Band Gap Engineering of Titania Film through Cobalt Regulation for

Subscriber access provided by BOSTON UNIV

Article

Band Gap Engineering of Titania Film Through Cobalt Regulation for Oxidative Damage of Bacteria Respiration and Viability Jinhua Li, Jiaxing Wang, Donghui Wang, Geyong Guo, Kelvin Wai Kwok Yeung, Xianlong Zhang, and Xuanyong Liu ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.7b06867 • Publication Date (Web): 27 Jul 2017 Downloaded from http://pubs.acs.org on July 28, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Band Gap Engineering of Titania Film Through Cobalt Regulation for Oxidative Damage of Bacteria Respiration and Viability

Jinhua Li, a, b, d, e, 1 Jiaxing Wang, c, 1 Donghui Wang, a Geyong Guo, c Kelvin W. K. Yeung, b, d, * Xianlong Zhang c, * and Xuanyong Liu a, *

a

State Key Laboratory of High Performance Ceramics and Superfine Microstructure,

Shanghai Institute of Ceramics, Chinese Academy of Sciences, Shanghai 200050, China b

Department of Orthopaedics and Traumatology, Li Ka Shing Faculty of Medicine,

The University of Hong Kong, Pokfulam, Hong Kong, China c

Department of Orthopaedics, Shanghai Jiao Tong University Affiliated Sixth

People’s Hospital, Shanghai Jiao Tong University, Shanghai 200233, China d

Shenzhen Key Laboratory for Innovative Technology in Orthopaedic Trauma, The

University of Hong Kong Shenzhen Hospital, Shenzhen 518053, China e

University of Chinese Academy of Sciences, Beijing 100049, China

* Corresponding Authors: Prof. Xuanyong Liu Tel.: +86 21 5241 2409. Fax: +86 21 5241 2409. E-mail: [email protected] Prof. Xianlong Zhang Tel.: +86 21 6436 9183. Fax: +86 21 6470 1363. E-mail: [email protected] Prof. Kelvin W. K. Yeung E-mail: [email protected] Tel: +852 22554654. Fax: +852 28174392. 1

These authors contributed equally to this work.

1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT Biomaterial-related bacterial infections cause patient suffering, mortality and extended periods of hospitalization, and impose a substantial burden on medical systems. In this context, understanding the interactions between nanomaterials and bacteria is clinically significant. Herein, TiO2-based heterojunctions including Co-TiO2, CoO-TiO2 and Co3O4-TiO2, were firstly designed by optimizing magnetron sputtering to establish a platform to explore the interactions between nanomaterials and bacteria. We found that the energy band bending and band gap narrowing were effectively promoted at the contact interface of the heterojunctions, which have the ability to induce abiotic reactive oxygen species formation. Using methicillin-resistant Staphylococcus aureus and Staphylococcus epidermidis, in vitro studies showed that the heterojunctions of Co-TiO2, CoO-TiO2 and especially Co3O4-TiO2 can effectively down-regulate the expression levels of bacterial respiratory genes and cause oxidative damage to bacterial membrane respiration and viability. As a result, the surfaces of the heterojunctions possess favorable anti-adherent bacterial activity. Moreover, using an osteomyelitis model, pre-clinical study on rats further confirmed the favorable anti-infection effect of the elaborately designed heterojunctions (especially Co3O4-TiO2). We hope this study can provide new insights into the surface antibacterial design of biomaterials using energy band engineering for both basic research and clinical needs. Meanwhile, this attempt may also contribute to expanding the biomedical applications of cobalt-based nanoparticles for the treatment of antibiotic-resistant infections.

KEYWORDS Metal Oxide Nanoparticles; Reactive Oxygen Species; Electron Transfer; Energy Level Structure; Nano-Bio Interactions; Surface and Interface


Page 2 of 54

Page 3 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. INTRODUCTION Nowadays increasing attentions have focused on the antibiotic resistance of bacterial pathogens, which starves for breakthrough for biomaterials-related infection prevention and treatment1-3. Over 40% of Staphylococcus aureus strains isolated from hospitals show drug resistance to methicillin (methicillin-resistant S. aureus)4, 5; some of them even develop drug resistance to vancomycin, which is the mainstay for treating S. aureus infection6, 7. Gram-negative bacteria have also been developing multi-drug resistance8, 9. In this context, engineering self-antimicrobial biomaterials to enhance antibacterial efficacy and prevent drug resistance is highly demanded10, 11. As an alternative to traditional antibiotic administration, nanomaterials-based antibiotics provide a new and attractive paradigm for combating drug-resistant bacteria12-14. The TiO2-based nanomaterials hold great promise for bacterial inactivation owing to their photocatalytic activity15,

16

. However, TiO2 is a wide-bandgap

semiconductor, which makes it unable to inactivate bacterial pathogens under visible light or in the dark17-19. Therefore, various efforts have been made to endow TiO2 with self-antibacterial properties. For instance, the incorporation of Ag nanoparticles into TiO2 matrix has been widely adopted for surface-killing purposes20-23. Before clinical trials on humans, it is important to understand the inactivation mechanism of bactericidal nanomaterials. Growing attentions have focused on reactive oxygen species (ROS)-induced bacterial toxicity, which can be achieved through two ways: (i) by contact killing, in which bacteria is inactivated through ROS induction after direct 3 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

contact with engineered nanoparticles, such as Ag2S/Ag nanodimers24, Ag/clay nanohybrids25, etc., or (ii) by the toxic effect of dissolved metal ions, which cause oxidative damage to bacteria, such as CuO nanoparticles26, Ag2O nanoparticles27, etc. Burello et al.28-30 recently proposed a theoretical model to predict the oxidative stress and toxicity potential of metal oxide nanoparticles by comparing their energy levels with the biological redox potential (BRP, –4.12 eV to –4.84 eV) determined by cellular redox couples. It is known that the alignment of Fermi level (EF) and band gap (Eg) plays an important role in driving electron-hole separation and charge transfer between semiconductors and their neighboring materials31. In physical contact, the relationship between the energy levels and BRP holds potential to affect the cellular oxidative stress response32. Therefore, it is meaningful to engineer the energy levels of semiconductors and explore whether they can influence the microbial redox hemostasis. For n-type semiconductors, electrons near the bottom of conduction band primarily account for the electrical conduction, and for p-type semiconductors, the holes near the top of valence band mainly carry the current. Considering that TiO2 is an n-type semiconductor, Co3O4 and CoO are p-type semiconductors, and Co is in the metallic state, it is inferred that the construction of TiO2-based heterostructures by cobalt doping has the potential to facilitate electron-hole separation and charge transfer. If so, it would be a platform to investigate the microbial oxidative stress response. In addition, cobalt has been confirmed to promote osteogenesis and vascularization33, 34. It is an essential element in human physiology and a constituent part of cobalamin (vitamin B12) that cannot be synthesized by the human body. 4 ACS Paragon Plus Environment

Page 4 of 54

Page 5 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


In this work, TiO2-based heterojunctions, including Co3O4-TiO2, CoO-TiO2 and Co-TiO2, were designed by optimizing magnetron sputtering. We firstly investigated the physicochemical properties of the heterojunctions and then explored their influence on the respiratory chain and cellular viability of methicillin-resistant S. aureus and S. epidermidis. The present study aimed to explore the potential relationship between the energy levels of heterojunctions and the bacterial oxidative stress response. Finally, a classical osteomyelitis model35 was adopted as pre-clinical study to further investigate the in vivo anti-infection effect.

2. MATERIALS AND METHODS 2.1. Specimen Fabrication Metallic titanium (purity 99.95%, Shanghai PuWei Medical Instrument Company) was used in this study for the purpose of fabricating titania film. In detail, titanium plates (10 mm × 10 mm × 1 mm, 20 mm × 20 mm × 1 mm, 20 mm × 10 mm × 1 mm) and rods (Ø1.5 mm × 20 mm) were firstly pickled in 5 wt% oxalic acid solution at 100 ºC for 2 h to clean the surfaces, followed by thorough washing with ethanol and pure water. Then, the titanium plates and rods were used as the substrates of depositing cobalt-based nanoparticles using a magnetron sputtering apparatus (ULVAC Corp., Model ACS-4000-C4) with highly pure Co3O4, CoO, and Co metal targets. After, these specimens were vacuum annealed at 450 °C. The cobalt nanoparticle sizes were tuned to similar scales. The test specimens were denoted as Co3O4-TiO2, CoO-TiO2, and Co-TiO2, respectively. Annealed titanium plates and rods 5 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

were used as the control (denoted as A-TiO2).

2.2. Specimen Characterization The specimens’ surface morphologies were observed by field emission scanning electron microscopy (SEM; Magellan 400, FEI, USA). Crystallinity was examined by an X-ray diffractometer (XRD; Rigaku Ultima IV, Japan) using a Cu Kα (λ = 1.541 Å) source (2θ = 20º~90º) with a glancing angle of 1º. Phase identification was conducted according to the JCPDS database. High-resolution images were acquired by a field emission transmission electron microscope (TEM; JEM-2100F, JEOL Ltd., Japan) equipped with an energy-dispersive spectrometer (EDS) at an accelerating voltage of 200 kV. The observed specimens were scratched from the surface and dispersed in ethanol. Their surface chemical compositions and states were analyzed by X-ray photoelectron spectroscopy (XPS; ESCALAB 250, Thermo Scientific, USA). The surface zeta potential (ζ) of specimens Co3O4-TiO2, CoO-TiO2, Co-TiO2, and A-TiO2 (20 mm × 10 mm × 1 mm) were measured by a SurPASS Electrokinetic Analyzer (Anton Paar GmbH, Austria). The optical diffuse reflectance spectra of specimens Co3O4-TiO2, CoO-TiO2, Co-TiO2, and A-TiO2 were recorded on a UV-Vis-NIR spectrophotometer (Model UV-4100, Hitachi Corp.). The measurement was repeated three times.

2.3. Ion Release Measurement Specimens Co3O4-TiO2, CoO-TiO2, Co-TiO2, and A-TiO2 were immersed in 10 6 ACS Paragon Plus Environment

Page 6 of 54

Page 7 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ml of trypticase soy broth (TSB) and Dulbecco’s Modified Eagle’s medium (DMEM) in 15 ml sterile microcentrifuge tubes, followed by successive static incubation for 1, 4, and 7 days and 2, 4, 6, and 8 weeks at 37 ºC. At the end of each time point, the leachates were collected. The release amounts of the cobalt ions were detected by inductively coupled plasma optical emission spectrometry (ICP-OES, Varian Liberty 150, US).

2.4. Bacteria Source and Culture In this study, community-acquired methicillin-resistant S. aureus (SF8300) and S. epidermidis (RP62A) were used to investigate the antibacterial activity of various specimens in vitro, and SF8300 was used to evaluate the anti-infection effect in vivo. SF8300 was kindly given by Dr. Binh An Diep (Department of Infectious Disease, San Francisco General Hospital, UCSF, CA, USA), and RP62A was purchased in freeze-dried form the American Type Culture Collection (Rockefeller, MD). All strains were frozen and stored at –80 °C. Prior to each experiment, SF8300 and RP62A were grown on sheep blood agar (SBA) plates overnight at 37 °C. Single bacterial colonies of each strain were collected and incubated in 4 ml TSB overnight at 37 °C. The inocula of SF8300 and RP62A were serially diluted tenfold to ~1 × 106 colony-forming units per ml (CFUs/ml) in TSB for antibacterial study in vitro. SF8300 was prepared in PBS at a concentration of ~1 × 106 CFUs/ml for the animal model of osteomyelitis.

2.5. In Vitro Antibacterial Property Evaluation The antibacterial activity of four groups (Co3O4-TiO2, CoO-TiO2, Co-TiO2, and 7 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

A-TiO2) against planktonic and adherent bacteria were evaluated. These specimens with 500 µl of prepared bacteria suspension (~1 × 106 CFUs/ml) were incubated overnight in 24-well plates at 37 °C. Then, the spread plate method (SPM) was adopted to estimate the growth discrepancy of the planktonic bacteria in the culture medium with different specimens. CLSM and SEM were used to evaluate the anti-adherent bacteria property of the different specimens.

2.5.1. Antibacterial Property Assay by SPM After overnight culturing, the bacterial broth was harvested to assay the total viable counts of planktonic bacteria. The bacteria on the specimens’ surface were collected in 1 ml of PBS by ultrasonic vibration (150 W, 50 Hz) for 5 min, and ultrasonic lysates were used to determine the total viable counts of adherent bacteria. After rapid vortex mixing (B3500S-MT, Branson Ultrasonics, China), the above bacteria suspensions were serially diluted tenfold. Then, 100 µl of diluted bacterial suspension was spread on an SBA plate and incubated at 37 °C overnight. The viable counts were calculated according to the National Standard of China GB/T 4789.2 protocol. The experiment was repeated thrice.

2.5.2. Antibacterial Property Assay by CLSM According to the instructions of the Live/Dead BacLight Bacterial Viability Kit (L13152, Invitrogen), after culturing bacteria overnight, the specimens of each group were gently rinsed thrice with PBS in new 24-well plates and then stained with 500 µl 8 ACS Paragon Plus Environment

Page 8 of 54

Page 9 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of a fluorescent dye mixture at room temperature for 15 min in darkness. Propidium iodide (PI, red fluorescent dye for dead bacteria) and SYTO 9 (green fluorescent dye for live bacteria) were mixed before use. Then, the specimens were observed by confocal laser scanning microscopy (CLSM; LSM 510 Meta, Zeiss, Germany). The viable adherent bacteria were stained in a green fluorescence, whereas the nonviable bacteria were stained in a red fluorescence. All the operations strictly followed the manufacturer’s instructions.

2.5.3. Antibacterial Property Assay by SEM For SEM observation, the bacteria were first cultured on various specimens, gently rinsed thrice with PBS, and then fixed with 2.5% glutaraldehyde at 4 °C for 4 h. After, they were dehydrated successively using a graded ethanol series (50, 70, 80, 90, 95, and 100 v/v%) for 10 min in new 24-well plates. They were freeze dried, platinum coated, and observed by SEM (JEOL JSM-6310LV, Japan).

2.6. qRT-PCR for Bacterial Gene Expression Analyses To explore the mechanism by which the specimens had an effect on bacterial respiratory functions, real-time polymerase chain reaction (PCR) was utilized to analyze the expression of three relevant genes of S. aureus (SF8300) and S. epidermidis (RP62A). The expression levels of genes sdhC, cydB, and cco-3 were used to determine the respiratory functions of both bacteria on specimens (Table 1), and 16S rRNA was used as the internal standard gene. 2 ml of bacterial suspension 9 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

were added to each well containing the respective sample (20 mm × 20 mm × 1 mm) in 6-well plate and cultured statically at 37 ºC overnight. After being gently rinsed thrice with PBS in new 6-well plate, the adherent bacteria were collected and pelleted by centrifugation at 10,000 g for 5 min, followed by resuspending in 1 ml of PBS containing 100 mg/ml of lysostaphin (Sigma) and incubation at 37 ºC for 10 min36. Total RNA was extracted using an RNeasy Mini Kit (Qiagen, Germany). Then, reverse transcription was completed with the PrimeScript RT Reagent Kit (Takara) using 1 µg of the total RNA. qRT-PCR analysis was conducted using 2 × SG Fast qPCR Master Mix (Low Rox, BBI Life Sciences). In total, 20 µl of reaction mix aggregated in the standard 384-well plate setup. Then, 10 µl of 2 × SG Fast qPCR Master Mix (Low Rox), 2 µl of DNF buffer, 0.4 µl of primer (forward and reverse), and 7.2 µl of the cDNA template with ddH2O were blended in each well, and the reactions were implemented in triplicate for each gene. Amplification was accomplished over 40 cycles (enzyme activation at 95 °C for 3 min, denaturation at 95 °C for 3 s, and annealing extension at 60 °C for 30 s) using the Applied Biosystems 7900 system. After data collection, the ∆∆CT method was used to calculate the relative expression level of each gene in all the samples.

2.7. Abiotic ROS Assay 2.7.1. Total Abiotic ROS Assay The total abiotic ROS induced by the heterojunctions was evaluated according to previous work 37. Prior to measurement, a working solution was prepared. In brief, the 10 ACS Paragon Plus Environment

Page 10 of 54

Page 11 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


acetate

group

of

2′,7′-dichlorodihydrofluorescein

diacetate

(DCFH-DA;

Sigma-Aldrich, US) was hydrolyzed and deacetylated by 0.1 M of NaOH at room temperature for 30 min to form DCFH with a final dye concentration of 30 ng/ml. The non-fluorescent DCFH was oxidized into highly fluorescent 2′,7′-dichlorofluorescein (DCF) by abiotic ROS. Four specimens of each group were positioned in new 24-well plates and supplemented with 500 µl of DCFH working solution, followed by incubation at 37 °C for 6 h. After, 100 µl of the solution was transferred into 96-well plates, and the fluorescence intensity of DCF was recorded on a Cytation 3 Cell Imaging Multi-Mode Reader at an excitation and emission of 485 nm and 530 nm, respectively.

2.7.2. Hydroxyl Radical Assay The heterojunction-induced hydroxyl radical (●OH) was evaluated using terephthalic acid (THA) as a fluorescent probe

38

. THA readily reacts with hydroxyl

radicals to produce highly fluorescent 2-hydroxyterephthalic acid after hydroxylation. In this study, a working solution was firstly prepared containing 0.5 mM of THA in 2 mM of NaOH. Four specimens from each group were placed in new 24-well plates and supplemented with 500 µl of THA working solution, followed by incubation at 37 °C for 6 h. After, 100 µl of solution was transferred into 96-well plates, and the fluorescence intensity of 2-hydroxyterephthalic acid was recorded on a Cytation 3 Cell Imaging Multi-Mode Reader at an excitation and emission of 315 nm and 425 nm, respectively. 11 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 54

2.7.3. Superoxide Anion Radical Assay The superoxide anion radical (● O2-) induced by heterojunction was evaluated by using

2,3-bis(2-methoxy-4-nitro-5-sulfophehyl)-2H-tetrazolium-5-carboxanilide)

(XTT) as a specific probe

39

. XTT reduction by superoxide anion radicals produces

XTT-formazan. Here, a working solution was first prepared containing 100 µM of XTT in PBS. Four specimens from each group were positioned in new 24-well plates and supplemented with 500 µl of XTT working solution, followed by incubation at 37 °C for 6 h. After, 100 µl of solution was transferred into 96-well plates, and the absorbance of formazan was measured on a Cytation 3 Cell Imaging Multi-Mode Reader at 470 nm.

2.8. Confirmatory Study To examine the long-term antibacterial properties, specimens Co3O4-TiO2, CoO-TiO2, Co-TiO2, and A-TiO2 were incubated in PBS for 8 weeks. Then, the Live/Dead BacLight Kit was used to observe the viability of the bacteria after culturing on various specimens by CLSM (Section 2.5.2). To

explore

the

potential

role

of

oxidative

stress

in

cobalt-titania

heterojunction-induced loss of bacteria viability, both RP62A and SF8300 were co-incubated with 10 mM of glutathione (GSH, reduced form), the major endogenous antioxidant, to attenuate or eliminate the contribution of oxidative stress in the bacterial response to the heterojunction exposure. This strategy can effectively 12 ACS Paragon Plus Environment

Page 13 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


alleviate the oxidative stress induced by bacteria pro-oxidants

40

. The Live/Dead

BacLight Kit was used to observe the bacteria viability after culturing on various specimens by CLSM (Section 2.5.2).

2.9. Pre-Clinical Study on Antimicrobial Activity 2.9.1. Implant Preparation Titanium rods with diameter of 1.5 mm and length of 20 mm were used as the implants for in vivo study. All the details of sample preparation were described in Section 2.1.

2.9.2. Implant-Related Femoral Osteomyelitis Model Our experiment was approved by the Animal Care and Experiment Committee of Sixth People’s Hospital Affiliated to Shanghai Jiao Tong University. Thirty-six specific-pathogen-free male Sprague Dawley rats, with an average weight of 410 g, were used in our work. S. aureus (SF8300) was chosen to establish femur osteomyelitis. Anesthesia was completed by the intraperitoneal injection of 3% pentobarbital sodium. All surgical procedures were carried out under aseptic conditions. The left knee was shaved, sterilized with povidone iodine, and incised layer by layer through a medial parapatellar approach. Then, the femoral condyle was disclosed, and the medullary cavity was accessed and reamed gradually with a Kirschner wire (1.5-mm diameter) by drilling a hole on the femoral trochlea. Subsequently, 100 µl of PBS containing S. aureus with a bacterial concentration of 13 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 54

105 CFUs was injected into the femoral medullary cavity, and a prepared implant (1.5 mm in diameter and 20 mm in length) was inserted. Then, the surgical site was closed layer by layer. After the surgery, the rats were raised in ventilated rooms and allowed to eat and drink freely. The administration of antibiotics was prohibited during our experiment.

2.9.3. Clinical Assessment All the rats in the four groups were supervised on the day of surgery and 7 days (1 week), 14 days (2 weeks), 28 days (4 weeks) and 42 days (6 weeks) after surgery. Body weight and temperature were chosen as general index observations and were assessed. Body weight was determined on a precision scale, and body temperature was measured by a digital infrared thermometer. Local clinical symptoms of infection, including skin exudation, left knee joint swelling, and other inflammatory signs, were monitored.

2.9.4. Radiographic Assessment At 1, 14, 28, and 42 days after surgery, lateral radiographs of the rat femurs were acquired. The imaging was evaluated based on a scoring system

41, 42

, as follows: 1,

osteolysis; 2, periosteal reaction; 3, malformation; 4, overall impression; 5, sequestrum formation; and 6, spontaneous fracture. Parameters 1–4 were graded as follows: 0 = absent; 1 = mild; 2 = moderate; and 3 = severe. Parameters 5 and 6 were graded as 0 = absent or 1 = present. The X-ray images of the femurs in all the animals 14 ACS Paragon Plus Environment

Page 15 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


were read and explained blindly by three radiologists who were unaware of our experimental scheme. Prior to micro-computed tomographic (micro-CT; Skyscan 1176, Bruker Micro-CT, Germany) scanning, the rats were euthanized with 3% pentobarbital sodium at 42 days post-surgery. Their femurs were aseptically attained and scanned through high-resolution micro-CT at an image resolution of 18 µm (55 kV and 181 µA radiation sources with a 0.5-mm aluminum filter). The coronal and transverse sections and the overall three-dimensional high-resolution images were obtained using the software provided by the manufacturer. The bone volume/total volume and the cortical bone mineral density of the femurs were also analyzed using the software supplied by the manufacturer.

2.9.5. Microbiological Evaluation After micro-CT scanning, the metal rods in the rat femurs were aseptically rooted. For the quantitative analysis of the adhered bacteria, we placed the rods in 5 ml of sterile PBS. They were sonicated in an ultrasonic pot at 150 W for 5 minutes and vibrated at maximum speed to remove any sessile bacteria. The resultant solutions were serially diluted, and the amount of adhered bacteria was counted by the SPM. After implant removal, nine random femurs from each group were weighed, frozen in liquid nitrogen, and ground to a powder in a sterile bone mill

43

.

Subsequently, the bone powder of every femur was adequately vortexed in 4 ml of 15 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

fresh PBS for 2 minutes. After centrifuging at 10,000 g for 30 s, 100 µL of supernatant was sucked up for subsequent ten-fold serial dilutions. The number of bacteria in each femur was analyzed and expressed for CFUs/g through the SPM.

2.9.6. Histopathological Evaluation Four femurs from each group were fixed in 10% buffered neutral formalin for 3 days, decalcified at 37 °C for 10 days, and then dehydrated in a serial alcohol solution. Then, the samples were embedded in paraffin and cut by a microtome (Leica, Hamburg, Germany) to acquire a 5-µm longitudinal section in a coronal plane after the implants were explanted. Hematoxylin and eosin (H&E) staining was used to evaluate the morphology, and Giemsa staining was used to determine the bacterial contamination.

2.10. Statistical Analysis Each experiment was repeated three times. Data were expressed as mean ± standard deviations. The statistical evaluation was completed using GraphPad Prism statistical software. The level of statistical significance was determined by one-way ANOVA and Student-Newman-Keul post hoc tests. P values less than 0.05 were considered statistically significant.

3. RESULTS 3.1. Specimen Characterization 16 ACS Paragon Plus Environment

Page 16 of 54

Page 17 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1a–d shows the surface morphologies of specimens A-TiO2, Co-TiO2, CoO-TiO2, and Co3O4-TiO2, respectively. Compared with the relatively smooth surface topography of specimen A-TiO2, after cobalt depositing, tiny nanoparticles appeared on the surfaces of specimens Co-TiO2, CoO-TiO2, and Co3O4-TiO2. Titanium surface consists of a thin layer of amorphous titanium oxide due to natural oxidation

44

. Here, an XRD technique was used to study the phase evolution and

composition of various samples after magnetron sputtering and vacuum annealing. As shown in Figure 1e, the pristine amorphous layer on substrate underwent the crystallization process to form the anatase titania phase (A-TiO2) with a representative diffraction peak at 2θ = 62.8º. This was also true for specimens Co-TiO2, CoO-TiO2, and Co3O4-TiO2, which mainly consisted of anatase titania after magnetron sputtering and vacuum annealing. The corresponding high-resolution TEM images are given in Figure 1f–i. The apparent lattice fringes indicated the good crystallinity of the titania layer on A-TiO2 (Figure 1f), with an interplanar spacing of 0.149 nm assigned to the (204) crystal plane of anatase titania. After the sputtering of the Co metal target, as shown in Figure 1g, tiny nanoparticles tightly bound with the titania layer, with an interplanar spacing of 0.340 nm and 0.425 nm corresponding to the lattice fringes of the (201) and (102) crystal planes of the well-crystalized metallic Co nanoparticles, respectively. Combined with the corresponding micro-area EDS analysis results (the inset), the tiny nanoparticles demonstrated Co nanoparticles (Co-TiO2). After the sputtering of the CoO target, tiny nanoparticles were also observed on the titania layer, with an interplanar spacing of 0.302 nm for the lattice fringe of the (110) crystal plane 17 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

of the well-crystallized CoO nanoparticles

45

, as seen in Figure 1h. Combined with

the corresponding micro-area EDS analysis results (the inset), the tiny nanoparticles confirmed CoO nanoparticles (CoO-TiO2). The above situation was also the same for the sputtering of the Co3O4 target. As shown in Figure 1i, tiny nanoparticles tightly bound with the titania layer, with an interplanar spacing of 0.234 nm and 0.244 nm corresponding to the lattice fringes of the (222) and (311) crystal planes of the well-crystallized Co3O4 nanoparticles, respectively

46

. Combined with the

corresponding micro-area EDS analysis results (the inset), the tiny nanoparticles demonstrated Co3O4 nanoparticles (Co3O4-TiO2). In addition, based on the TEM images, the thickness of crystalline TiO2 films should be over 20 nm. Figure 1j–m shows the high-resolution XPS spectra of the Ti 2p peaks acquired from the surfaces of specimens A-TiO2, Co-TiO2, CoO-TiO2, and Co3O4-TiO2, respectively. All the Ti 2p XPS peaks can be fitted with doublet peaks at 458.8 eV and 464.5 eV, which correspond to the Ti 2p3/2 and Ti 2p1/2 in TiO2. This result indicated that the outermost surface of the titanium substrate was completely overlaid with a layer of the titania phase, which agreed well with the XRD and TEM results. With regard to the Co 2p XPS spectra, Figure 1n shows the high-resolution spectrum of the Co 2p XPS peak acquired from the surface of the specimen Co-TiO2. From this figure, the main doublet peaks at 777.3 eV and 792.3 eV belong to Co 2p3/2 and Co 2p1/2 in Co metal

47

. Further, two other Co 2p XPS doublet peaks appeared for the

CoO, which included doublet peaks at 780.1 eV and 786.0 eV for Co 2p3/2 and at 796.0 eV and 802.2 eV for Co 2p1/2, indicating the partial natural oxidation of Co 18 ACS Paragon Plus Environment

Page 18 of 54

Page 19 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


metal nanoparticles upon their exposure to air. For the Co 2p XPS spectrum from the surface of specimen CoO-TiO2 (Figure 1o), two fitted XPS doublet peaks correspond to Co 2p3/2 (780.1 eV and 785.2 eV) and Co 2p1/2 (795.9 eV and 802.1 eV) in CoO. In regard to the acquired Co 2p XPS spectrum from the surface of specimen Co3O4-TiO2 (Figure 1p), the spectrum was fitted with two doublet peaks assigned to Co 2p3/2 (779.7 eV and 785.1 eV) and Co 2p1/2 (795.3 eV and 801.5 eV) in Co3O4. Overall, the XPS analysis results were quite consistent with the TEM analysis results. In addition, the surface zeta potential of specimens A-TiO2, Co-TiO2, CoO-TiO2, and Co3O4-TiO2 are given in Figure 1q, which reflects the influence of cobalt doping on the surface charge states of various specimens at different pH values, indicating a trend of positive shift of the surface potentials and isoelectric points of heterojunctions from oxide to metal. Besides, the Ti/Co ratios for samples Co-TiO2, CoO-TiO2 and Co3O4-TiO2 are 1.94, 2.65 and 3.51, respectively. Since the 10 nm of sampling depth of XPS is less than the thickness of TiO2 films, no signals of metal substrate can be detected by XPS.

3.2. Anti-Planktonic Bacterial Activity Figure 2 gives the anti-planktonic bacterial activity of specimens A-TiO2, Co-TiO2, CoO-TiO2, and Co3O4-TiO2. For this purpose, the release profile of cobalt ions should be explored first. As seen in Figure 2a, cobalt ions were released at a low rate from the surfaces of specimens Co-TiO2 and CoO-TiO2 within the initial 2 weeks of immersion in TSB. However, the cobalt ions could not be detected by ICP-OES 19 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

after 2 weeks, indicating that no more cobalt ions were released from the surface. This is also true for specimen Co3O4-TiO2, which did not release any cobalt ions within 8 weeks of immersion in TSB. Likewise, there was also no release of cobalt ions from the surfaces of the specimens within 8 weeks of soaking in DMEM, as shown in Figure 2b. On this basis, one can infer that the cobalt-doped titania surfaces may have no significant anti-planktonic bacterial properties due to the lack of released free cobalt ions. Actually, as evidenced in Figure 2c, large numbers of live bacterial colonies appeared on the SBA after re-cultivating planktonic bacteria by the SPM for both RP62A and SF8300. Clearly, as seen in Figure 2d-e, the total counts of live bacterial colonies had no significant difference among the groups for either bacteria. This demonstrates that the cobalt-doped titania surfaces do not possess an anti-planktonic bacterial capability against RP62A or SF8300; in other words, they have no bacteria-killing ability in release mode.

3.3. Anti-Adherent Bacterial Activity On this basis, we further investigated the anti-adherent bacterial ability of specimens A-TiO2, Co-TiO2, CoO-TiO2, and Co3O4-TiO2. To visualize the bacterial viability and membrane integrity, a fluorescent-based method was used. As shown in the live/dead fluorescence staining results of RP62A (Figure 3a) and SF8300 (Figure 3b) after 24 h of culturing on various specimens, it was clearly seen that the red fluorescent intensity increased in the order of Co-TiO2, CoO-TiO2, and Co3O4-TiO2, indicating the sharp loss of bacterial viability and membrane integrity. Interestingly, 20 ACS Paragon Plus Environment

Page 20 of 54

Page 21 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


bacteria huddling was observed on CoO-TiO2 and Co3O4-TiO2. Furthermore, from the fluorescence results, only cobalt-doped titania surfaces can kill surface-adhering bacteria. In other words, when a thick layer of bacteria approaches the surface of the heterojunction, only the bottom layer of bacteria in contact with the surface can be killed. Therefore, the upper layer of live bacteria was stained in green fluorescence. Besides, Figure S1 gives the state, morphology, and membrane integrity of the bacteria after culturing RP62A and SF8300 on various specimens for 24 h examined by SEM. For specimen A-TiO2, large amounts of bacteria adhered on the surface and produced continuous biofilms. By contrast, the numbers of adherent bacteria sharply decreased on the surface of specimen Co-TiO2. This became more severe for the bacteria cultured on the surfaces of specimens CoO-TiO2 and Co3O4-TiO2. Furthermore, significant bacteria lysis and huddling were also observed on the two specimens. The fluorescence results agreed well with the SEM observations. These observations

demonstrated

the

favorable

anti-adherent

bacterial

ability

of

cobalt-doped titania films, especially for specimens CoO-TiO2 and Co3O4-TiO2.

3.4. Bacterial Respiratory Gene Expression Analysis The expressions of three genes (cydB, sdhC, and cco-3) of RP62A and SF8300 were analyzed after overnight culturing (Figure 4). For RP62A, the results exhibit that, compared with the A-TiO2 samples, the three selected respiratory genes were downregulated in the CoO-TiO2 and Co3O4-TiO2 samples, and there were significant differences between the A-TiO2 and CoO-TiO2/Co3O4-TiO2 groups, respectively (P < 21 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

0.01). With respect to the expression levels of all the genes, the CoO-TiO2 and Co3O4-TiO2 groups also showed lower levels than the Co-TiO2 group (P < 0.05). However, only for the cydB gene, there was a significant difference between the A-TiO2 and Co-TiO2 groups (P < 0.01). For the cco-3 gene, there was a statistically significant difference between the CoO-TiO2 and Co3O4-TiO2 groups (P < 0.01). For SF8300, we found that, compared with that in the A-TiO2 group, the expression levels of the three selected genes decreased in the groups with cobalt doping, and there were significant differences among the A-TiO2, CoO-TiO2, and Co3O4-TiO2 groups (P < 0.01). For the sdhC gene, there was a significant difference between the A-TiO2 and Co-TiO2 groups (P < 0.05). For the cydB and sdhC genes, the expression levels in the CoO-TiO2 and Co3O4-TiO2 groups were lower than those in the Co-TiO2 group (P < 0.05). Moreover, the expression of all the involved genes in the Co3O4-TiO2 group showed the lowest levels.

3.5. Heterojunction Band Bending and ROS Formation Table 2 lists the data for the energy level positions of TiO2, Co, CoO, and Co3O4. According to these data, the direct physical contact of the Co, CoO, and Co3O4 nanoparticles with TiO2 films forms heterojunctions and leads to band bending. In fact, a metal-semiconductor or semiconductor-semiconductor heterojunction is produced when Co, CoO, and Co3O4 nanoparticles are deposited on TiO2 film, accompanied by Schottky barrier formation and Fermi level alignment at the contact interface48, 49. During this process, electronic charge flow usually occurs. To determine its direction, 22 ACS Paragon Plus Environment

Page 22 of 54

Page 23 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the energy band diagrams of the interconnecting nanomaterials should be taken into consideration. The energy band diagrams of Co-TiO2, CoO-TiO2, and Co3O4-TiO2 are depicted in Figure 5a–d. Indeed, energy-band bending occurs upon heterojunction formation and allows for electronic charge flow. To verify this, the UV-Vis diffuse reflectance spectra of specimens A-TiO2, Co-TiO2, CoO-TiO2, and Co3O4-TiO2 are shown in Figure 5e. The Kubelka–Munk function was utilized to convert the diffuse

( reflectance results into the equivalent absorption coefficient : α = 50

1− R)

2

2R ,

α hν = C1 (hν − Eg )2 , hν = 1240 λ , where α, is the optical absorption coefficient near the absorption edge for indirect interband transition; R is the reflectance of the semiconductor; C1 is the constant for indirect transition; hν is the photon energy; Eg is the indirect bandgap energy (eV); and λ is the wavelength (nm). Figure 5f depicts the (αhν)1/2 plot versus the hν, and the vertical segments of the spectra are extended to intersect with the hν axis to obtain the Eg values of the specimens. The Eg value of specimen A-TiO2 is 3.03 eV, while the Eg values of the cobalt-doped titania specimens apparently decreased in the order of Co-TiO2, CoO-TiO2, and Co3O4-TiO2, which demonstrates the narrowing of the heterojunction bandgap. As shown in Figure 5e–f, the presence of heterojunctions contributes to a red shift of the absorption edge, which narrows the bandgap of the cobalt-titania heterojunction. The narrowed bandgap confirms Schottky barrier formation and Fermi level alignment at the interface of the cobalt-titania heterojunction, which alters its electronic structure and affects its optical properties. To study the potential interactions between bacteria and heterojunctions, Figure 5g-i gives the relationship between the energy band diagrams 23 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

of Co-TiO2, CoO-TiO2, and Co3O4-TiO2 and the BRP of bacteria. It can be clearly seen from the energy band diagrams that the above physical contacts spontaneously produce energy-band bending and promote electron-hole separation at the interface of the heterojunction. Bacteria possess negative membrane potential and electron transport chains. When bacteria approach the heterojunction, they apply an external voltage that drives electron-hole separation at the interface51,

52

. The separated holes (h+) can form

hydroxyl radicals (● OH) by oxidizing water molecules: H2O + h+ → H+ + ●OH. Similarly, the separated electrons (e-) can produce superoxide anion radicals (●O2-) by reducing oxygen molecules: O2 + e- → ●O2-. To validate the theoretical prediction, the heterojunction-induced abiotic ROS, including total ROS, ●OH, and ●O2- levels, were determined; the results are given in Figure 6. For the total abiotic ROS induced by the heterojunctions, the levels were apparently increased in the order of Co-TiO2, CoO-TiO2, and Co3O4-TiO2 (Figure 6a), as determined by incremental energy-band bending at the heterojunction interface. For the hydroxyl radical, the levels also showed a similar uptrend (Figure 6b). Interestingly, for the superoxide anion radical levels, no obvious differences existed between Co3O4-TiO2 and A-TiO2, though the free e- on the Co3O4 side of the heterojunction interface should be able to form ●O2theoretically (Figure 6c). Although we cannot fully understand this result, a recent work by Dong et al. 53 found that Co3O4 nanoparticles possess a superoxide dismutase mimetic activity that can catalyze the disproportionation of superoxide to H2O2 and O2. The high standard redox potential of the Co3+/Co2+ redox couple (1.808 V) makes 24 ACS Paragon Plus Environment

Page 24 of 54

Page 25 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Co3O4 nanoparticles efficient scavengers for ●O2-. According to this, the Co3O4-TiO2 heterojunction may not be able to induce ●O2-.54 Further, the ●O2- levels of Co-TiO2 and CoO-TiO2 showed no obvious difference from that of A-TiO2, which may be due to the presence of redox reactions: Co2+ + ●O2- + 2H+ → Co3+ + H2O2; Co2+ + H2O2 + 2H+ → Co3+ + 2H2O; 2Co2+ + H2O2 → 2Co3+ + 2OH-.53 The bacteria oxidative damage caused by the induced abiotic ROS contributes to the antibacterial ability of the cobalt-titania heterojunctions. Since ROS can only exist in a short time and can only migrate a short distance, the cobalt-doped TiO2 heterojunctions only exhibit the inactivation effect on surface-adherent bacteria. To further demonstrate the role of heterojunction-induced oxidative stress in bacteria inactivation, we co-incubated RP62A and SF8300 with 10 mM of GSH, the major endogenous antioxidant in bacteria55, to alleviate or eliminate the contribution of oxidative stress to bacterial viability loss. As shown in Figure 6d, using live/dead fluorescence staining, bacteria co-incubation with GSH can effectively repair the viability of RP62A and SF8300 and reduce the antibacterial ability of cobalt-titania heterojunctions.

3.6. In Vivo Antibacterial Property 3.6.1 Clinical Assessment There were no deaths or severe postoperative complications among the groups over the 6-week follow-up period. Three rats in groups I and II exhibited moderate swelling around their surgical wounds 1 week after surgery, whereas the remaining animals showed no obvious suppuration or exudation. 25 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

The temperatures of all the animals held stable and normal, without significant differences among the various groups (P > 0.05), as seen in Figure S4a. The body weights of all the rats gradually decreased from weeks 0 to 4 after surgery but increased at the following time point, as shown in Figure S4b. Compared with CoO-TiO2 and Co3O4-TiO2, A-TiO2 and Co-TiO2 had more weight loss at 2 post-operative weeks (P < 0.001). At 4 weeks after operation, the weight loss of A-TiO2 was significantly higher than those of the other three groups (P < 0.01), and Co3O4-TiO2 had less weight loss compared with Co-TiO2 (P < 0.001). However, compared with A-TiO2, CoO-TiO2 and Co3O4-TiO2 had more weight gain at 6 post-operative weeks (P < 0.01). The corresponding data are recorded in Table 3.

3.6.2. Radiographic Evaluation Figure 7a shows the X-ray images of the femurs of the four groups. No radiographic signs of osteolysis or periosteal reaction were detected at 0 week (the second day after surgery) in any of the groups. However, after 2 weeks, radiographic signs of periosteal reaction and osseous destruction around the rod were obvious in A-TiO2. The femurs in Co-TiO2 presented slight bone destruction and periosteal reaction. Little osseous destruction was detected in CoO-TiO2 and Co3O4-TiO2. At 4 weeks after operation, bacterial infection developed in A-TiO2, as demonstrated by the progress of the periosteal reaction and the exacerbation of osteolysis surrounding the implant. However, the X-ray images of the other three groups indicate relatively mild osseous destruction and periosteal reaction. At 6 weeks, implant-related bone 26 ACS Paragon Plus Environment

Page 26 of 54

Page 27 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


infection on A-TiO2 did not deteriorate with time, and no obvious evidence indicates the further development of periosteal reaction or osseous destruction. We are aware of the stimulation of bone formation due to the periosteal reaction. However, almost no indication of bacterial infection was found among the implanted cobalt samples. The difference between CoO-TiO2 and Co3O4-TiO2 was negligible, suggesting the good antimicrobial activity of the implanted cobalt samples in vivo. Figure 7c shows the quantitative analysis of the X-ray plain films, revealing that A-TiO2 had increasing radiographic scores during the 6 weeks, and Co-TiO2 and CoO-TiO2 had lower scores, especially for CoO-TiO2, which was significantly different from those of A-TiO2 at each time point (P < 0.05). In addition, at 4 and 6 weeks, CoO-TiO2 had lower scores than Co-TiO2, with a statistical difference of P < 0.01. Furthermore, Co3O4-TiO2 maintained relatively steady and the lowest scores over the course of the follow-up period, especially at 6 weeks. Overall, the radiographic scores decreased over time, in the order of A-TiO2, Co-TiO2, CoO-TiO2 and Co3O4-TiO2. The aforementioned radiographic results were further verified by micro-CT analyses 6 weeks after surgery (Figure 7b). Visible periprosthetic osteolysis and porous changes throughout the femur were detected in A-TiO2, and slight implant loosening and porous changes were detected in Co-TiO2. By contrast, CoO-TiO2 and Co3O4-TiO2 displayed favorable implant osseointegration and cortical integrity. We also completed quantitative analyses of the micro-CT results. Concerning the bone volume/total volume (Figure 7d), the trend was in the rising order of A-TiO2, Co-TiO2, CoO-TiO2 and Co3O4-TiO2. The difference between the latter two groups 27 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

and the former two groups was significant (P < 0.05). For cortical bone mineral density (Figure 7e), the trend was in the rising order of A-TiO2, Co-TiO2, CoO-TiO2 and Co3O4-TiO2. The last group had a higher cortical bone mineral density than the first group (P < 0.05).

3.6.3. Microbiological Evaluation All cultures from the four groups were completed under sterile conditions and were incubated in a thermotank for 24 h. The number of bacterial colonies dislodged from the metal rods demonstrated the following trend: A-TiO2 > Co-TiO2 > CoO-TiO2 > Co3O4-TiO2 (Figure 7f). With respect to the results of the adhered bacteria, there were significant statistical differences among the four groups, and the cultures acquired from group Co3O4-TiO2 exhibited the least amount of bacteria. Groups Co-TiO2 and CoO-TiO2 also showed a significantly lower bacterial burden compared with group A-TiO2 (P < 0.05). We also evaluated the bacterial burden cultured from the powder bones in the four groups. As shown in Figure 7g, the quantity of CFU per gram of femur showed the following trend: A-TiO2 > Co-TiO2 > CoO-TiO2 > Co3O4-TiO2. The lowest bacterial amount was observed in group Co3O4-TiO2, and no significant difference was observed between groups A-TiO2 and Co-TiO2. Group CoO-TiO2 also revealed significantly lower CFU compared with groups A-TiO2 and Co-TiO2 (P < 0.001).

3.6.4. Histological Evaluation 28 ACS Paragon Plus Environment

Page 28 of 54

Page 29 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The histopathological changes of the femurs in the four groups were assessed by H&E staining, and the bacterial residue was verified by Giemsa staining. The longitudinal decalcified sections from the various groups are shown in Figure 8. In group A-TiO2, the histological slices of H&E staining exhibited typical signs of bone infection in the femurs, as demonstrated by the obvious destruction of the cancellous bone, the intramedullary abscesses, and inflammatory cell infiltration in the bone-implant interface. Further, many bacteria were found in the intramedullary tissue through the slice of Giemsa staining. In groups Co-TiO2 and CoO-TiO2, there was slight bone destruction, moderate abscess lesions, and less inflammatory cell infiltration; the amount of bacteria in the Giemsa-stained bone tissue seemed to be reduced compared with those of group A-TiO2. In addition, the mildest bone infection and least amount of bacterial residue were observed in group Co3O4-TiO2.

4. DISCUSSION As evidenced above, since the cobalt-titania heterojunctions only possess an anti-adherent bacterial capability in contact-killing mode rather than in release-killing mode, one can infer that the surfaces of the heterojunctions should have long-term anti-adherent bacteria properties, even if they are immersed in an aqueous environment for a long period. Indeed, in this study, we first soaked all the specimens in PBS solution for 8 weeks. After, we performed an anti-adherent bacterial property assay using live/dead fluorescent staining to visualize the bacterial viability and membrane integrity. As seen in Figure S2, compared with specimen A-TiO2, the 29 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

green fluorescence of live adherent bacteria on the surface gradually weakened, and the red fluorescence sharply intensified in the order of Co-TiO2, CoO-TiO2, and Co3O4-TiO2, demonstrating significant bacterial inactivation and membrane integrity damage. As a result, the surfaces of the heterojunctions were confirmed to possess long-term anti-adherent bacterial capabilities. The surface physical and chemical properties of biomaterials play a crucial role in bacterial adhesion and viability. Firstly, although the sizes of CoOx nanoparticles were tuned at the similar scale, the potential influence of surface structure difference should be elucidated since nanostructures can reduce bacterial adhesion and viability56. In the absence of oxidative stress by adding GSH, the viability of adherent bacteria showed no significant difference among various samples. This may indicate the negligible effect of the prepared surface structures on bacterial viability. Then, the surface potentials also showed difference among groups (Figure 1m). Relatively positive surface potentials can promote bacterial adhesion via the electrostatic interaction between samples and negatively charged bacterial membranes. Nevertheless, this cannot explain the relationship between antibacterial properties and surface potentials in this study. Therefore, other mechanism may exist behind the antibacterial actions of the prepared heterojunctions. Bacteria perform respiration to supply energy for vital movement.57 This process requires extracellular electron acceptors to achieve electron transfer in respiratory chain.58 An electron conduit consisting of respiratory proteins exists between bacterial membrane and extracellular environment to produce energy.59 In this context, 30 ACS Paragon Plus Environment

Page 30 of 54

Page 31 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


interruption of electron transfer may cause bacteria inactivation. Burello et al.28, 29 proposed a theoretical model using the relationship between cellular redox potential and metal oxide nanoparticle bandgap to understand nanomaterial-induced oxidative stress and cytotoxicity. The oxidative stress potential of heterojunctions may be predictable by comparing their energy levels (Ec, Ev, Ef) with bacterial BRP. Meanwhile, bacteria maintain negative resting membrane potential (–200 mV to –20 mV).51 If the physical contact of bacteria-on-substrate can produce a conductive circuit for electron transfer, bacteria may continuously lose electrons driven by negative membrane potential. Thus, the conductivity or band structure of underlying substrate material may have an important impact on bacterial response. Meanwhile, the bacterial energy states similar to or higher than those of heterojunctions will allow the electron transfer from membrane respiratory chain to heterojunctions.28,

29

Therefore, regulation of substrate band structure or conductivity should be able to affect bacterial behavior. As evidenced in Figure 5a-f, the energy band diagrams and the UV-Vis results of these heterojunctions apparently indicate their band bending and bandgap narrowing in the order of A-TiO2 < Co-TiO2 < CoO-TiO2 < Co3O4-TiO2. The band bending and bandgap narrowing can enhance the substrate conductivity, which will contribute to the electron transfer from bacteria to substrate. Figure 5g shows the energy level structure of bacteria on Co3O4-TiO2 contact. Due to the larger degree of heterojunction bandgap narrowing, the membrane electrons tend to transfer easily from bacteria to substrate. The destructive electron extraction can reduce bacteria proliferation and viability.51, 60 Similarly, from the energy level structure of bacteria on 31 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 54

CoO-TiO2 contact (Figure 5h), the electrons can be extracted by substrate from bacterial membrane, though less effective than Co3O4-TiO2 owing to the lower degree of heterojunction bandgap narrowing. By contrast, Co-TiO2 has the less effective electron extraction ability from bacteria than Co3O4-TiO2 and CoO-TiO2 due to the lowest degree of bandgap narrowing (Figure 5i). As evidenced in this work clearly, the electron extraction ability has a strong dependence on the substrate conductivity or band structure, and larger degree of bandgap narrowing or conductivity increase can cause more destructive effect on bacteria viability and produce better antibacterial outcome. This destructive interruption of electron transfer can elevate intracellular ROS production, decrease intracellular antioxidant level and upset cellular redox homeostasis, which finally causes the oxidative stress-mediated bacterial respiration damage and viability loss. This strategy of regulation of substrate conductivity or band structure has been applied to noble metal24,

60-62

or graphene51,

63

based

heterojunctions and amorphous material64 for antibacterial purpose. Nevertheless, further study is required to understand the exact antibacterial mechanism. In fact, biophysical stimulation method can also induce bactericidal effect, for example, electric or magnetic field stimulation65. Electric field stimulation can increase the cellular membrane permeability, known as electropermeabilization or irreversible electroporation, and promote the bactericidal behavior. A recent study confirmed the synergistic anti-biofilm behavior of hydroxyapatite-zinc oxide (HA-ZnO) composites and direct current electric field, which was mediated by the ROS production and bacterial membrane depolarization66. Under an external magnetic 32 ACS Paragon Plus Environment

Page 33 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


field, the Lorentzian force is involved in ion interference mechanism for the transport of essential ions across bacterial membrane and can cause osmotic imbalance and membrane rupture. As a result, magnetic field stimulation can exhibit favorable bactericidal effect67-69. In addition, the designed heterojunctions’ surface possessed favorable cytocompatibility for rat bone marrow mesenchymal stem cells and human osteoblast-like cell line MG63, as shown in Figure S3. Bacteria and cells exhibit different responses to the cobalt-titania heterojunction surface. For bacteria, the BRP of –4.12 eV to –4.84 eV mainly comes from a series of redox couples located in membrane

respiratory

electron

transport

chain,

such

as

NADP+/NADPH,

NAD+/NADH, etc., while, for cells, the BRP mainly results from a series of redox couples located in mitochondrial respiratory electron transport chain. According to endosymbiotic theory (symbiogenesis), prokaryote bacteria is an analogue of eukaryotic mitochondria. As a result, when bacteria adheres on the heterojunctions’ surface, the abiotic ROS perturbs the membrane respiratory electron transport chain. Meanwhile, the inhibition of the electron transport chain elevates the intracellular ROS level25. Both features simultaneously contribute to oxidative damage, which triggers the downregulation of bacterial respiration gene expression and the destruction of bacterial viability and may account for the different behavioral responses of the bacteria and cells to the designed heterojunctions. Currently many reports focus on the surface antibacterial design of implants using silver cations70, antimicrobial peptides71, 72, cationic polymers73 and antibiotics74. 33 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

However, these strategies have some concomitant issues including the potential toxicity of metal cations to cells and organs, the enzymolysis of peptides by body, and the antibiotic resistance. Besides, there strategies kill bacteria mainly through a release mode, so the long-term effect should also be concerned. The present strategy combat bacteria through a contact killing mode, independent of cation release, and thus should have long-term antibacterial effect. It was shown that the released Co2+ ions at ~17 ppm from cobalt-doped bioactive glass did not possess antibacterial ability33. Another work found that CoO nanosheets at 500 ppm exhibited good antibacterial property75. For Co3O4 nanoparticles, the minimum bactericidal concentration was 128 ppm and the released free cobalt ions were responsible for the antibacterial activity of nanoparticles76. Herein, by constructing the heterostructures of Co-TiO2, CoO-TiO2, and Co3O4-TiO2, it can be achieved to engineer the energy band structures of these heterojunctions and study the bacterial oxidative stress response upon exposure to them. The cobalt-titania heterojunctions were able to induce ROS-mediated oxidative damage to the respiration and viability of surface-adherent bacteria on biomaterials, exhibiting favorable anti-infection effect and good cytocompatibility. Nevertheless, future efforts are needed to unravel the exact molecular mechanism of the interactions among heterojunctions, bacteria, and human cells. The anti-infection efficiency and universality of the designed heterojunctions should be further explored using more epidemic clinical bacteria strains for pre-clinical study to promote the potential clinical application of cobalt-based antibacterial nanomaterials in the orthopedic field. On the other hand, 34 ACS Paragon Plus Environment

Page 34 of 54

Page 35 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


from clinical perspective, many implant infections do not require bacteria to reside on the implant in bone and the contact killing of adherent bacteria is often not sufficient to prevent implant infection77. The designed antibacterial surface can only show bactericidal effect on the adherent bacteria on implant, rather than on the planktonic bacteria in peri-implant fluids and tissues. It seems not comparable with the many fold reduction in CFU with clinically used drugs since the latter can not only effectively kill adherent bacteria, but also powerfully destroy planktonic bacteria. Our recent work combined the contact-killing Ag-implanted TiO2 nanotubes with release-killing loaded vancomycin and achieved superior antibacterial outcome in soft tissue infection model, with significant difference of CFU reduction by loading vancomycin, exhibiting synergistic antibacterial effect21. Therefore, it is highly necessary to further design powerful antibacterial surface that can release antimicrobial agents (cobalt, silver, antibiotics, antimicrobial peptides, etc.) to kill planktonic bacteria that can often colonize soft tissues and to better meet the clinical needs.

5. CONCLUSIONS In the present work, we designed TiO2-based heterojunctions including Co-TiO2, CoO-TiO2 and Co3O4-TiO2, through the optimization of magnetron sputtering. The construction of heterojunctions can effectively promote energy band bending and band gap narrowing at the contact interface of cobalt nanoparticles and titania films. The cobalt-doped titania heterojunctions have the ability to induce abiotic ROS. In vitro study showed that these heterojunctions can downregulate the expression levels 35 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

of respiratory genes and cause oxidative damage to the membrane respiration and cellular viability of methicillin-resistant S. aureus and S. epidermidis, especially for Co3O4-TiO2, thus exhibiting favorable anti-adherent bacterial ability in contact mode. The pre-clinical study using osteomyelitis model further demonstrated the favorable anti-infection effect of the elaborately designed cobalt nanoparticles modified TiO2 heterojunctions. We hope this work can provide new insights into using energy band engineering to improve the antibacterial ability of TiO2-based biomaterials for both research and clinical needs.

ASSOCIATED CONTENT Supporting Information The Supporting information is available free of charge on the ACS Publications website (http://pubs.acs.org) at DOI: Relevant experimental details pertaining to cell culture, viability evaluation, and adhesion observation; Figures S1-S4 (PDF).

AUTHOR INFORMATION Corresponding Author Xuanyong Liu. E-mail: [email protected] Xianlong Zhang. E-mail: [email protected] Kelvin W. K. Yeung. E-mail: [email protected] Notes 36 ACS Paragon Plus Environment

Page 36 of 54

Page 37 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The authors declare no competing financial interest.

ACKNOWLEDGMENTS The authors are grateful to the financial support by National Science Foundation for Distinguished Young Scholars of China (51525207), National Natural Science Foundation of China (81271962, 81472109), Shanghai Committee of Science and Technology, China (15441904900, 14XD1403900), Hong Kong Research Grants Council-General Research Fund (718913), Shenzhen Science and Technology Funding (JCYJ20160429185449249).

REFERENCES (1) Campoccia, D.; Montanaro, L.; Arciola, C. R. The Significance of Infection Related to Orthopedic Devices and Issues of Antibiotic Resistance. Biomaterials 2006, 27, 2331-2339. (2) Campoccia, D.; Montanaro, L.; Arciola, C. R. A Review of the Clinical Implications of Anti-Infective Biomaterials and Infection-Resistant Surfaces. Biomaterials 2013, 34, 8018-8029. (3) Campoccia, D.; Montanaro, L.; Arciola, C. R. A Review of the Biomaterials Technologies for Infection-Resistant Surfaces. Biomaterials 2013, 34, 8533-8554. (4) Cohen, M. L. Changing Patterns of Infectious Disease. Nature 2000, 406, 762-767. (5) Li, M.; Du, X.; Villaruz, A. E.; Diep, B. A.; Wang, D.; Song, Y.; Tian, Y.; Hu, J.; Yu, F.; Lu, Y., et al. MRSA Epidemic Linked to a Quickly Spreading Colonization and Virulence Determinant. Nat. Med. 2012, 18, 816-819. (6) Subhankari Prasad, C.; Sumanta Kumar, S.; Santanu Kar, M.; Susmita, S.; Manjusri, B.; Somenath, R.; Panchanan, P. Nanoconjugated Vancomycin: New Opportunities for the Development of Anti-VRSA Agents. Nanotechnology 2010, 21, 105103. (7) Périchon, B.; Courvalin, P. VanA-Type Vancomycin-Resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 2009, 53, 4580-4587. (8) Gold, H. S.; Moellering, R. C. Antimicrobial-Drug Resistance. N. Engl. J. Med. 1996, 335, 1445-1453. (9) Boucher, H. W.; Talbot, G. H.; Bradley, J. S.; Edwards, J. E.; Gilbert, D.; Rice, L. 37 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

B.; Scheld, M.; Spellberg, B.; Bartlett, J. Bad Bugs, No Drugs: No ESKAPE! An Update from the Infectious Diseases Society of America. Clin. Infect. Dis. 2009, 48, 1-12. (10) Hasan, J.; Crawford, R. J.; Ivanova, E. P. Antibacterial Surfaces: the Quest for a New Generation of Biomaterials. Trends Biotechnol. 2013, 31, 295-304. (11) Cloutier, M.; Mantovani, D.; Rosei, F. Antibacterial Coatings: Challenges, Perspectives, and Opportunities. Trends Biotechnol. 2015, 33, 637-652. (12) Hajipour, M. J.; Fromm, K. M.; Akbar Ashkarran, A.; Jimenez de Aberasturi, D.; Larramendi, I. R. d.; Rojo, T.; Serpooshan, V.; Parak, W. J.; Mahmoudi, M. Antibacterial Properties of Nanoparticles. Trends Biotechnol. 2012, 30, 499-511. (13) Huh, A. J.; Kwon, Y. J. “Nanoantibiotics”: A New Paradigm for Treating Infectious Diseases Using Nanomaterials in the Antibiotics Resistant Era. J. Controlled Release 2011, 156, 128-145. (14) Zhao, Y.; Jiang, X. Multiple Strategies to Activate Gold Nanoparticles As Antibiotics. Nanoscale 2013, 5, 8340-8350. (15) Fujishima, A.; Zhang, X.; Tryk, D. A. TiO2 Photocatalysis and Related Surface Phenomena. Surf. Sci. Rep. 2008, 63, 515-582. (16) Chen, X.; Mao, S. S. Titanium Dioxide Nanomaterials: Synthesis, Properties, Modifications, and Applications. Chem. Rev. 2007, 107, 2891-2959. (17) Xu, J.-W.; Gao, Z.-D.; Han, K.; Liu, Y.; Song, Y.-Y. Synthesis of Magnetically Separable Ag3PO4/TiO2/Fe3O4 Heterostructure with Enhanced Photocatalytic Performance under Visible Light for Photoinactivation of Bacteria. ACS Appl. Mater. Interfaces 2014, 6, 15122-15131. (18) Xu, J.; Zhou, X.; Gao, Z.; Song, Y.-Y.; Schmuki, P. Visible-Light-Triggered Drug Release from TiO2 Nanotube Arrays: A Controllable Antibacterial Platform. Angew. Chem., Int. Ed. 2016, 55, 593-597. (19) Xu, J.; Li, Y.; Zhou, X.; Li, Y.; Gao, Z.-D.; Song, Y.-Y.; Schmuki, P. Graphitic C3N4-Sensitized TiO2 Nanotube Layers: A Visible-Light Activated Efficient Metal-Free Antimicrobial Platform. Chem. - Eur. J. 2016, 22, 3947-3951. (20) Mei, S.; Wang, H.; Wang, W.; Tong, L.; Pan, H.; Ruan, C.; Ma, Q.; Liu, M.; Yang, H.; Zhang, L., et al. Antibacterial Effects and Biocompatibility of Titanium Surfaces with Graded Silver Incorporation in Titania Nanotubes. Biomaterials 2014, 35, 4255-4265. (21) Wang, J.; Li, J.; Qian, S.; Guo, G.; Wang, Q.; Tang, J.; Shen, H.; Liu, X.; Zhang, X.; Chu, P. K. Antibacterial Surface Design of Titanium-Based Biomaterials for Enhanced Bacteria-Killing and Cell-Assisting Functions Against Periprosthetic Joint Infection. ACS Appl. Mater. Interfaces 2016, 8, 11162–11178. (22) Cao, H.; Qiao, Y.; Meng, F.; Liu, X. Spacing-Dependent Antimicrobial Efficacy of Immobilized Silver Nanoparticles. J. Phys. Chem. Lett. 2014, 5, 743-748. (23) Cao, H.; Qiao, Y.; Liu, X.; Lu, T.; Cui, T.; Meng, F.; Chu, P. K. Electron Storage Mediated Dark Antibacterial Action of Bound Silver Nanoparticles: Smaller Is Not Always Better. Acta Biomater. 2013, 9, 5100-5110. (24) Pang, M.; Hu, J.; Zeng, H. C. Synthesis, Morphological Control, and Antibacterial Properties of Hollow/Solid Ag2S/Ag Heterodimers. J. Am. Chem. Soc. 38 ACS Paragon Plus Environment

Page 38 of 54

Page 39 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2010, 132, 10771-10785. (25) Su, H.-L.; Chou, C.-C.; Hung, D.-J.; Lin, S.-H.; Pao, I. C.; Lin, J.-H.; Huang, F.-L.; Dong, R.-X.; Lin, J.-J. The Disruption of Bacterial Membrane Integrity through ROS Generation Induced by Nanohybrids of Silver and Clay. Biomaterials 2009, 30, 5979-5987. (26) Gunawan, C.; Teoh, W. Y.; Marquis, C. P.; Amal, R. Cytotoxic Origin of Copper(II) Oxide Nanoparticles: Comparative Studies with Micron-Sized Particles, Leachate, and Metal Salts. ACS Nano 2011, 5, 7214-7225. (27) Gao, A.; Hang, R.; Huang, X.; Zhao, L.; Zhang, X.; Wang, L.; Tang, B.; Ma, S.; Chu, P. K. The Effects of Titania Nanotubes with Embedded Silver Oxide Nanoparticles on Bacteria and Osteoblasts. Biomaterials 2014, 35, 4223-4235. (28) Burello, E.; Worth, A. P. A Theoretical Framework for Predicting the Oxidative Stress Potential of Oxide Nanoparticles. Nanotoxicology 2010, 5, 228-235. (29) Burello, E.; Worth, A. P. QSAR Modeling of Nanomaterials. Wiley Interdiscip. Rev.: Nanomed. Nanobiotechnol. 2011, 3, 298-306. (30) Nel, A. E.; Madler, L.; Velegol, D.; Xia, T.; Hoek, E. M. V.; Somasundaran, P.; Klaessig, F.; Castranova, V.; Thompson, M. Understanding Biophysicochemical Interactions at the Nano-Bio Interface. Nat. Mater. 2009, 8, 543-557. (31) Tung, R. T. The Physics and Chemistry of the Schottky Barrier Height. Appl. Phys. Rev. 2014, 1, 011304. (32) Nel, A.; Xia, T.; Mädler, L.; Li, N. Toxic Potential of Materials at the Nanolevel. Science 2006, 311, 622-627. (33) Wu, C.; Zhou, Y.; Fan, W.; Han, P.; Chang, J.; Yuen, J.; Zhang, M.; Xiao, Y. Hypoxia-Mimicking Mesoporous Bioactive Glass Scaffolds with Controllable Cobalt Ion Release for Bone Tissue Engineering. Biomaterials 2012, 33, 2076-2085. (34) Fan, W.; Crawford, R.; Xiao, Y. Enhancing In Vivo Vascularized Bone Formation by Cobalt Chloride-Treated Bone Marrow Stromal Cells in a Tissue Engineered Periosteum Model. Biomaterials 2010, 31, 3580-3589. (35) Inzana, J. A.; Schwarz, E. M.; Kates, S. L.; Awad, H. A. Biomaterials Approaches to Treating Implant-Associated Osteomyelitis. Biomaterials 2016, 81, 58-71. (36) Tan, H.; Peng, Z.; Li, Q.; Xu, X.; Guo, S.; Tang, T. The Use of Quaternised Chitosan-Loaded PMMA to Inhibit Biofilm Formation and Downregulate the Virulence-Associated Gene Expression of Antibiotic-Resistant Staphylococcus. Biomaterials 2012, 33, 365-77. (37) Chin, R. M.; Fu, X.; Pai, M. Y.; Vergnes, L.; Hwang, H.; Deng, G.; Diep, S.; Lomenick, B.; Meli, V. S.; Monsalve, G. C., et al. The Metabolite α-Ketoglutarate Extends Lifespan by Inhibiting ATP Synthase and TOR. Nature 2014, 510, 397-401. (38) Ishibashi, K.-i.; Fujishima, A.; Watanabe, T.; Hashimoto, K. Detection of Active Oxidative Species in TiO2 Photocatalysis Using the Fluorescence Technique. Electrochem. Commun. 2000, 2, 207-210. (39) Brunet, L.; Lyon, D. Y.; Hotze, E. M.; Alvarez, P. J. J.; Wiesner, M. R. Comparative Photoactivity and Antibacterial Properties of C60 Fullerenes and Titanium Dioxide Nanoparticles. Environ. Sci. Technol. 2009, 43, 4355-4360. (40) Vecitis, C. D.; Zodrow, K. R.; Kang, S.; Elimelech, M. 39 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Electronic-Structure-Dependent Bacterial Cytotoxicity of Single-Walled Carbon Nanotubes. ACS Nano 2010, 4, 5471-5479. (41) Rissing, J. P.; Buxton, T. B.; Weinstein, R. S.; Shockley, R. K. Model of Experimental Chronic Osteomyelitis in Rats. Infect. Immun. 1985, 47, 581-6. (42) Yang, Y.; Ao, H. Y.; Yang, S. B.; Wang, Y. G.; Lin, W. T.; Yu, Z. F.; Tang, T. T. In Vivo Evaluation of the Anti-Infection Potential of Gentamicin-Loaded Nanotubes on Titania Implants. Int. J. Nanomed. 2016, 11, 2223-34. (43) Lucke, M.; Schmidmaier, G.; Sadoni, S.; Wildemann, B.; Schiller, R.; Haas, N. P.; Raschke, M. Gentamicin Coating of Metallic Implants Reduces Implant-Related Osteomyelitis in Rats. Bone 2003, 32, 521-31. (44) Wang, G.; Li, J.; Lv, K.; Zhang, W.; Ding, X.; Yang, G.; Liu, X.; Jiang, X. Surface Thermal Oxidation on Titanium Implants to Enhance Osteogenic Activity and In Vivo Osseointegration. Sci. Rep. 2016, 6, 31769. (45) Xiong, S.; Chen, J. S.; Lou, X. W.; Zeng, H. C. Mesoporous Co3O4 and CoO@C Topotactically Transformed from Chrysanthemum-like Co(CO3)0.5(OH)·0.11H2O and Their Lithium-Storage Properties. Adv. Funct. Mater. 2012, 22, 861-871. (46) Wang, H.; Chen, C.; Zhang, Y.; Peng, L.; Ma, S.; Yang, T.; Guo, H.; Zhang, Z.; Su, D. S.; Zhang, J. In Situ Oxidation of Carbon-Encapsulated Cobalt Nanocapsules Creates Highly Active Cobalt Oxide Catalysts for Hydrocarbon Combustion. Nat. Commun. 2015, 6, 7181. (47) Tan, B. J.; Klabunde, K. J.; Sherwood, P. M. A. XPS Studies of Solvated Metal Atom Dispersed (SMAD) Catalysts. Evidence for Layered Cobalt-Manganese Particles on Alumina and Silica. J. Am. Chem. Soc. 1991, 113, 855-861. (48) Ulrike, D. The Surface Science of Titanium Dioxide. Surf. Sci. Rep. 2003, 48, 53-229. (49) Kudo, A.; Miseki, Y. Heterogeneous Photocatalyst Materials for Water Splitting. Chem. Soc. Rev. 2009, 38, 253-278. (50) Ng, J.; Xu, S.; Zhang, X.; Yang, H. Y.; Sun, D. D. Hybridized Nanowires and Cubes: A Novel Architecture of a Heterojunctioned TiO2/SrTiO3 Thin Film for Efficient Water Splitting. Adv. Funct. Mater. 2010, 20, 4287-4294. (51) Li, J.; Wang, G.; Zhu, H.; Zhang, M.; Zheng, X.; Di, Z.; Liu, X.; Wang, X. Antibacterial Activity of Large-Area Monolayer Graphene Film Manipulated by Charge Transfer. Sci. Rep. 2014, 4, 4359. (52) Bardeen, J. Research Leading to Point-Contact Transistor. Science 1957, 126, 105. (53) Dong, J.; Song, L.; Yin, J.-J.; He, W.; Wu, Y.; Gu, N.; Zhang, Y. Co3O4 Nanoparticles with Multi-Enzyme Activities and Their Application in Immunohistochemical Assay. ACS Appl. Mater. Interfaces 2014, 6, 1959-1970. (54) Zhang, H.; Pokhrel, S.; Ji, Z.; Meng, H.; Wang, X.; Lin, S.; Chang, C. H.; Li, L.; Li, R.; Sun, B., et al. PdO Doping Tunes Band-Gap Energy Levels as Well as Oxidative Stress Responses to a Co3O4 p-Type Semiconductor in Cells and the Lung. J. Am. Chem. Soc. 2014, 136, 6406-6420. (55) Fahey, R. C.; Brown, W. C.; Adams, W. B.; Worsham, M. B. Occurrence of Glutathione in Bacteria. J. Bacteriol. 1978, 133, 1126-1129. 40 ACS Paragon Plus Environment

Page 40 of 54

Page 41 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(56) Puckett, S. D.; Taylor, E.; Raimondo, T.; Webster, T. J. The Relationship between the Nanostructure of Titanium Surfaces and Bacterial Attachment. Biomaterials 2010, 31, 706-713. (57) Reece, S. Y.; Nocera, D. G. Proton-Coupled Electron Transfer in Biology: Results from Synergistic Studies in Natural and Model Systems. Annu. Rev. Biochem. 2009, 78, 673-699. (58) Myers, C. R.; Nealson, K. H. Bacterial Manganese Reduction and Growth with Manganese Oxide as the Sole Electron Acceptor. Science 1988, 240, 1319. (59) Hartshorne, R. S.; Reardon, C. L.; Ross, D.; Nuester, J.; Clarke, T. A.; Gates, A. J.; Mills, P. C.; Fredrickson, J. K.; Zachara, J. M.; Shi, L., et al. Characterization of an Electron Conduit between Bacteria and the Extracellular Environment. Proc. Natl. Acad. Sci. U. S. A. 2009, 106, 22169-22174. (60) Wang, G.; Feng, H.; Gao, A.; Hao, Q.; Jin, W.; Peng, X.; Li, W.; Wu, G.; Chu, P. K. Extracellular Electron Transfer from Aerobic Bacteria to Au-Loaded TiO2 Semiconductor without Light: A New Bacteria-Killing Mechanism Other than Localized Surface Plasmon Resonance or Microbial Fuel Cells. ACS Appl. Mater. Interfaces 2016, 8, 24509-24516. (61) Wang, G.; Jin, W.; Qasim, A. M.; Gao, A.; Peng, X.; Li, W.; Feng, H.; Chu, P. K. Antibacterial Effects of Titanium Embedded with Silver Nanoparticles Based on Electron-Transfer-Induced Reactive Oxygen Species. Biomaterials 2017, 124, 25–34. (62) Li, J.; Zhou, H.; Qian, S.; Liu, Z.; Feng, J.; Jin, P.; Liu, X. Plasmonic Gold Nanoparticles Modified Titania Nanotubes for Antibacterial Application. Appl. Phys. Lett. 2014, 104, 261110. (63) Li, J.; Wang, G.; Zhang, W.; Jin, G.; Zhang, M.; Jiang, X.; Di, Z.; Liu, X.; Wang, X. Graphene Film-Functionalized Germanium as a Chemically Stable, Electrically Conductive, and Biologically Active Substrate. J. Mater. Chem. B 2015, 3, 1544-1555. (64) Li, J.; Guo, G.; Wang, J.; Zhou, H.; Shen, H.; Yeung, K. W. K. Anti-Biofouling Function of Amorphous Nano-Ta2O5 Coating for VO2-Based Intelligent Windows. Nanotechnology 2017, 28, 175705. (65) Boda, S. K.; Basu, B. Engineered Biomaterial and Biophysical Stimulation as Combinatorial Strategies to Address Prosthetic Infection by Pathogenic Bacteria. J. Biomed. Mater. Res., Part B 2016, n/a-n/a. (DOI: 10.1002/jbm.b.33740) (66) Boda, S. K.; Bajpai, I.; Basu, B. Inhibitory Effect of Direct Electric Field and HA-ZnO Composites on S. Aureus Biofilm Formation. J. Biomed. Mater. Res., Part B 2016, 104, 1064-1075. (67) Bajpai, I.; Saha, N.; Basu, B. Moderate Intensity Static Magnetic Field Has Bactericidal Effect on E. Coli and S. Epidermidis on Sintered Hydroxyapatite. J. Biomed. Mater. Res., Part B 2012, 100B, 1206-1217. (68) Bajpai, I.; Balani, K.; Basu, B. Synergistic Effect of Static Magnetic Field and HA-Fe3O4 Magnetic Composites on Viability of S. Aureus and E. Coli Bacteria. J. Biomed. Mater. Res., Part B 2014, 102, 524-532. (69) Boda, S. K.; Ravikumar, K.; Saini, D. K.; Basu, B. Differential Viability Response of Prokaryotes and Eukaryotes to High Strength Pulsed Magnetic Stimuli. 41 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Bioelectrochemistry 2015, 106, Part B, 276-289. (70) Taheri, S.; Cavallaro, A.; Christo, S. N.; Smith, L. E.; Majewski, P.; Barton, M.; Hayball, J. D.; Vasilev, K. Substrate Independent Silver Nanoparticle Based Antibacterial Coatings. Biomaterials 2014, 35, 4601-4609. (71) Chen, R.; Willcox, M. D. P.; Ho, K. K. K.; Smyth, D.; Kumar, N. Antimicrobial Peptide Melimine Coating for Titanium and Its In Vivo Antibacterial Activity in Rodent Subcutaneous Infection Models. Biomaterials 2016, 85, 142-151. (72) Yu, K.; Lo, J. C. Y.; Yan, M.; Yang, X.; Brooks, D. E.; Hancock, R. E. W.; Lange, D.; Kizhakkedathu, J. N. Anti-Adhesive Antimicrobial Peptide Coating Prevents Catheter Associated Infection in a Mouse Urinary Infection Model. Biomaterials 2017, 116, 69-81. (73) Ding, X.; Yang, C.; Lim, T. P.; Hsu, L. Y.; Engler, A. C.; Hedrick, J. L.; Yang, Y.-Y. Antibacterial and Antifouling Catheter Coatings Using Surface Grafted PEG-b-Cationic Polycarbonate Diblock Copolymers. Biomaterials 2012, 33, 6593-6603. (74) Popat, K. C.; Eltgroth, M.; LaTempa, T. J.; Grimes, C. A.; Desai, T. A. Decreased Staphylococcus Epidermis Adhesion and Increased Osteoblast Functionality on Antibiotic-Loaded Titania Nanotubes. Biomaterials 2007, 28, 4880-4888. (75) Khan, S. T.; Ahmad, J.; Siddiqui, M. A.; Ali, B. A. CoO Thin Nanosheets Exhibit Higher Antimicrobial Activity against Tested Gram-Positive Bacteria than Gram-Negative Bacteria. Korean Chem. Eng. Res. 2015, 53, 565-569. (76) Ghosh, T.; Dash, S. K.; Chakraborty, P.; Guha, A.; Kawaguchi, K.; Roy, S.; Chattopadhyay, T.; Das, D. Preparation of Antiferromagnetic Co3O4 Nanoparticles from Two Different Precursors by Pyrolytic Method: In Vitro Antimicrobial Activity. RSC Adv. 2014, 4, 15022-15029. (77) van Hengel, I. A. J.; Riool, M.; Fratila-Apachitei, L. E.; Witte-Bouma, J.; Farrell, E.; Zadpoor, A. A.; Zaat, S. A. J.; Apachitei, I. Selective Laser Melting Porous Metallic Implants with Immobilized Silver Nanoparticles Kill and Prevent Biofilm Formation by Methicillin-Resistant Staphylococcus Aureus. Biomaterials 2017, 140, 1-15. (78) Greiner, M. T.; Helander, M. G.; Tang, W.-M.; Wang, Z.-B.; Qiu, J.; Lu, Z.-H. Universal Energy-Level Alignment of Molecules on Metal Oxides. Nat. Mater. 2012, 11, 76-81.


Page 42 of 54

Page 43 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1. Primers used in our study for real-time polymerase chain reaction. Target gene

Direction

Primer sequence (5’→3’)

cydB

F

AGATACTAAACTGCCCTGGATTG

cydB

R

GCTCATAGATATAACCACCTTCTG

sdhC

F

GTAAACCATCAAGCAACGCAAG

sdhC

R

CTTAGCAGTGAAAGCGATGTG

cydB

F

GCAGGTTTCTTCGCATTGC

cydB

R

CTGGAAAGAAACCTACGAATCC

sdhC

F

TGAATCACCAAGCAACACAAGG

sdhC

R

GCTGTAAATGCAATGTGTATACC

cco-3

F

CACTATTGATTCACGCACACATG

cco-3

R

GCATAATCGCCACCATGTTGC

16S rRNA

F

TCGTGTCGTGAGATGTTGGGTTA

16S rRNA

R

GGTTTCGCTGCCCTTTGTATTGT

RP62A

SF8300

RP62A & SF8300



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 44 of 54

Table 2. Data for the energy level positions of TiO2 (anatase), Co, CoO and Co3O4 according to reference78. Materials

Φ (eV)

Eg (eV)

χ (eV)

Ec (eV)

Ev (eV)

TiO2

5.2

3.33

4.16

-4.16

-7.49

Co

5.0

CoO

4.5

2.41

4.42

-4.42

-6.83

Co3O4

6.1

2.43

4.59

-4.59

-7.02

Notes: E0, vacuum level; EF, Fermi level; Φ, work function; Eg, bandgap; χ, electron affinity; Ec, conduction band; Ev, valence band.


Page 45 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 3. Mean values of body temperature and weight of four groups determined during the observation period. Groups

Week 0

Week 2

Week 4

Week 6

A-TiO2

37.6±0.5

37.1±0.6

37.3±0.6

37.8±0.4

Co-TiO2

37.4±0.7

37.4±0.7

37.5±0.6

37.5±0.5

CoO-TiO2

37.2±0.5

37.5±0.5

37.5±0.5

37.6±0.6

Co3O4-TiO2

37.4±0.7

37.2±0.5

37.7±0.4

37.5±0.5

A-TiO2

411.7±25.0

396.3±28.1

389.5±29.5

390.2±30.5

Co-TiO2

413.4±24.3

399.6±26.1

395.2±26.9

396.8±27.6

CoO-TiO2

407.9±22.8

401.5±24.0

399.0±24.8

403.2±27.4

Co3O4-TiO2

409.5±31.3

404.2±32.9

403.0±33.5

408.3±34.0

Temperature (°C)

Weight (g)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 1. Surface SEM morphologies of specimens A-TiO2 (a), Co-TiO2 (b), CoO-TiO2 (c) and Co3O4-TiO2 (d); XRD patterns of the various specimens (e); High resolution TEM images of specimens A-TiO2 (f), CoTiO2 (g), CoO-TiO2 (h) and Co3O4-TiO2 (i), inserted with the corresponding micro-area EDS analysis results; Surface high resolution XPS spectra of the Ti 2p peaks from specimens A-TiO2 (j), Co-TiO2 (k), CoO-TiO2 (l) and Co3O4-TiO2 (m), and the Co 2p peaks from specimens Co-TiO2 (n), CoO-TiO2 (o) and Co3O4-TiO2 (p); Surface zeta potentials of the various specimens at different pH (q). 131x102mm (300 x 300 DPI)

ACS Paragon Plus Environment

Page 46 of 54

Page 47 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. Release profiles of cobalt ions after immersion in TSB (a) and DMEM (b) within 8 weeks; Representative images (c) of re-cultivated bacterial colonies on SBA by SPM conducted on planktonic RP62A (top panel) and SF8300 (bottom panel), accompanied by the corresponding counting results (d-e). Note: ns, not significant. 162x207mm (300 x 300 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3. Live-dead fluorescence staining results of adherent bacteria of RP62A (a) and SF8300 (b) showing their viability after culturing on specimens A-TiO2, Co-TiO2, CoO-TiO2 and Co3O4-TiO2. 130x144mm (300 x 300 DPI)


Page 48 of 54

Page 49 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Relative expression levels of cydB, sdhC and cco-3 by RP62A (top panel) and SF8300 (bottom panel) on specimens A-TiO2, Co-TiO2, CoO-TiO2 and Co3O4-TiO2. The expression levels of all genes are normalized to the 16S rRNA gene. Note: *P< 0.05, **P< 0.01, ***P< 0.001. 175x74mm (300 x 300 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 5. Energy band positions (a) and energy band diagrams (b-d) of TiO2, Co, CoO and Co3O4 before and after physical contact; UV-Vis diffuse reflectance spectra (e) of specimens A-TiO2, Co-TiO2, CoO-TiO2 and Co3O4-TiO2 and the corresponding conversion curves using the Kubelka–Munk function (f); Schematic illustration for the energy band bending of the various heterojunctions and the possible interactions between heterojunctions and bacteria: (g) for Co3O4-TiO2, (h) for CoO-TiO2, and (i) for Co-TiO2. 182x131mm (300 x 300 DPI)


Page 50 of 54

Page 51 of 54

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. Abiotic ROS levels induced by the various specimens A-TiO2, Co-TiO2, CoO-TiO2 and Co3O4-TiO2, including total ROS (a), hydroxyl radical (b) and superoxide anion radical (c), expressed as fold increase relative to that of A-TiO2 control with a relative value of 1; Live-dead fluorescence staining results of adherent bacteria of RP62A (top panel) and SF8300 (bottom panel) co-incubated with 10 mM GSH antioxidant, showing their viability on specimens A-TiO2, Co-TiO2, CoO-TiO2 and Co3O4-TiO2 (d), accompanied by the corresponding representative photographs (e) and counting results (f-g) of bacterial colonies by spread plate method. Note: *P

Band Gap Engineering of Titania Film through Cobalt Regulation for

Recommend Documents