Autophagy-Related Gene Expression Analysis of Wild-type and

Autophagy-Related Gene Expression Analysis of Wild-type and...
0 downloads 0 Views 4MB Size
Download PDF
Article pubs.acs.org/molecularpharmaceutics

Autophagy-Related Gene Expression Analysis of Wild-type and atg5 Gene Knockout Mouse Embryonic Fibroblast Cells Treated with Polyethylenimine Chia-Wei Lin,† Ming-Shiou Jan,*,†,‡ and Jung-Hua Steven Kuo*,§ †

Institute of Microbiology and Immunology, ‡Division of Allergy, Immunology, and Rheumatology, Medical College of Chung Shan Medical University, 110 Jianguo North Road, Sec. 1, Taichung 40201, Taiwan § Department of Pharmacy, Chia Nan University of Pharmacy and Science, 60 Erh-Jen Road, Sec. 1, Jen-Te, Tainan 717, Taiwan S Supporting Information *

ABSTRACT: The molecular mechanisms of autophagy in polyethylenimine (PEI)-treated cells are not well understood because of the use of nonspecific autophagy inhibitors. Here, we applied autophagy-related gene expression analysis to pinpoint the molecular mechanisms of autophagy in PEItreated wild-type and atg5 gene knockout (atg5−/−) mouse embryonic fibroblast (MEF) cells. It was demonstrated that the majority of induced genes are downregulated in wild-type and atg5−/− MEF cells, indicating that autophagy exhibits a trend toward downregulation after treatment with PEI. In addition to regulating genes encoding autophagy machinery components, genes related to coregulation of autophagy and apoptosis were induced in wild-type and atg5−/− cells treated with PEI. These data indicate that autophagy and apoptosis are closely related in the PEI-induced mechanism of cell death. In the absence of autophagy, the regulation of apoptosis was enhanced in atg5−/− MEF cells treated with PEI, indicating that inhibition of autophagy may lead to higher levels of apoptosis. Our study may provide deeper insight into the molecular mechanisms of cell death caused by PEI. KEYWORDS: polyethylenimine (PEI), autophagy, apoptosis, necrosis, PCR array

■

INTRODUCTION Polyethylenimine (PEI) is one of the most intensively used nonviral vectors for gene delivery because it provides significant buffering capacity in lysosomes over other cationic polymers.1,2 However, the well-known cytotoxicity of PEI remains a major obstacle for its clinical use.3,4 Because of the dynamic and complicated characteristics of cell death, interpretations of cell death mechanisms induced by PEI have been inconclusive, and the exact molecular mechanisms of cell death induced by PEI are still elusive.4−7 Morphologically, cell death is classified in at least four distinct processes: apoptosis, autophagy, necrosis, and pyroptosis.8,9 Genetically, autophagy is located upstream of the apoptotic and necrotic pathways and is engaged in both types of cell death.10 Necrosis, apoptosis, and, recently proposed, autophagy were identified in various PEI-treated cell lines.3,4,6,7 Autophagy is a highly conserved cellular mechanism through which various cellular components reach lysosomes for degradation, and it has been associated with various physiological and pathological processes.11 The execution of autophagy relies on a set of Atg proteins, and autophagy either avoids or promotes cell death under certain circumstances.12 It has been demonstrated that a free fraction of PEI accumulates inside lysosomes after cellular uptake and that the enzymatic © 2014 American Chemical Society

function of lysosomes is disrupted by the proton sponge effect of free PEI.7,13 The protective role of PEI-induced autophagy in HeLa cells has been observed, whereas PEI-induced autophagy promotes cell death in both hepatic and nephritic cell lines.6,7 Previous studies on PEI-induced autophagy have focused mainly on the identification of the process of autophagy, mostly by monitoring the activity of key proteins.6,7 The gene expression profiles of PEI-induced autophagy, however, which can provide upstream information regarding related proteins, have not been previously investigated. Furthermore, the role of autophagy in PEI-induced autophagy has not been clarified due to the use of nonspecific autophagy inhibitors.6,7 The molecular interactions between apoptosis and autophagy in PEI-induced cells are still not well known. The aim of this study is to explore the molecular mechanisms of autophagy in PEI-induced cell death by applying autophagy-related gene expression analysis of wild-type and atg5 gene knockout (atg5−/−) mouse embryonic fibroblast (MEF) cells. atg5−/− MEF cells were chosen in order Received: Revised: Accepted: Published: 3002

February 6, 2014 July 8, 2014 July 20, 2014 July 20, 2014 dx.doi.org/10.1021/mp500111u | Mol. Pharmaceutics 2014, 11, 3002−3008

Molecular Pharmaceutics

Article

Reaction (RT-qPCR). Three independent samples were performed for RT-qPCR, and the protocol was the same as that for the PCR arrays. The data for the target genes were quantified in a relative manner by normalizing to the reference gene (GAPDH). Six genes (Sqstm1, Becn1, Atg5, Casp8, Casp3, and Bcl2) were investigated using the following primer sequences: Sqstm1 sense GATAGCCTTGGAGTCGGTGG and antisense GTGTCCAGTCATCGTCTCCTC; Becn1 sense GGCGGCTCCTATTCCATCAA and antisense CCCACTTGAGATTGGTCAGCA; Atg5 sense CTCGGTTTGGCTTTGGTTGA and antisense ACCACACATCTCGAAGCACA; Casp8 sense TTCTGCTGGGAATGGCTACG and antisense CTCAGGCTCTGGCAAAGTGA; Casp3 sense TAACAGGAAGGTGGCAACGG and antisense CGGGATCTGTTTCTTTGCGTG; Bcl2 sense AGGATAACGGAGGCTGGGATG and antisense GCCAGGAGAAATCAAACAGAGG. Statistical Analysis. Statistical analyses were conducted using Student’s t test. Significance was set at P < 0.05. The data from PEI-treated cells were compared with data from untreated cells at each corresponding incubation time and dose.

to fully understand the activities and roles of autophagy through specific inhibition of the autophagic pathway. Our findings contribute valuable safety information for PEI-based gene delivery systems.

■

EXPERIMENTAL SECTION Materials. Branched PEI 25 K (MW = 25 000 g/mol) was obtained from Sigma-Aldrich Co. (St. Louis, MO, USA) without further purification, and PEI solutions were adjusted to pH 7.4. Rabbit anti-Beclin 1 and rabbit anti-Bcl-2 were purchased from Novus Biologicals (Littleton, CO, USA). Rabbit anti-Caspase-8, rabbit anti-Caspase-3, rabbit antiCleaved Caspase-8, and anti-Cleaved Caspase-3 were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). Cell Culture. Wild-type and atg5−/− MEF cell lines, generously provided by Dr. T. Yoshimori (Department of Genetics, Osaka University Graduate School of Medicine, Japan), were maintained in RPMI-1640 medium (Invitrogen Corp., Carlsbad, CA, USA) supplemented with 10% heatinactivated FBS and antibiotics (100 U/mL penicillin and 100 μg/mL streptomycin (Invitrogen)) and were cultured in a 5% CO2 atmosphere at 37 °C. Cell Viability and Lactate Dehydrogenase (LDH) Release Assays. Cell viability was assessed by detecting the activity of dehydrogenases (an indicator of cell viability) in cells (treated or untreated with PEI). Membrane integrity was analyzed by the release of lactate dehydrogenase after treatment with PEI. The protocols have been described in our previous work.7 Cell Morphology. After incubation with PEI, changes in cell morphology were observed using a Nikon Diaphot inverse phase-contrast microscope at 200× magnification. Western Blot Analysis. The expression of targeted proteins was evaluated by western blot analysis as described in our previous work.7 PCR Array. Array studies were conducted in RT2 Profile PCR arrays (Mouse Autophagy, SA Biosciences, Frederick, MD, USA), which contain 84 pathway-focused genes, by comparing autophagy-related gene expression profiles between untreated control cells and PEI-treated cells. Under the same incubation conditions as those used in western blot analysis, the quality of extracted RNA was confirmed according to the manufacturer’s standard. RNA from three replicates was pooled for reverse-transcription with the RT2 First Strand Kit (SA Biosciences) according to the standard protocol of the supplier. The template cDNA was mixed with nuclease-free water and RT2 qPCR SYBR Green master mix (SA Biosciences) before loading into the wells of the primer-containing PCR array plate. Every reaction was performed by using 10 ng of cDNA per 25 μL reaction volume in a two-step cycling program (95 °C for 10 min (required to activate the Hotstart Taq DNA polymerase), followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s) and was run on the ABI 7500FAST real-time PCR detection system. The quality of the PCR array was assured by a positive PCR control, a reverse transcription control, and a genomic DNA contamination control. Data was analyzed with RT2 profiler PCR Array Data analysis software (version 3.5). GAPDH was selected as the reference gene to which the target genes were normalized; genes with expression fold changes between samples of larger than 2 and lower than 0.5 were selected as being differentially regulated. Confirming Microarray Results Using Real-Time Quantitative Reverse Transcriptase-Polymerase Chain

■

RESULTS Cytotoxicity Assays and Effects of PEI Treatment on Cell Morphology. The trends of cell viability tended toward a dose-dependent decrease in both wild-type and atg5−/− MEF cells with 2.5−40 μg/mL doses of PEI for up to 12 h of incubation. Moreover, except at 2 h of incubation, PEI-induced cell death was higher in atg5−/− MEF cells than in wild-type MEF cells with 5−20 μg/mL doses of PEI (see Supporting Information, Figure 1A−C). Furthermore, PEI doses of 10−80 μg/mL induced dose-dependent gradual increases in the release of LDH for 2, 6, and 12 h incubations in both wild-type and atg5−/− MEF cells (see Supporting Information, Figure 1D−F). Our results provide evidence for necrosis upon PEI treatment in both wild-type and atg5−/− MEF cells because the release of LDH correlated with decreases in membrane integrity. Considerable morphological changes in PEI-treated wild-type and atg5−/− MEF cells were observed during longer incubation times or at the 20 μg/mL dose of PEI (see Supporting Information, Figure 2). Autophgy-Related Protein Expressions. Microtubuleassociated protein 1 light chain 3 (LC3), a mammalian homologue of Atg8, has been identified as a marker for autophagosomes.14 After protein synthesis, LC3-I is formed from an unprocessed form of LC3 by Atg4 protease. LC3-II is formed after LC3-I conjugates with phosphatidylethanolamine. The conversion of cytosolic LC3-I to LC3-II is a useful and sensitive marker for detecting autophagy in mammalian cells. LC3-II levels correlate with the number of autophagosomes and can be combined with lysosomal protease inhibitors, which block autophagosomal degradation, to detect the flux of autophagy-dependent substrate degradation.13 Furthermore, polyubiquitin-binding p62 protein (sequestosome 1 (Sqstm1)) binds to LC3 and is selectively recognized and degraded by autophagy.15 Beclin-1, which is the mammalian orthologue of yeast Atg6, plays an important role in autophagy.16 Beclin-1 also interacts with apoptosis proteins such as Bcl-2 or Bcl-XL, resulting in crosstalk between apoptosis and autophagy.16,17 Because the cytotoxicity of PEI increased significantly at higher concentrations (40 and 80 μg/ mL), we selected lower doses (5, 10, and 20 μg/mL) and incubated cells with PEI for 2, 6, and 12 h. With the exception 3003

dx.doi.org/10.1021/mp500111u | Mol. Pharmaceutics 2014, 11, 3002−3008

Molecular Pharmaceutics

Article

Figure 1. (A) Western blot analysis of LC3-I, LC3-II, p62, and Beclin-1 in wild-type and atg5−/− MEF cells treated PEI without protease inhibitors (E64-d and pepstatin) at the indicated concentrations. Western blot analysis of LC3-I, LC3-II, and Bcl-2 in (B) wild-type and (C) atg5−/− MEF cells treated PEI with or without protease inhibitors (E64-d and pepstatin) at the indicated concentrations. β-actin was used as the loading control. The ratios of band density were calculated with AlphaImager 2200 software. The data shown are from one representative experiment among three similar experiments.

in atg5−/− MEF cells, whereas Bcl-2 dose-dependently decreased in wild-type cells (Figure 1B,C). Autophagy-Related Gene Expression Analysis. According to functional classification by SA Biosciences, 84 autophagyrelated genes are related to the following two main categories: autophagy machinery components and regulation of autophagy. Interestingly, the majority of PEI-induced genes are downregulated in wild-type and atg5−/− MEF cells, which indicates that autophagy tended toward downregulation of related genes (Figure 2; for GenBank ID, gene description, quantitative data, and functional classification, see the Supporting Information). In PEI-treated wild-type MEF cells, 1 gene is upregulated and 15 genes are downregulated with 10 μg/mL PEI after 2 h of incubation, whereas 5 genes are upregulated and 15 genes are downregulated after 12 h of incubation (Figure 2). After treatment with a 20 μg/mL dose of PEI, 2 genes are upregulated and 35 genes are downregulated after a 2 h incubation, whereas 2 genes are upregulated and 29 genes are downregulated after a 12 h incubation (Figure 2). A larger number of genes were induced with the 20 μg/mL dose of PEI than for the 10 μg/mL dose at each time point, and the number of genes related to coregulating autophagy and apoptosis also increased (classification 7; Supporting Information, Table 9). Casp 8 and Fas, which are related to death receptor-mediated apoptosis, were both downregulated at 20 μg/mL PEI at each time point. At the 20 μg/mL dose of PEI, Sqstm 1 (p62), which is a coregulator of autophagy and apoptosis, was upregulated after 2 h of incubation. After 6 h, another coregulator of autophagy and apoptosis (Fadd) was upregulated. Furthermore, genes related to coregulating autophagy and apoptosis were also closely involved at the 10 μg/mL dose of PEI; only 2 genes

of the 2 h incubation, at which LC3-II was detected only at 20 μg/mL, the LC3-II/LC3-I ratios were dose-dependently higher in wild-type PEI-treated MEF cells than those in wild-type untreated cells (Figure 1A) for the 6 and 12 h incubations. Also, p62 expression was dose-dependently lower than that in wild-type untreated cells except for the 20 μg/mL treatment for 2 h, for which p62 expression was slightly higher than that of untreated cells (Figure 1A). However, Beclin-1 expression was slightly dose-dependently lower than that in wild-type untreated cells for each time point except for an increase observed at 2 h with 20 μg/mL PEI (Figure 1A). In atg5−/− PEI-treated MEF cells, no LC3-II expression was observed at each dose and incubation time used (Figure 1A). The expression of p62 remained unchanged at each dose used at the 2 h incubation and was dose-dependently lower than that in untreated atg5−/− MEF cells at the longer 6 and 12 h incubations (Figure 1A). The trends in Beclin-1 expression tended toward a dosedependent decrease in untreated atg5−/− MEF cells at each time point (Figure 1A). In order to monitor autophagic flux from LC3-I to LC3-II in PEI-treated cells, an LC3 turnover assay was conducted, which measures LC3-II degradation using inhibitors of lysosomal proteases (E64-d and pepstatin A).14 Indeed, LC3-II levels were increased in the presence of inhibitors compared to those in the absence of inhibitors under the same conditions in wildtype PEI-treated MEF cells (Figure 1B). This indicated that autophagic flux is increased during PEI treatment. In contrast, no LC3-II was detected in PEI-treated atg5−/− MEF cells (Figure 1C). We further checked the protein level of Bcl-2, which regulates apoptosis and autophagy.16 After PEI treatment, the protein level of Bcl-2 was predominantly unchanged 3004

dx.doi.org/10.1021/mp500111u | Mol. Pharmaceutics 2014, 11, 3002−3008

Molecular Pharmaceutics

Article

downregulation, and Bcl2 is also downregulated except at 10 μg/mL PEI after 12 h of incubation. These data indicate that autophagy and apoptosis are closely related in the PEI-induced mechanism of cell death. In the autophagy machinery components, Fam176a, which is the gene linking the autophagosome to the lysosome, was upregulated at 2 h for 10 and 20 μg/mL PEI. Atg16 related genes (Atg16l1 and Atg16l2) and Ulk1 are solely upregulated at 12 h with the 10 μg/mL dose of PEI. Upregulated Tmem74 is the sole gene involved in autophagy in response to other intracellular signals at 6 h with the 20 μg/mL dose of PEI. In PEI-treated atg5−/− MEF cells, we also observed some similarities and differences in the genes induced compared to those from PEI-treated wild-type MEF cells (Figure 2). Autophagy-related gene expression also tended toward downregulation in PEI-treated atg5−/− MEF cells. The number of induced genes at the 20 μg/mL dose of PEI in atg5−/− cells was comparable to that in wild-type cells, whereas the number of induced genes was greater at the 10 μg/mL dose of PEI in atg5−/− cells. The genes related to coregulating autophagy and apoptosis were also closely involved in PEI-treated atg5−/− MEF cells. Htt and Igf1 were both upregulated in PEI-treated wild-type and atg5−/− MEF cells at 12 h with 10 μg/mL PEI. However, Fas was upregulated at 2 h with 10 μg/mL PEI in atg5−/− MEF cells, whereas Fas was downregulated at 2 and 6 h with 10 μg/mL PEI in wild-type MEF cells (Figure 2). Only Casp8 was downregulated at 2 h with 20 μg/mL PEI in atg5−/− MEF cells. More downregulated genes related to autophagy machinery components were observed in atg5−/− MEF cells after treatment than in wild-type MEF cells. Beclin1 and Bcl2 genes also demonstrated trends toward downregulation in atg5−/− MEF cells. No upregulated genes were observed at 6 h with 20 μg/mL PEI in atg5−/− MEF cells. Confirming Microarray Results Using RT-qPCR and Western Blot Analysis. To confirm the gene expression results obtained from the PCR microarray analysis with the results from RT-qPCR, we tested six genes (Sqstm1, Becn1, Atg5, Casp8, Casp3, and Bcl2) in both PEI-treated wild-type and atg5−/− MEF cells (Tables 1 and 2). The criteria for selecting the genes that were measured using RT-qPCR were based on the further verification of their protein levels. In addition, the gene expression of Atg5 was selected because we can compare the gene levels between wild-type and atg5−/− MEF cells. Although some of the genes under the indicated conditions did not include genes for which expression was increased by a fold change greater than 2 or decreased lower

Figure 2. Heat map of genes induced in PEI-treated wild-type and atg5−/− MEF cells. Green indicates upregulation, and red represents downregulation.

related to coregulation of autophagy and apoptosis (Htt and Igf1) were regulated at 12 h. Beclin1 shows a trend toward

Table 1. Confirmation of Microarray Results in PEI-Treated Wild-type MEF Using RT-qPCRa dose (μg/mL) incubation time (h)

10 2

12

gene name Sqstm1 Becn1 Atg5 Casp8 Casp3 Bcl2

20 2

6

fold change (microarray/RT-qPCR) 0.72/0.65 0.31/0.40 0.59/0.48 0.53/0.51 0.47/0.39 0.11/0.32

± ± ± ± ± ±

0.08b 0.07b 0.07b 0.08b 0.06b 0.05b

0.95/0.97 0.31/0.37 0.87/0.70 1.02/1.12 0.65/0.72 0.68/0.66

± ± ± ± ± ±

0.10 0.08b 0.08b 0.19 0.09b 0.08b

2.27/2.57 0.30/0.69 0.31/0.61 0.22/0.37 0.85/0.76 0.17/0.32

± ± ± ± ± ±

0.16b 0.09b 0.07b 0.06b 0.06b 0.05b

1.42/1.50 0.40/0.55 0.52/0.47 0.17/0.30 0.55/0.59 0.16/0.25

± ± ± ± ± ±

0.14b 0.08b 0.09b 0.08b 0.07b 0.04b

The microarray data are presented as the mean values (the standard deviations were less than 1%). The RT-qPCR data are expressed as mean ± SD (n = 3). bP < 0.05 vs untreated cells (Sqstm1 (2 h (1.00 ± 0.11), 6 h (1.00 ± 0.08), 12 h (1.00 ± 0.06)); Becn1 (2 h (1.00 ± 0.09), 6 h (1.00 ± 0.07), 12 h (1.00 ± 0.13)); Atg5 (2 h (1.00 ± 0.10), 6 h (1.00 ± 0.14), 12 h (1.00 ± 0.12)); Casp8 (2 h (1.00 ± 0.15), 6 h (1.00 ± 0.16), 12 h (1.00 ± 0.10)); Casp3 (2 h (1.00 ± 0.07), 6 h (1.00 ± 0.04), 12 h (1.00 ± 0.09)); Bcl2 (2 h (1.00 ± 0.05), 6 h (1.00 ± 0.03), 12 h (1.00 ± 0.08))). a

3005

dx.doi.org/10.1021/mp500111u | Mol. Pharmaceutics 2014, 11, 3002−3008

Molecular Pharmaceutics

Article

Table 2. Confirmation of Microarray Results in PEI-Treated atg5−/− MEF Cells Using RT-qPCRa dose (μg/mL) incubation time (h)

10

20

2

12

gene name Sqstm1 Becn1 Atg5 Casp8 Casp3 Bcl2

2

6

fold change (microarray/RT-qPCR) 0.80/0.75 0.29/0.68 NSc 1.05/1.12 1.03/1.18 1.43/1.39

± 0.09b ± 0.09b ± 0.10 ± 0.12 ± 0.10b

1.10/1.15 0.29/0.57 NS 1.05/1.09 0.85/0.90 0.75/0.83

± 0.09 ± 0.06b ± 0.08 ± 0.08 ± 0.07

1.48/1.56 0.28/0.64 NS 0.20/0.56 1.21/1.29 0.28/0.75

± 0.12b ± 0.06b ± 0.07b ± 0.14 ± 0.07b

1.83/1.93 0.32/0.71 NS 0.65/0.60 0.95/1.03 0.53/0.65

± 0.14b ± 0.08b ± 0.05b ± 0.08 ± 0.07b

a The microarray data are presented as the mean values (the standard deviations were less than 1%). The RT-qPCR data are expressed as mean ± SD (n = 3). bP < 0.05 vs untreated cells (Sqstm1 (2 h (1.00 ± 0.06), 6 h (1.00 ± 0.06), 12 h (1.00 ± 0.08)); Becn1 (2 h (1.00 ± 0.08), 6 h (1.00 ± 0.04), 12 h (1.00 ± 0.10)); Atg5 (2 h (1.00 ± 0.06), 6 h (1.00 ± 0.11), 12 h (1.00 ± 0.09)); Casp8 (2 h (1.00 ± 0.13), 6 h (1.00 ± 0.09), 12 h (1.00 ± 0.09)); Casp3 (2 h (1.00 ± 0.17), 6 h (1.00 ± 0.12), 12 h (1.00 ± 0.08)); Bcl2 (2 h (1.00 ± 0.07), 6 h (1.00 ± 0.08), 12 h (1.00 ± 0.09))). cNot significant.

than 0.5, we still investigated the expression of these genes to fully understand their kinetic characteristics. As shown in Tables 1 and 2, the RT-qPCR results were consistent with the results from the microarray in terms of the trends toward upregulation or downregulation. Among those six genes tested, the gene expression of Beclin1 always decreased after treatment with PEI in wild-type and atg5−/− MEF cells (Tables 1 and 2). The protein level of Beclin-1 was slightly decreased and was consistent with the mRNA level of Beclin1 in both wild-type and atg5−/− MEF cells except at 20 μg/mL PEI after 2 h in wild-type cells (Figure 1A). For Sqstm1 or p62, the gene expression was upregulated at 2 h, and the degree of upregulation decreased at 12 h with 20 μg/mL PEI in wildtype cells. With 10 μg/mL PEI, the gene expression was downregulated at 2 h and remained almost unchanged at 6 h. In atg5−/− MEF cells, the gene expression of Sqstm1 was slightly downregulated and was followed by being upregulated at 10 μg/mL PEI from 2 to 12 h (Table 2). For 20 μg/mL PEI, the gene expression of Sqstm1 was upregulated from 2 to 6 h. At the protein level, Sqstm1 was increased and consistent with its gene expression at 2 h with 20 μg/mL PEI in wild-type cells (Figure 1A). The consistency between the decreased protein level and gene expression of Sqstm1 was also observed at 2 h with 10 μg/mL PEI in wild-type and atg5−/− cells. However, inconsistency was observed between protein level (decreased) and gene expression (increased) for the rest of the indicated conditions in wild-type and atg5−/− cells (Figure 1A). For Atg5, decreases in its gene expression were observed in wild-type cells, whereas there was no detection of Atg5 in atg5−/− MEF cells. For apoptosis-related genes (Casp8, Casp3, and Bcl2), Bcl2 and Casp3 were downregulated under each of the indicated conditions in wild-type cells, whereas the protein level of Bcl-2 remained unchanged and the protein level of Casp-3 was undetectable in wild-type cells (Figure 1B and Figure 3). In atg5−/− cells, Bcl2 was downregulated under each of the indicated conditions except with 10 μg/mL PEI after 2 h, in which Bcl2 was upregulated. However, the protein level of Bcl-2 remained mostly unchanged in atg5−/− cells (Figure 1C). Casp-3 was upregulated at 2 h with 20 μg/mL PEI and was slightly downregulated at 12 h with 10 μg/mL PEI in atg5−/− MEF cells. The protein level of cleaved Casp-3 was detectable under each of the indicated conditions in atg5−/− MEF cells (Figure 3). For Casp-8, downregulation was observed with 20 μg/mL PEI after 2 and 6 h and with 10 μg/mL PEI after 2 h in wild-type cells. The gene expression of Casp8 remained unchanged with 10 μg/mL PEI after 2 h in wild-type cells.

Figure 3. Western blot analysis of activated caspase-3 and caspase-8 in PEI-treated wild-type and atg5−/− MEF cells. β-actin was used as the loading control. The data shown are from one representative experiment among three similar experiments. 3006

dx.doi.org/10.1021/mp500111u | Mol. Pharmaceutics 2014, 11, 3002−3008

Molecular Pharmaceutics

Article

manner to cell death stimuli and this may result, in turn, in different expression profiles. Finally, the Casp-1 protein level was measured, and no significant expression level of cleaved Casp-1 was detected in PEI-treated wild-type and atg5−/− MEF cells (data not shown). We also investigated the release of the inflammatory cytokine IL-1β, which was related to Casp1-dependent activation as revealed by an enzyme-linked immunosorbent assay analysis in PEI-treated wild-type and atg5−/− MEF cells. Similarly, no release of IL-1β was detected (data not shown). Therefore, PEI-induced cell death was not related to Casp-1-dependent pathways of pyroptosis.

No protein expression of cleaved Casp-8 was observed in wildtype cells (Figure 3). In atg5−/− MEF cells, downregulation of Casp8 was observed at 2 and 6 h with 20 μg/mL PEI. The protein level of cleaved Casp-8 was only prevailingly found after 6 h of incubation (Figure 3).

■

DISCUSSION In addition to autophagy, the cytotoxic effects of PEI triggered damage to cell membranes in wild-type and atg5−/− cells after higher doses or longer incubations, indicating that necrosis was inevitably involved in PEI-induce cell death. Furthermore, PEIinduced cell death was higher in atg5−/− MEF cells than in wild-type MEF cells, implying the cytoprotective role of autophagy, which is consistent with the results of our previous study.7 Although evidence of the induction of autophagy, including conversion of the LC3-I to LC3-II and p62 degradation, are provided in PEI-treated wild-type MEF cells, the trends in the protein level and gene expression for another important autophagic protein, Beclin-1, tended toward downregulation (Figure 1A and Table 1). Beclin-1 increases under conditions of cell stress and is involved at every step in autophagic pathway through the activation of specific Beclin-1binding proteins such as the antiapoptotic Bcl-2 protein.15 We have conducted a coimmunoprecipitation assay for Beclin-1 and Bcl-2 in order to better understand the protein interaction between Beclin-1 and Bcl-2, as the Bcl-2−Beclin-1 complex may regulate the crosstalk between apoptosis and autophagy.16 We observed that higher dose (10 and 20 μg/mL) treatments of PEI after 6 h of incubation caused a dissociation of the Beclin-1−Bcl-2 complex in wild-type MEF cells. This dissociated Beclin-1 may promote the autophagy pathways, which correlates well with our observation of increased LC3-II protein in Figure 1A, indicating that PEI induces autophagy in wild-type MEF cells in a dose-dependent manner (data not shown). In this study, some of the protein levels did not correlate well with their mRNA levels. Most Atg mRNA levels were downregulated in wild-type and atg5−/− MEF cells treated with PEI, whereas protein levels of LC3 were increased in PEItreated wild-type cells. This inconsistency may be due to the fact that Atg proteins are constitutively sufficient or that their post-translational modifications are associated with other members of the autophagic machinery.14 Still, gene expression levels reflected kinetic feed-back regulation mechanisms of these genes. In atg5−/− MEF cells, the protein level of cleaved Casp-3 increased at every time point for 10 μg/mL and 20 μg/ mL PEI, whereas mRNA levels were upregulated to a lesser extent. Also, the protein level of cleaved Casp-8 increased at 6 h with 10 μg/mL and 20 μg/mL PEI, whereas its mRNA was downregulated in atg5−/− MEF cells. Therefore, in the absence of autophagy, the regulation of apoptosis was enhanced in atg5−/− MEF cells treated with PEI, indicating that inhibition of autophagy may lead to higher levels of apoptosis. However, no protein expression of cleaved Casp-3 and Casp-8 was observed in PEI-treated wild-type cells. This contrasts with previous studies in which Casp-3 was activated in various cells treated with PEI.7,18 Also, an investigation of the gene expression profile of apoptosis-related genes in several cells treated with 25 kDa PEI revealed different expression patterns compared with our data for apoptosis-related genes.19,20 This may be due to differences in the cell type used. Additionally, assays at the single-cell level, such as flow cytometry or immunohistochemistry, will provide more precise measurements than those measured as a whole because cells may respond in a flexible

■

CONCLUSIONS Gene expression profiling demonstrated that the majority of genes regulated by PEI treatment are downregulated in wildtype and atg5−/− MEF cells, indicating that autophagy exhibited a trend toward downregulation after treatment with PEI. In addition to genes encoding autophagy machinery components, genes related to the coregulation of autophagy and apoptosis were induced in wild-type and atg5−/− cells treated with PEI. These data indicate that autophagy and apoptosis are closely related in PEI-induced mechanisms of cell death. In the absence of autophagy, the regulation of apoptosis was enhanced in atg5−/− MEF cells treated with PEI, indicating that inhibition of autophagy may lead to higher levels of apoptosis. Our findings provide deeper insight into the molecular mechanisms of cell death caused by PEI.

■

ASSOCIATED CONTENT

S Supporting Information *

Cytotoxicity and LDH release assays of PEI on wild-type and atg5−/− MEF cells; phase-contrast images of the effects of PEI treatment on cell morphology in wild-type and atg5−/− MEF cells; and time course evaluation of up- and down-regulated genes in PEI-treated wild-type and atg5−/− MEF cells as well as the functional classifications of those genes. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Authors

*(M.-S.J.) E-mail: [email protected]. *(J.-H.S.K.) Tel: 886-6-266-4911 ext. 2104; Fax: 886-6-2666411; E-mail: [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by grant NSC 102-2221-E-041-013MY3 from the Taiwan National Science Council.

■

REFERENCES

(1) Boussif, O.; Lezoualch, F.; Zanta, M. A.; Mergny, M. D.; Scherman, D.; Demeneix, B.; Behr, J. P. A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethylenimine. Proc. Natl. Acad. Sci. U.S.A. 1995, 92, 7297−7301. (2) Behr, J. The proton sponge: a trick to enter cells the viruses did not exploit. Chimia 1997, 51, 34−36. (3) Hunter, A. C.; Moghimi, S. M. Cationic carriers of genetic material and cell death: a mitochondrial tale. Biochim. Biophys. Acta 2010, 1797, 1203−1209.

3007

dx.doi.org/10.1021/mp500111u | Mol. Pharmaceutics 2014, 11, 3002−3008

Molecular Pharmaceutics

Article

(4) Fischer, D.; Li, Y.; Ahlemeyer, B.; Krieglstein, J.; Kissel, T. In vitro cytotoxicity testing of polycations: influence of polymer structure on cell viability and hemolysis. Biomaterials 2003, 24, 1121−1131. (5) Larsen, A. K.; Malinska, D.; Koszela-Piotrowska, I.; Parhamifar, L.; Hunter, A. C.; Moghimi, S. M. Polyethylenimine-mediated impairment of mitochondrial membrane potential, respiration and membrane integrity: implications for nucleic acid delivery and gene therapy. Mitochondrion 2012, 12, 162−168. (6) Gao, X.; Yao, L.; Song, Q.; Zhu, L.; Xia, Z.; Xia, H.; Jiang, X.; Chen, J.; Chen, H. The association of autophagywith polyethylenimine-induced cytotoxicity in nephritic and hepatic cell lines. Biomaterials 2011, 32, 8613−8625. (7) Lin, C. W.; Jan, M. S.; Kuo, J. H.; Hsu, L. J.; Lin, Y. S. Protective role of autophagy in branched polyethylenimine (25K)- and poly(Llysine) (30−70K)-induced cell death. Eur. J. Pharm. Sci. 2012, 47, 865−874. (8) Galluzzi, L.; Vicencio, J. M.; Kepp, O.; Tasdemir, E.; Maiuri, M. C.; Kroemer, G. To die or not to die: that is the autophagic question. Curr. Mol. Med. 2008, 8, 78−91. (9) Bergsbaken, T.; Fink, S. L.; Cookson, B. T. Pyroptosis: host cell death and inflammation. Nat. Rev. Microbiol. 2009, 7, 99−109. (10) Eisenberg-Lerner, A.; Bialik, S.; Simon, H. U.; Kimchi, A. Life and death partners: apoptosis, autophagy and the cross-talk between them. Cell Death Differ. 2009, 16, 966−975. (11) Mizushima, N.; Komatsu, M. Autophagy: renovation of cells and tissues. Cell 2011, 147, 728−741. (12) Kroemer, G.; Mariño, G.; Levine, B. Autophagy and the integrated stress response. Mol. Cell 2010, 40, 280−293. (13) Benjaminsen, R. V.; Mattebjerg, M. A.; Henriksen, J. R.; Moghimi, S. M.; Andresen, T. L. The possible “proton sponge” effect of polyethylenimine (PEI) does not include change in lysosomal pH. Mol. Ther. 2013, 21, 149−157. (14) Mizushima, N.; Yoshimori, T.; Levine, B. Methods in mammalian autophagy research. Cell 2010, 140, 313−326. (15) Mizushima, N. Autophagy: process and function. Genes Dev. 2007, 21, 2861−2873. (16) Mukhopadhyay, S.; Panda, P. K.; Sinha, N.; Das, D. N.; Bhutia, S. K. Autophagy and apoptosis: where do they meet? Apoptosis 2014, 19, 555−566. (17) Kang, R.; Zeh, H.; Lotze, M. T.; Tang, D. The beclin 1 network regulates autophagy and apoptosis. Cell Death Differ. 2011, 18, 571− 580. (18) Moghimi, S. M.; Symonds, P.; Murray, J. C.; Hunter, A. C.; Debska, G.; Szewczyk, A. A two-stage poly(ethylenimine)-mediated cytotoxicity: implications for gene transfer/therapy. Mol. Ther. 2005, 11, 990−995. (19) Merkel, O. M.; Beyerle, A.; Beckmann, B. M.; Zheng, M.; Hartmann, R. K.; Stöger, T.; Kissel, T. H. Polymer-related off-target effects in non-viral siRNA delivery. Biomaterials 2011, 32, 2388−2398. (20) Beyerle, A.; Irmler, M.; Beckers, J.; Kissel, T.; Stöger, T. Toxicity pathway focused gene expression profiling of PEI-based polymers for pulmonaryapplications. Mol. Pharmaceutics 2010, 7, 727−737.

3008

dx.doi.org/10.1021/mp500111u | Mol. Pharmaceutics 2014, 11, 3002−3008