Bioluminometric Assay for Relative Quantification ... - ACS Publications

Unlike the inherited mutations, which are present in all cells, somatic (acquired) mutations occur only in certain cells of the body and, quite often,...
0 downloads 0 Views 449KB Size
Download PDF
Anal. Chem. 2009, 81, 8596–8602

Bioluminometric Assay for Relative Quantification of Mutant Allele Burden: Application to the Oncogenic Somatic Point Mutation JAK2 V617F Vaya Tsiakalou,† Margarita Petropoulou,† Penelope C. Ioannou,*,† Theodore K. Christopoulos,‡,§ Emmanuel Kanavakis,| Nikolaos I. Anagnostopoulos,⊥ Ioanna Savvidou,⊥ and Jan Traeger-Synodinos| Laboratory of Analytical Chemistry, Department of Chemistry, Athens University, Athens 15771, Greece, Department of Chemistry, University of Patras, Patras 26500, Greece, Foundation for Research and Technology Hellas, Institute of Chemical Engineering and High Temperature Chemical Processes (FORTH/ICE-HT), Patras 26504, Greece, Laboratory of Medical Genetics, Athens University, Athens 11527, Greece, and Department of Clinical Haematology, General Hospital of Athens “G. Gennimatas”, Greece Unlike the inherited mutations, which are present in all cells, somatic (acquired) mutations occur only in certain cells of the body and, quite often, are oncogenic. Quantification of mutant allele burden (percentage of the mutant allele) is critical for diagnosis, monitoring of therapy, and detection of minimal residual disease. With point mutations, the challenge is to quantify the mutant allele while discriminating from a large excess of the normal allele that differs in a single base-pair. To this end, we report the first bioluminometric assay for quantification of the allele burden and its application to JAK2 V617F somatic point mutation, which is a recently (2005) discovered molecular marker for myeloproliferative neoplasms. The method is performed in microtiter wells and involves a single PCR, for amplification of both alleles, followed by primer extension reactions with allele-specific primers. The products are captured in microtiter wells and detected by oligo(dT)-conjugated photoprotein aequorin. The photoprotein is measured within seconds by simply adding Ca2+. We have demonstrated that the percent (%) luminescence signal due to the mutant allele is linearly related to the allele burden. As low as 0.85% of mutant allele can be detected and the linearity extends to 100%. The assay is complete within 50 min after the amplification step. Contrary to inherited mutations that are present in all cells of an individual, a somatic (acquired) mutation occurs only in certain cells of the body and, quite often, results in loss of control of cell development and commences excessive proliferation. Thus, somatic mutations are considered as the primary cause of human cancer. Myeloproliferative neoplasms are hematological malignant * Corresponding author. Phone: +30 210-7274574. Fax: +30 210 7274750. E-mail: [email protected]. † Department of Chemistry, Athens University. ‡ University of Patras. § Institute of Chemical Engineering and High Temperature Chemical Processes (FORTH/ICE-HT). | Laboratory of Medical Genetics, Athens University. ⊥ General Hospital of Athens “G. Gennimatas”.

8596

Analytical Chemistry, Vol. 81, No. 20, October 15, 2009

diseases characterized by overproduction of red blood cells (polycythemia vera, PV), platelets (essential thrombocythemia, ET), or white blood cells (chronic myelogenous leukemia). The molecular basis of these diseases is largely unclear. In the 1980s, it was found that, at the molecular level, chronic myelogenous leukemia is characterized by a chromosomal rearrangement that leads to the fusion of the ABL protooncogene to the BCR gene.1-3 Consequently, the BCR-ABL fusion gene became a unique marker whose detection and/or quantification is critical for diagnosis, monitoring of therapy, and detection of minimal residual disease.4-6 Contrary to leukemia, the molecular basis of polycythemia vera and essential thrombocythemia remained obscure until very recently.7 In 2005, it was discovered that a single base substitution of the JAK2 kinase gene (G to T at position 1849) is strongly associated with PV and ET.8-11 JAK2 is a cytoplasmic tyrosine kinase that plays a key role in signal transduction from the receptors of various hematopoietic growth factors. The somatic (1) Heisterkamp, N.; Stam, K.; Groffen, J.; de Klein, A.; Grosveld, G. Nature 1985, 315, 758–761. (2) de Klein, A.; van Kessel, A. G.; Grosveld, G.; Bartram, C. R.; Hagemeijer, A.; Bootsma, D.; Spurr, N. K.; Heisterkamp, N.; Groffen, J.; Stephenson, J. R. Nature 1982, 300, 765–767. (3) Heisterkamp, N.; Stephenson, J. R.; Groffen, J.; Hansen, P. F.; de Klein, A.; Bartram, C. R.; Grosveld, G. Nature 1983, 306, 239–242. (4) Bortolin, S.; Christopoulos, T. K. Anal. Chem. 1995, 67, 2644–2649. (5) Bortolin, S.; Christopoulos, T. K. Clin. Chem. 1996, 42, 1924–1929. (6) Kalogianni, D. P.; Bravou, V.; Christopoulos, T. K.; Ioannou, P. C.; Zoumbos, N. C. Nucleic Acids Res. 2007, 35, e23. (7) Kilpivaara, O.; Levine, R. L. Leukemia 2008, 22, 1813–1817. (8) James, C.; Ugo, V.; Le Couedic, J. P.; Staerk, J.; Delhommeau, F.; Lacout, C.; Garc¸on, L.; Raslova, H.; Berger, R.; Bennaceur-Griscelli, A.; Villeval, J. L.; Constantinescu, S. N.; Casadevall, N.; Vainchenker, W. Nature 2005, 434, 1144–1148. (9) Baxter, E. J.; Scott, L. M.; Campbell, P. J.; East, C.; Fourouclas, N.; Swanton, S.; Vassiliou, G. S.; Bench, A. J.; Boyd, E. M.; Curtin, N.; Scott, M. A.; Erber, W. N.; The Cancer Genome Project; Green, A. R. Lancet 2005, 365, 1054– 1061. (10) Levine, R. L.; Wadleigh, M.; Cools, J.; Ebert, B. L.; Wernig, G.; Huntly, B. J.; Boggon, T. J.; Wlodarska, I.; Clark, J. J.; Moore, S.; Adelsperger, J.; Koo, S.; Lee, J. C.; Gabriel, S.; Mercher, T.; D’Andrea, A.; Fro ¨hling, S.; Do ¨hner, K.; Marynen, P.; Vandenberghe, P.; Mesa, R. A.; Tefferi, A.; Griffin, J. D.; Eck, M. J.; Sellers, W. R.; Meyerson, M.; Golub, T. R.; Lee, S. J.; Gilliland, D. G. Cancer Cell 2005, 7, 387–397. (11) Kralovics, R.; Passamonti, F.; Buser, A. S.; Teo, S. S.; Tiedt, R.; Passweg, J. R.; Tichelli, A.; Cazzola, M.; Skoda, R. C. N. Engl. J. Med. 2005, 352, 1779–1790. 10.1021/ac901584a CCC: $40.75  2009 American Chemical Society Published on Web 09/22/2009

point mutation results in a valine to phenylalanine substitution at codon 617 of the JAK2 kinase (V617F) that leads to its activation. As a consequence, in 2008, the JAK2 V617F allele was included in the World Health Organization (WHO) diagnostic markers for myeloproliferative neoplasms.12,13 From the analytical chemist’s point of view, the challenge is to develop sensitive, robust, and practical methods for detection of the mutant allele JAK2 V617F in the presence of an excess of normal allele in human genomic DNA. Moreover, quantification of the mutant allele burden (expressed as the ratio of JAK2 V617F allele to JAK2 total alleles) is expected to provide an estimate of the size of the myeloproliferative clone with prognostic significance and usefulness in the monitoring of therapy.14-16 The first studies of allele burden were based on direct sequencing but the detectability of this approach is low (15-20% of mutant allele). Current methods are based on real-time PCR with allele-specific primers or real-time PCR exploiting the 5′ nuclease activity of Taq DNA polymerase (TaqMan assay system) and allele-specific oligonucleotide probes.17-20 These homogeneous fluorometric assays offer the advantage that the detection is accomplished during the amplification step. However, they require costly equipment along with expensive reagents (e.g., double labeled fluorescent oligonucleotides). In recent years, bio(chemi)luminescence has found rapidly expanding applications in DNA/RNA assays.21-23 Because they do not require excitation light, bio(chemi)luminometric assays present higher detectability, wider linear range, and much simpler instrumentation than fluorometric methods. The most sensitive bio(chemi)luminometric assays employ either an enzyme reporter (alkaline phosphatase or horseradish peroxidase), in combination with a chemiluminogenic substrate, or a photoprotein reporter (e.g., aequorin or obelin). A common thermal cycler and a luminometer (usually a microtiter plate reader) are required for detection. A variety of hybridization assays have been published for highly sensitive (12) Tefferi, A.; Thiele, J.; Vardiman, J. W. Cancer 2009, 115, 3842–3847. (13) Tefferi, A.; Vardiman, J. W. Leukemia 2008, 22, 14–22. (14) Vannucchi, A. M.; Antonioli, E.; Guglielmelli, P.; Pardanani, A.; Tefferi, A. Leukemia 2008, 22, 1299–1307. (15) Larsen, T. S.; Pallisgaard, N.; Moller, M. B.; Hasselbalch, H. C. Leukemia 2008, 22, 194–195. (16) Larsen, T. S.; Pallisgaard, N.; Moller, M. B.; Hasselbalch, H. C. Eur. J. Haematol 2007, 79, 508–515. (17) Rapado, I.; Albizua, E.; Ayala, R.; Hernandez, J.-A.; Garcia-Alonso, L.; Grande, S.; Gallardo, M.; Gilsanz, F.; Martinez-Lopez, J. Ann. Hematol. 2008, 87, 741–749. (18) Poodt, J.; Fijnheer, R.; Walsh, I. B. B.; Hermans, M. H. A. Hematol. Oncol. 2006, 24, 227–233. (19) Lippert, E.; Girodon, F.; Hammond, E.; Jelinek, J.; Reading, N.-S.; Fehse, B.; Hanlon, K.; Hermans, M.; Richard, C.; Swierczek, S.; Ugo, V.; Carillo, S.; Harrivel, V.; Marzac, C.; Pietra, D.; Sobas, M.; Mounier, M.; Migeon, M.; Ellard, S.; Kroger, N.; Herrmann, R.; Prchal, J. T.; Skoda, R. C.; Hermouet, S. Haematologica 2009, 94, 38–45. (20) Lucia, E.; Martino, B.; Mammi, C.; Vigna, E.; Mazzone, C.; Gentile, M.; Qualtieri, G.; Bisconte, M.-G.; Naccarato, M.; Gentile, C.; Lagana, C.; Romeo, F.; Neri, A.; Nobile, F.; Morabito, F. Leuk. Lymphoma 2008, 49, 1907– 1915. (21) Christopoulos, T. K.; Ioannou, P. C. Verhaegen, M. Photoproteins in Nucleic Acids Analysis. In Photoproteins in Bioanalysis; Daunert, S., Deo, S. K., Eds.; Wiley: Weinheim, Germany, 2006; Chapter 5, p 77. (22) Roda, A.; Guardigli, M.; Mirasoli, M. Pasini, P. Luminescent Proteins in Binding Assays. In Photoproteins in Bioanalysis; Daunert, S., Deo, S. K., Eds.; Wiley: Weinheim, Germany, 2006; Chapter 9, p 155. (23) Michelini, E.; Cevenini, L.; Mezzanotte, L.; Ablamsky, D.; Southworth, T.; Branchini, B.; Roda, A. Anal. Chem. 2008, 80, 260–267.

detection of PCR products,24-27 detection of microRNA,28 and quantitative competitive PCR.29,30 The detection of point mutations is challenging because it requires the discrimination of allele sequences differing only in a single base pair. Bio(chemi)luminometric assays for point mutations have been reported, in which the allele discrimination is based (i) on the specificity of DNA ligase to catalyze the formation of a phosphodiester bond between two oligonucleotides that are hybridized in adjacent positions on the target sequence (oligonucleotide ligation reaction)31,32 or (ii) the specificity of deoxynucleoside triphosphate incorporation by the DNA polymerase (primer extension reactions).33,34 However, all the aforementioned assays have focused on the detection of the alleles in inherited mutations where the goal is the discrimination between the normal homozygote, mutant homozygote, or heterozygote (50% from each allele, one copy from each parent) individual. The above methods provide no quantitative estimate of the percent of each allele in the DNA sample. On the contrary, quantification of the allele burden is crucial in the case of somatic mutations. In the present work, we report the first bioluminometric assay for quantification of allele burden and its application to JAK2 V617F somatic point mutation. The method involves a single PCR with one pair of primers for amplification of both alleles followed by primer extension reactions with allele-specific primers. The products are captured in microtiter wells and detected by oligo(dT)-conjugated photoprotein aequorin. The photoprotein is measured within seconds by simply adding Ca2+. We have demonstrated that the percent (%) luminescence signal due to the mutant allele is linearly related to the allele burden. As low as 0.85% of mutant allele can be detected. MATERIALS AND METHODS Instrumentation. Flash-type bioluminescence was measured using a PhL microplate luminometer/photometer from Mediators (Vienna, Austria). PCR and PEXT reactions were carried out in a PTC-0150 thermal cycler (MJ Research, Watertown, MA). A digital camera (Kodak DC 120) and Gel Analyzer software for DNA and protein documentation were purchased from Kodak (New York, NY). The microtiter plate washer model Wellwash 4 was obtained from Labsystems (Milford, MA). Hybridization assays were (24) Doleman, L.; Davies, L.; Rowe, L.; Moschou, E. A.; Deo, S.; Daunert, S. Anal. Chem. 2007, 79, 4149–4153. (25) Bonvicini, F.; Mirasoli, M.; Gallinella, G.; Zerbini, M.; Musiani, M.; Roda, A. Analyst 2007, 132, 519–523. (26) Laios, E.; Obeid, P. J.; Ioannou, P. C.; Christopoulos, T. K. Anal. Chem. 2000, 72, 4022–4028. (27) Laios, E.; Ioannou, P. C.; Christopoulos, T. K. Anal. Chem. 2001, 73, 689– 692. (28) Cissell, K. A.; Rahimi, Y.; Shrestha, S.; Hunt, E. A.; Deo, S. K. Anal. Chem. 2008, 80, 2319–2325. (29) Elenis, D. S.; Ioannou, P. C.; Christopoulos, T. K. Anal. Chem. 2007, 79, 9433–9440. (30) Mavropoulou, A. K.; Koraki, T.; Ioannou, P. C.; Christopoulos, T. K. Anal. Chem. 2005, 77, 4785–4791. (31) Tannous, B.; Verhaegen, M.; Christopoulos, T. K.; Kourakli, A. Anal. Biochem. 2003, 320, 266–272. (32) Toubanaki, D. K.; Christopoulos, T. K.; Ioannou, P. C.; Flordellis, C. S. Anal. Biochem. 2009, 385, 34–41. (33) Glynou, K.; Kastanis, P.; Boukouvala, S.; Tsaoussis, V.; Ioannou, P. C.; Christopoulos, T. K.; Traeger, J.; Kanavakis, E. Clin. Chem. 2007, 53, 384– 391. (34) Zerefos, P. G.; Ioannou, P. C.; Traeger-Synodinos, J.; Dimissianos, G.; Kanavakis, E.; Christopoulos, T. K. Human Mutat. 2006, 27, 279–285.

Analytical Chemistry, Vol. 81, No. 20, October 15, 2009

8597

Table 1. Oligonucleotides Used in the Present Study As Primers for PCR and PEXTa

a

oligonucleotide

name

PCR Primers 5′ primer 3′ primer

sequence (5′ f 3′)

size

JAK2-F2 JAK-R(IC)

AAGGGACCAAAGCACATTG TGGGCATTGTAACCTTCTA

19 mer 19 mer

PEXT Primers primer (N) primer (M)

JAK2-N(R) JAK2-M(R)

(A)27TTACTCTCGTCTCCACAGAC (A)27TTACTCTCGTCTCCACAGAA

47 mer 47 mer

Primers for Mutagenic PCR 5′ primer 3′ primer

JAK2Mut-F JAK2Mut-R

TCTCGTCTCCACAGAAACATACTCCATAAT ATTATGGAGTATGTTTCTGTGGAGACGAGA

30 mer 30 mer

For convenience we have named the wild-type nucleotide sequence as “normal” or N and the variant nucleotide sequence as “mutant” or M.

performed using the Titramax 1000 shaker/incubator (Heidolph, Kehlheim, Germany). Materials. Opaque polystyrene microtiter wells Microlite 2 were obtained from Thermo Labsystems (Franclin, MA). Biotin11-dUTP was purchased from Applichem (Darmstadt, Germany) and Taq DNA polymerase Vent (exo-) was from New England Biolabs (Beverly, MA). Ultrapure 2-deoxyribo-nucleoside 5-triphosphates (dNTPs) were from HT Biotechnology (Cambridge, U.K.), and bovine serum albumin (BSA) was from Serva (Heidelberg, Germany). The (dT)30-aequorin conjugate (Aeq-(dT)30) was synthesized and purified as described previously.35,36 DNA molecular weight markers and terminal deoxynucleotidyl transferase were from MBI Fermentas (Vilnius, Lithuania), and streptavidin was from Roche Applied Science (Indianapolis, IN). Oligonucleotides for PCR and PEXT reactions as well as aminomodified (dT)30 were synthesized by Thermo Electron (Ulm, Germany). The sequences of all oligonucleotides are presented in Table 1. For convenience, the wild-type and the variant nucleotide sequences are referred to as “normal” (N) and “mutant” (M), respectively. All other chemicals were purchased from Sigma (St. Louis, MO). Samples. A total of 46 clinical samples were included in this study after informed consent. Genomic DNA was extracted from EDTA-anticoagulated whole blood (200 µL) using the MachereyNagel NucleoSpin Blood mini kit (Duren, Germany). Amplification of the JAK2 Gene. A 447-bp segment flanking the somatic point mutation 1849G > T (Val617Phe) in the JAK2 gene was amplified from genomic DNA. PCR was carried out in a total volume of 50 µL containing 2 U HotStar Taq Plus DNA polymerase (Qiagen), 1×PCR buffer, 2.5 mM MgCl2, 0.2 mM of each dNTP, 0.5 µM of the appropriate forward and reversed primer (Table 1), and 50-100 ng of genomic DNA. The cycling parameters were as follows: initial denaturation at 95 °C for 5 min and 35 cycles of 95 °C for 1 min, 55 °C for 1 min and 72 °C for 1 min, and finally, incubation at 72 °C for 10 min. Plasmid Construction. A “normal” (wild-type) and a “mutant” plasmid containing the 447-bp amplification product of the wildtype and the variant JAK2 gene, respectively, were prepared using the InsTAclone PCR cloning kit from MBI Fermentas (Vilnius, Lithuania) according to the manufacturer’s instructions. The wild type 447-bp fragment was amplified from genomic DNA of a (35) Glynou, K.; Ioannou, P. C.; Christopoulos, T. K. Prot. Expr. Purif. 2003, 27, 384–390. (36) Glynou, K.; Ioannou, P. C.; Christopoulos, T. K. Bioconjugate Chem. 2003, 14, 1024–1029.

8598

Analytical Chemistry, Vol. 81, No. 20, October 15, 2009

normal individual, as described above. A 447-bp DNA fragment containing the mutation was created by a three-step PCR (PCRA, PCR-B, and PCR-AB) using genomic DNA as a starting template. PCR-A and PCR-B were carried out using the primer pairs JAK2-F2/JAK2Mut-R and JAK2Mut-F/JAK2-R(IC), respectively, in a total volume of 50 µL containing 1× buffer, 2 mM MgCl2, 200 µM of each dNTP, 0.3 µM of each primer, 2 µL of genomic DNA (∼50 ng), and 2 U of Qiagen HotStar Taq DNA polymerase. The cycling conditions were 95 °C for 5 min followed by 35 cycles at 95 °C for 30 s, 55 °C for 30 s and 72 °C for 30 s, and a final extension step at 72 °C for 8 min. PCR-A and PCR-B products, 232 bp and 245 bp, respectively, were gel purified, mixed in a 1:1 molar ratio, and joined by a PCRlike reaction without primers for 40 cycles using the same thermal cycling conditions as above (PCR-A/PCR-B). To produce the AB product in large quantities, aliquots of the PCRAB reaction mixture (3 µL) were subjected to another PCR (35 cycles) using JAK2-F2 and JAK2-R(IC) oligonucleotides as the upstream and downstream primers, respectively. Primer Extension Reaction (PEXT). PEXT reactions were carried out in a total volume of 20 µL, containing 20 mM TrisHCl, 10 mM (NH4)2SO4, 10 mM KCl, 2 mM MgSO4, 0.1% Triton X-100, pH 8.8, 0.25 U of Vent (exo-) DNA polymerase, 100 fmol of the amplified DNA, 1 pmol of the appropriate primer (normal or mutant), 2.5 µM each of dATP, dCTP, and dGTP, 1.25 µM dTTP, and 1.25 µM biotin-dUTP. The PEXT reactions were performed in the thermal cycler as follows: 95 °C for 5 min and then three cycles of 95 °C for 15 s, 50 °C for 15 s, and 72 °C for 15 s. The extension products were subjected to a final denaturation step at 95 °C for 5 min and placed immediately on ice before measurement. Bioluminometric Hybridization Assay of PEXT Products. Opaque polystyrene microtiter wells, coated with 50 µL of 2 mg/L streptavidin in phosphate-buffered saline, pH 7.4, containing 2% (w/w) sucrose, were first washed three times with wash solution (50 mM Tris-HCl, 0.15 M NaCl, 2 mM EGTA, 0.2 mL/L Tween 20, pH 7.5). A 2 µL aliquot of PEXT reaction product along with 48 µL of assay buffer (10 g/L BSA in 0.1 M maleic acid, 0.15 M NaCl, and 2 mM EDTA, pH 7.5) was added into each well in duplicate and incubated for 15 min at ambient temperature under gentle shaking to allow binding of biotinylated PEXT products to streptavidin. The wells were washed thrice, and then 50 µL of 0.1 M NaOH was added to each well. Following incubation for 5 min as above, the nonbiotinylated DNA strand was removed by washing the wells. Then, 50 µL of 22 nmol/L (with respect to

Figure 1. Schematic presentation of the principle of the bioluminometric assay for relative quantification of allele burden. PCR-amplified DNA fragments that span the point mutation are subjected to two primer extension (PEXT) reactions using normal and mutant primers in the presence of biotin-dUTP. Both primers contain a poly(dA) segment at the 5′-end but differ in the final nucleotide at the 3′-end. Under optimized conditions only the primer that is perfectly complementary with the target DNA will be extended by DNA polymerase and lead to a biotinylated extension product. Only the extended strand will be captured on streptavidin-coated microtiter wells and detected with oligo(dT) conjugated photoprotein aequorin. B ) biotin; SA ) streptavidin; Aeq ) aequorin.

aequorin), aequorin-(dT)30 conjugate, diluted in reconstitution buffer (10 mM Tris-HCl, 5 mM EGTA, 10 mM MgCl2, 2 g/L BSA, pH 7.5, 5 mL/L Tween 20), was added into each well and incubated for 15 min to allow hybridization with immobilized single-stranded PEXT product carrying a poly-(dA) tail. The wells were washed as above, and the activity of bound aequorin was measured in the luminometer by injecting 50 µL of triggering solution (25 mM CaCl2, 20 mM Tris-HCl, pH 7.5) into each well and integrating the signal for 3 s. RESULTS AND DISCUSSION The principle of the proposed bioluminometric assay for the determination of the percentage of the mutant allele of the JAK2 gene in the sample is shown in Figure 1. The genomic DNA sequence spanning the region of interest is first amplified by PCR. The 447-bp amplified fragment is then subjected to two separate

PEXT reactions, one with a primer carrying at the 3′-end a nucleotide complementary to the normal allele (N-primer) and the other using a primer whose 3′ nucleotide is complementary to the mutant allele (M-primer). Genotyping primers N and M contain at their 5′ end a (dA)30 segment. Although both primers hybridize to both alleles, only primers with perfectly matched 3′ ends are extended by the DNA polymerase. Biotin is incorporated in the extended strand through the addition of biotin-dUTP in the dNTP mix. Extension products are captured in microtiter wells coated with streptavidin. Captured products are then detected by adding a (dT)30-conjugated aequorin and measuring the luminescence of bound aequorin (AEQ) within seconds through injection of Ca2+. Because the two alleles differ only in one base-pair, their amplification efficiencies during PCR are equal. Thus, the ratio of the amplified products corresponds to the ratio of the two alleles in the sample prior to amplification. Similarly, following the extension reaction, the molar ratio of the PEXT products corresponds to the ratio of the two allele-specific amplified DNA sequences. Overall, the ratio of the luminescence signals obtained from the extension of the two allele-specific primers reflects the ratio of the two alleles in the sample prior to amplification. The percentage of the mutant allele (allele burden, AB) is given by the ratio (expressed as percentage) of the signal due to the mutant allele over the total luminescence obtained from both alleles, i.e., AB ) 100LM/(LN + LM), where LN and LM are the luminescence signals obtained from PEXT reactions with the N and the M primer, respectively. The values of AB range from 0 (only the normal allele is present) to 100 (only the mutant allele is present). The PEXT reaction was optimized with respect to various parameters that affect the reaction yield, specificity and biotin incorporation efficiency. These include the concentration of Mg2+, the annealing temperature of primers, the amount of target DNA, and the primer-to-target DNA molar ratio. The effect of Mg2+ concentration was studied by performing a series of PEXT reactions using two samples containing 0%

Figure 2. (Left panel) Effect of Mg2+ concentration on the luminescence signals LN (0) and LM (4) obtained from the PEXT reaction with the N primer (0) and the M primer (4), respectively. The effect on the estimated allele burden (AB) is also shown (s). (Right panel) Effect of annealing temperature on the specificity of the PEXT reaction. The luminescence signals, LN (0) and LM (4), along with the estimated allele burden (s) are plotted against the annealing temperature. Analytical Chemistry, Vol. 81, No. 20, October 15, 2009

8599

Figure 3. (Left panel) Effect of the amount of PCR-amplified DNA used in the PEXT reaction on the luminescence signals LN (0) and LM (4) and on the estimated allele burden (AB, s). (Right panel) Effect of the primer-to-target DNA molar ratio on the specificity of the PEXT reaction. The luminescence signals, LN (0) and the LM (4), as well as the estimated allele burden (s) are plotted against the primer-to-target DNA molar ratio.

and 50% mutant allele. Amplified DNA (100 fmol) from each sample were subjected to two PEXT reactions, i.e., using the N-primer and the M-primer (1 pmol) and various Mg2+ concentrations in the range of 1-4 mM. The PEXT products were measured by the hybridization assay and the results are presented in Figure 2. It is observed, that there is an increase in luminescence signals LN and LM obtained from the extension of the normal and mutant primer, respectively, with increasing the Mg2+ concentration. On the other hand, the background luminescence, defined as the signal obtained from the Mprimer using a sample that contains only the normal allele (nonspecific extension), is not affected by the Mg2+ concentration. The estimated allele burden for both samples is practically not affected by the Mg2+ concentration. This is because the variation of the reaction conditions equally affects the extension of the two primers, so that the molar ratio of the extended products remains practically unchanged. A 2 mM Mg2+ concentration was selected for further experiments. The effect of the temperature of the PEXT reaction was studied in the range 45-70 °C with three samples representing high, medium, and low percentages of the mutant allele (Figure 2). At temperatures higher than 50 °C, a significant decrease in LN and LM signals is observed due to the decreased efficiency of primer/template hybridization. However, the estimated allele burden is not affected by the temperature in the entire range. Thus, an annealing temperature of 50 °C was selected. We also studied the effect of the amount of target DNA as well as the primer-to-target molar ratio, because they affect the reaction kinetics and, consequently, the amount of PEXT product. A series of PEXT reactions were set up using a constant amount of primer (1 pmol) and varying amounts of target DNA in the range of 6.25-200 fmol (Figure 3). The specific signals increased with the amount of target DNA as a result of the greater amount of hybrids that are formed and extended by DNA polymerase. The estimated allele burden remained constant in the entire range of target DNA. For further studies, 50 fmol of amplified product was used. 8600

Analytical Chemistry, Vol. 81, No. 20, October 15, 2009

Figure 4. Relationship between the experimentally determined allele burden and the actual percentage of the mutant allele in the sample. Synthetic mixtures of plasmids carrying the normal (wild-type) and the mutant allele (30 000 copies in total) were prepared and subjected in PCR amplification, primer extension, and bioluminometric assay. The AB (%) was determined as described in the text and plotted against the actual percent of the mutant allele in the sample.

Another series of PEXT reactions was performed using a constant amount of target DNA (50 fmol) and varying the primerto-target molar ratio in the range of 2.5-80. An increase in the luminescence signals, LN and LM was observed with increasing the primer-to-target molar ratio up to 40/1, whereas at higher molar ratios there is no significant change in the signals. The estimated allele burden remained practically constant in all range of primer-to-target molar ratio studied (Figure 3).

Figure 5. (Left panel) Comparison of the proposed method (PEXT) with another assay that is based on ARMS PCR and uses a DNA internal standard for the absolute quantification of the mutant allele. A total of 36 clinical samples were used for the comparison study. (Right panel) Determination of the mutant allele burden for the JAK2 V617F point mutation in 46 blood samples, including 20 samples from patients diagnosed with polycythemia vera (blue [), 14 samples from patients diagnosed with essential thrombocythemia (red b), 3 samples from patients with unclassified myeloproliferative neoplasms (green 2), and 9 samples from patients not diagnosed with myeloproliferative neoplasms (black 9).

The fact that despite the large variation in reaction conditions (Mg2+, temperature, amount of input target DNA, and primerto-target molar ratio), the estimated allele burden remains practically constant and demonstrates the robustness of the proposed method. In order to study the relation between the mutant allele burden (AB) that was determined by the present method and the actual percentage of the mutant allele in the sample, we prepared a series of DNA mixtures containing a constant number of copies of normal and mutant plasmids (a total of 30 000 copies) with a varying percentage of the mutant plasmid to cover the range of 0-100% (allele burden in the range of 0-100). The quantity of 30 000 copies corresponds to the number of copies of a single-copy gene in about 100 ng of human genomic DNA. Each mixture of alleles was amplified by PCR, followed by primer extension reaction, and the bioluminometric hybridization assay of the products. The results, presented in Figure 4 show an excellent linear relation (r ) 0.993) between the estimated allele burden and the actual percentage of the mutant allele in the sample. Error bars (±1 SD, where SD is the standard deviation with n ) 3) are also plotted for each point and confirm the high reproducibility of the proposed method. The detection limit (defined as the signal of the zero standard + 3SD) is 0.85% of the mutant allele. An allele burden of 1% corresponds to 300 copies of the target sequence in a typical sample of 100 ng of genomic DNA. Since only 1/10th of the PCR product is pipetted into the PEXT reaction mixture and only 1/10th of the PEXT product is used for the bioluminometric assay, it is deduced that the signal corresponds to less than three copies of the mutant allele. The reproducibility of the method (including both the PEXT reaction and the microtiter well-based bioluminometric assay) was assessed by analyzing PCR products from genomic DNA obtained from samples with mutant allele contents of 0%, 8%, and 78%. The coefficients of variation (% CV) of the estimated allele burden were found to be 0.3, 0.7, and 8.0%, respectively (n ) 5).

The proposed method compared very well with a method that is based on ARMS PCR and uses a DNA internal standard for the absolute quantification of the mutant allele. Figure 5 shows comparison results for the analysis of 36 clinical samples (genomic DNA). Also, we analyzed 46 blood samples for the JAK2 V617F point mutation. The estimated allele burden for each sample is presented in Figure 5. A total of 20 samples were taken from patients diagnosed with polycythemia vera (PV) of which 10 were found to have the mutation. A total of 14 samples were from patients diagnosed with essential thrombocythemia (ET) of which 7 samples were found to carry the mutation. A total of 3 samples were from patients with unclassified myeloproliferative neoplasms of which 1 carried the mutation. The remaining 9 clinical samples were from patients not diagnosed with myeloproliferative neoplasms. CONCLUSIONS A sensitive, reproducible, and robust bioluminometric assay was developed for the relative determination of the mutant allele burden. No treatment of the PCR products (e.g., for removal of primers and excess of dNTPs) is required prior to primer extension reaction. Because of the sensitivity of the bioluminometric assay, only 3 cycles of PEXT reaction are required and the mixture is introduced directly into the well without prior purification. The assay is complete in 50 min after the amplification step. The luminescence of aequorin is detected within seconds after the addition of Ca2+ (flash-type reaction), thus enabling more rapid detection than enzyme labels that give glow-type reactions with chemiluminogenic substrates. The microtiter well format renders the assay automatable and suitable for highsample throughput systems. The throughput can be further enhanced by using multiple bio(chemi)luminescent labels that allow simultaneous determination of several alleles in a single microtiter well. We have already demonstrated the feasibility of such a system for simultaneous detection of four alleles Analytical Chemistry, Vol. 81, No. 20, October 15, 2009

8601

employing aequorin, alkaline phosphatase, horseradish peroxidase, and β galactosidase reporters.37 To date, no other mutations in the JAK2 gene have been reported.38,39 However, in other applications of the proposed method in which more than one mutation may lie close to the interrogated locus, the PEXT primers should be designed properly in order to achieve discrimination of the two alleles. For instance, in this work the PEXT primers bind to the upper strand of the target sequence (reverse primers). If a second mutation was present in the primer binding site, then primers that bind to the lower strand (forward primers) could be used. The primer extension reaction is perhaps the most established approach for allele discrimination and is used widely (with a variety of detection schemes) because of its specificity, simplicity, and robustness. It is worth noting that because only three PEXT cycles are performed, the formation of products from the nonspecific (37) Elenis, D. S.; Ioannou, P. C.; Christopoulos, T. K. Analyst 2009, 134, 725– 730. (38) Levine, R. S.; Gilliland, D. G. Curr. Opin. Hematol. 2007, 14, 43–49. (39) Greiner, T. C. Am. J. Clin. Pathol 2006, 125, 651–653.

8602

Analytical Chemistry, Vol. 81, No. 20, October 15, 2009

extension of the allele-specific primers is prevented. The accuracy of the proposed method was demonstrated (a) by using synthetic mixtures containing the two alleles and (b) by direct comparison with a method that was based on ARMS PCR in combination with a DNA internal standard for the absolute quantification of the mutant allele. Finally, although the performance of the proposed method was demonstrated with the JAK2 somatic mutation, the method can be applied to a large number of reported somatic mutations where the quantification of the allele burden is useful for the diagnosis, prognosis, and monitoring of therapy.40 ACKNOWLEDGMENT We thank F. Papanikos for carrying out the preparation of the JAK2 plasmids. Received for review July 16, 2009. Accepted September 1, 2009. AC901584A (40) Teschendorff, A. E.; Caldas, C. Breast Cancer Res. 2009, 11, 301.