547-15479.

38. Maxwell, D. J.; Taylor, J. R.; Nie, S. J. Am. Chem. Soc. 2002, 124, 9606-9612.

39. Zheng, D.; Seferos, D. S.; Giljohann, D. A.; Patel, P. C.; Mirkin, C. A. Nano Lett. 2009, 9, 3258-3261.

40. Wang, Y.; Li, Z.; Hu, D.; Lin, C.-T.; Li, J.; Lin, Y. J. Am. Chem. Soc. 2010, 132, 9274-9276.

41. Li, L.; Gao, F.; Ye, J.; Chen, Z.; Li, Q.; Gao, W.; Ji, L.; Zhang, R.; Tang, B. Anal. Chem. 2013, 85, 9721-9727.

42. Chaney, M. O.; Demarco, P. V.; Jones, N. D.; Occolowitz, J. L. J. Am. Chem. Soc. 1974, 96 , 1932-1933.

43. Izyumov, D. S.; Avetisyan, A. V.; Pletjushkina, O. Y.; Sakharov, D. V.; Wirtz, K. W.; Chernyak, B. V.; Skulachev, V. P. Biochim Biophys Acta. 2004, 1658, 141-147.

44. Ainscow, E. K.; Rutter, G. A. Diabetes. 2002, 51, S162-S170.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

For TOC only


Page 28 of 28

AptazymeâGold Nanoparticle Sensor for Amplified Molecular Probing

Recommend Documents

AptazymeâGold Nanoparticle Sensor for Amplified Molecular Probing