Biophysical and Biological Characterization of ... - ACS Publications

Subscriber access provided by SELCUK UNIV

Article

Biophysical and Biological Characterization of Hairpin and Molecular Beacon RNase H Active Antisense Oligonucleotides Michael E. Østergaard, George Thomas, Erich Koller, Amber L. Southwell, Michael R. Hayden, and Punit P Seth ACS Chem. Biol., Just Accepted Manuscript • DOI: 10.1021/cb500880f • Publication Date (Web): 05 Feb 2015 Downloaded from http://pubs.acs.org on February 10, 2015

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Chemical Biology is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 9

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Chemical Biology

84x31mm (300 x 300 DPI)

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 9

Biophysical and Biological Characterization of Hairpin and Molecular Beacon RNase H Active Antisense Oligonucleotides Michael E. Østergaard1,*, George Thomas1, Erich Koller1, Amber L. Southwell2, Michael R. Hayden2 and Punit P. Seth1 1

Isis Pharmaceuticals, 2855 Gazelle Court, Carlsbad, California, USA

2

Centre for Molecular Medicine and Therapeutics, Child and Family Research Institute, University of British Columbia, Vancouver, British Columbia, V5Z 4H4, Canada

ABSTRACT: Antisense oligonucleotides (ASOs) are single stranded, backbone modified nucleic acids, which mediate cleavage of complementary RNA by directing RNase H cleavage in cell culture and in animals. It has generally been accepted that the single stranded state in conjunction with the phosphorothioate modified backbone are necessary for cellular uptake and transport to the active compartment. Herein, we examine the effect of using hairpin structured ASOs to 1) determine if an ASO agent requires a single stranded conformation for efficient RNA knock down, 2) use a fluorophorequencher labeled ASO to evaluate which moieties the ASO interacts with in cells and examine if cellular distribution can be determined with such probes, and 3) evaluate if self-structured ASOs can improve allele selective silencing between closely related huntingtin alleles. We show that hairpin shaped ASOs can efficiently down-regulate RNA in vitro but potency correlates strongly negatively with increasing stability of the hairpin structure. Furthermore, self-structured ASOs can efficiently reduce huntingtin mRNA in the central nervous system of mice.

Antisense oligonucleotides (ASOs) bind to their cognate mRNA in cells and modulate RNA processing to produce a pharmacological effect.1 2nd generation ASOs are single stranded (ss) chimeric oligonucleotides with a central DNA gap region flanked on either end typically with 2’modified nucleotides (Fig. 1).2 The gap region serves as the substrate for RNase H, an ubiquitous enzyme which selectively cleaves the RNA strand of a DNA/RNA heteroduplex.3 The modified nucleotides in the flanks enhance affinity for the targeted mRNA and also enhance ASO metabolic stability by protecting against degradation by nucleases present in biological media.4,5 One 2nd generation ASO, Kynamro, which targets apolipoprotein B-100, was recently approved by the FDA for the treatment of familial hypercholesterolemia.6 2nd generation ASOs are typically modified with the phosphorothioate (PS) linkage, where one of the non-bridging atoms of the phosphodiester linkage is replaced with sulfur.2 The PS modification stabilizes the ASO against nuclease mediated degradation and also increases the avidity of ASOs for proteins.7 As a result, ASOs transiently circulate in the blood bound to plasma proteins following systemic administration,8 before partitioning onto cell surface proteins. Entry into cellular compartments is thought to occur by receptor mediated endocytosis and several scavenger receptor pathways have been implicated.9,10

It is generally accepted that the entry of PS ASOs into cells is greatly facilitated by their single-stranded nature.11 Presumably, the inherent flexibility of single stranded nucleic acids facilitates ASO interactions with proteins responsible for uptake into cells. Given this background, we asked if converting ssASOs to hairpins could alter their cell-uptake efficiency and if these changes could be quantified by measuring down-regulation of the targeted transcript by RT-PCR. Additionally, further conversion of the hairpin ASO into a molecular beacon (MB),12,13 by introducing a fluorophore and quencher pair on either end of the ASO, could give insights into RNA hybridization kinetics and ASO trafficking between cellular compartments. However, the non-specific protein binding of MB derived from PS ASOs could lead to non-specific fluorescence. Furthermore, the strength of the stem-loop could prevent the MB ASO from efficiently binding to its targeted RNA and lead to confounding results when measuring transcript downregulation. To address these issues, we carried out an in-depth investigation to understand the effects of stem-loop strength on the ability of fluorescently-labelled (FL) hairpin and MB ASOs to downregulate their targeted mRNA in MHT (mouse hepatocellular SV40 large T-antigen carcinoma) cells. This cell-line maintains the ability to take up ss ASOs in culture and show sequence specific antisense effects at low nanomolar concentrations without the need of transfection reagents.11 In addition, we examined the ef-


Page 3 of 9

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


5'-wing

DNA

3'-wing

Standard ASO gapmer design

PO vs. PS backbone DNA gap

S-cEt

MOE wing

Figure 1. Schematics of an ASO and chemical modifications used herein.

fect of protein and RNA binding to PS MB-ASOs as this could produce non-specific fluorescence and potentially confound the use of MB ASOs to study ASO trafficking in cell culture experiments. Lastly, we examined the utility of hairpin ASOs for allele selective silencing of mutant huntingtin, by targeting a SNP associated with the CAG expansion, in patient fibroblasts and in a fully humanized transgenic mouse model of Huntington’s disease (HD).

Results and discussion

FL and MB ASO design. A 3-10-3 PS gapmer ASO targeting scavenger receptor class B, member 1 (SRB-1) mRNA was used as a starting point and S-cEt nucleotides were added to the 3’-end designed to be complementary to the 5’-end allowing formation of a stem-loop structure (Figure 2). One, two and four nucleotides were added with the rationale that one nucleotide would provide too little stability to be relevant at physiological temperatures while four nucleotides might be too stable and compete with binding to complementary RNA. Furthermore, 6carboxyfluorescein was added to the 5’-end as the fluorescent label and Black Hole Quencher-1 (BHQ-1) to the 3’end as a fluorescence quencher to construct a fluorophore-quencher molecular beacon architecture. Fluorescein and BHQ-1 are commonly used as pairs for MB design.14 Control oligonucleotides (ONs) were also made omitting the quencher moiety to establish the efficiency of fluorescence quenching (Figure 2). Biophysical Characterization. Stem stability was investigated by thermal denaturation temperature (Tm) experiments (Figure 2). Increasing the stem length by affinity enhancing S-cEt nucleotides has a significant effect on stem thermal stability. Adding one S-cEt nucleotide to the 3’-end results in a Tm significantly below physiological temperature while four nucleotides results in a stem loop structure expected to be thermally very stable inside living cells. As expected, addition of a 3’-quencher moiety further improves the stability of the stem-loop structure due to fluorophore-quencher hydrophobic interactions (Figure 2). As expected, Tm against complementary RNA was similar for the different duplexes except when highly stable stems were formed impeding opening of the stemloop structure to form a duplex. Increase in fluorescence intensity upon binding to complementary RNA was evaluated for the MB ASO con-

structs. Titration with complementary RNA showed, in most cases, that one equivalent of RNA is enough to reach maximum fluorescence intensity (Figure S1). ON6 was the exception where small increases in fluorescence intensity was observed for every additional equivalent of RNA added, but even with four equivalents of RNA the fluorescence is still much lower than the MB ASOs with shorter stems. Target binding and mRNA knock down. Binding to target RNA in a cell will lead to increase in fluorescence intensity, however, unintended interactions and/or degradation of the MB ASO can also cause fluorescence intensity increases. To determine conclusively that the MB ASOs bind to their target RNA in cells, mRNA knock down was investigated. Since the MB ASOs contain a central stretch of PS DNA, binding to complementary RNA results in RNase H mediated RNA cleavage.15 Using lipid transfection to deliver the MB constructs to the cells potencies range from 2.1 to 42 nM (Figure 2). Interestingly, increasing stem stability correlates strongly with decreased potency. RNA knock down was also evaluated in the absence of transfection agents and as expected the potencies are lower but the same potency rank order is observed as for the experiment using transfection. Strikingly, the ASO with the most stable hairpins, i.e. ON3 and ON6, produce no reduction of RNA even at the highest concentration tested (Figure 2). Opening of the MB ASO by protein and mismatched RNA. Unintended fluorescence signals in the cell are most likely due to opening of the stem-loop structure due to binding to mismatched RNA, by binding to proteins or alternatively by enzymatic degradation of the MB ASO. Consequently, each possibility was evaluated in a more simple system to pursue a better understanding of MB ASO behavior. ON5 exhibited the most desirable properties of the three MB constructs, i.e., good target knock down and sufficiently stable stem stability at 37 oC. Therefore only ON5 was employed in the following characterization. To examine how prone the MB ASO is to bind to mismatched RNA, total RNA was isolated from cells and added to ON5 (Figure 3). Few equivalents of total RNA have negligible effect on fluorescence intensity and only with the highest concentration of total RNA (256 equivalents), a small increase in fluorescence intensity was



Isis #

Sequence

Tm Backbone (SS)

ON1

5’-FTTCAGTCATGACTTCCA

PS

26.4

69.9

2.1

5.2

ON2

5’-FTTCAGTCATGACTTCCAA

PS

35.4

72.7

2.6

14

ON3

5’-FTTCAGTCATGACTTCCTGAA

PS

73.6

NT

20

>10000

ON4

5’-FTTCAGTCATGACTTCCAQ

PS

45.2

71.0

4.0

165

ON5

5’-FTTCAGTCATGACTTCCAAQ

PS

56.2

71.9

8.1

1095

ON6

5’-FTTCAGTCATGACTTCCTGAAQ

PS

>85

NT

42

>10000

ON7

5’-FTTCAGTCATGACTTCCAA

PO

49.1

>85

>10000

>10000

ON8

5’-FTTCAGTCATGACTTCCAAQ

PO

72.1

>85

>10000

>10000

ON3 ON4

ON1 ON2

Tm (RNA)

IC50 (nM) Transfection

IC50 (nM) Free-uptake

ON5 ON6

Transfection

Free uptake 100 % control

%control

100

50

50

0

0 -3

-2

-1 0 1 Log Conc. nanomolar

2

-2

0 2 Log Conc. nanomolar

4

Figure 2. FL- and MB ASOs reduce their cognate mRNA in cells. Table shows sequences and chemical modifications of FL- and MB ASOs along with Tm of the stem (ss) and duplexes with complementary RNA (all Tm-values in degrees Celcius) as well as potency (IC50) in MHT cells using either Lipofection 2000 or free uptake condition. Nucleotide color code: red font = fluorophore, green font = quencher and blue font = S-cEt. NT = no transition. RNA used for Tm experiments: 5’UUGAAAGGAAGUCAUGACUGAAGC-3’

observed. The data indicates that MB ASOs have a low tendency to hybridize to mismatched RNA in cells.

Fluorescence Intensity

30000

20000

10000

0 256

128

64

32

16

8

4

2

1

0.5

ssASO

cRNA

Equivalents of total RNA 25000

Fluorescence Intensity

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 9

20000 15000 10000 5000 0 100

50 25 12.50 6.25 Albumin

48.8 24.4 12.2 α-acid glycoprotein

2 1 SSB protein

1 0 cRNA

Equivalents of protein

Figure 3. Fluorescence intensity of ON5 in the presence of RNA purified from cells (upper graph) or selected proteins (lower graph). Concentration of ON5 is 1 µmol dissolved in Tm buffer.

Oligonucleotides with PS backbones are known to bind more strongly to proteins than their PO backbone counterparts.2 This could potentially be a problem when using a fluorophore-quencher modified ASO with a PS backbone to investigate binding to target RNA. Consequently, binding to albumin was investigated since albumin is often used as a surrogate for total protein. A clear dosedependent increase in fluorescence intensity is observed (Figure 3) where 100 equivalents results in fluorescence intensity of approximately 30% of maximal fluorescence with complementary RNA. α-acid glycoprotein, a negatively charged plasma protein, was added as a negative control and as expected no increase in fluorescence intensity was observed. As a positive control single stranded binding protein (SSB) was used16 and just two equivalents was enough to produce more than 50% fluorescence intensity relative to maximum. Also total protein was extracted from cells and, interestingly, has an influence on


Page 5 of 9

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


fluorescence intensity that is very similar to albumin (Figure S2). Cellular stability of MB ASO. Unmodified DNA is normally quickly cleaved in cells by nucleases. Cleavage of the loop region will result in dissociation of the stem region since cooperativity is lost and lead to fluorescence intensity increases. Also, either fluorophore or quencher linker can be cleaved leading to fluorescence intensity increases. A DNA nucleotide with a PS backbone is very resistant to endonucleases while a S-cEt nucleotide with a PS backbone positioned at the ends is very resistant to exonucleases.17 Therefore the constructs used herein are expected to be highly resistant to enzymatic degradation. The high stability was confirmed as MB ASO extracted from treated cells 24 h post treatment exhibit no degradation products as observed by HPLC and intact MB was confirmed by mass spectrometry (Figure S3). Comparing MB ASOs with PO and PS backbones. To contrast the properties of MB ASOs used herein with standard MBs employing fully PO backbones we prepared the full PO backbone analogs of ON2 and ON5. PO backbones are reported to be 0.5 to 1 degrees Celsius more stabilizing per modification relative to a PS backbone.18 Here it is observed that both stem strength and affinity for complementary RNA is significantly increased for the PO constructs (Figure 2). Addition of complementary RNA leads to increases in fluorescence intensity similar to the PS analogs, however two equivalents of RNA is necessary to reach the maximum level of fluorescence (Figure S4). This is most likely due to the higher stability of the stem and similar to the effect observed with PS backbone analog ON6 albeit less extreme. The PO backbone analogs were delivered to cells using lipid transfection and RNA knock down was measured. Both ON7 and ON8 were inactive as antisense agents at the concentrations used, which can be explained by enzymatic degradation of the PO MBs or by difference in intracellular trafficking. To investigate the nuclease stability of PO backbone MBs, cells were treated with both ON7 and ON8 and extracted from the cells 24 h later. Hairpin structured probes have previously been used for the purpose of increasing nuclease stability,19,20 but in this study ON7 was fully cleaved after 24 h while only approximately 25% full length of ON8 was extracted (Figure S3). Fluorescence microscopy in cells. Fluorescence was observed in cells using microscopy (Figure 4). All three FL ASOs exhibit intense fluorescence in cells mostly located in intracellular vesicles and in the nucleus. For MB ASOs with fluorophore-quencher pairs, overall fluorescence intensity is reduced. There is a higher level of fluorescence when using ON4 most likely due to the lower stability of the stem. Little fluorescence is observed with ON6 which can be explained by the very strong hairpin structure formed and very poor knock down efficiency. The quencher moiety is necessary to reduce overall fluorescence intensity as witnessed by fluorescence microscopy of cells treated with control MBs ON1 – ON3, which show much brighter fluorescence than the quencher

modified probes. PO MBs exhibits fluorescence in the cells closely resembling the PS MB ASOs (Figure S5). Fluorescence is also in the PO MBs case concentrated in intracellular compartments including the nucleus and overall fluorescence brightness is similar to the PS MB ASOs.

Figure 4. Representative merged confocal and fluorescence microscopy images of cells transfected with Lipofectamine 2000 and 75 nM MB ASO.

Allele selective huntingtin reduction using hairpin structured ASOs. MBs have been shown to exhibit improved mismatch selectivity relative to un-structured probes21 therefore we wanted to evaluate hairpin shaped ASOs for allele selective reduction of huntingtin mRNA. A slightly different ASO gapmer design was employed relative to the SRB-1 ASOs where the wings uses two different chemically modified nucleosides, S-cEt and 2’-Omethoxyethyl RNA (MOE). MOE does not exhibit as high RNA binding affinity as S-cEt but allows tuning of the overall binding affinity of the ASO. A 3-9-3 MOE/S-cEt ASO gapmer was designed to be complementary to a site surrounding the single nucleotide polymorphism (SNP) at rs7685686_A located in the huntingtin (HTT) gene within intron 42 where the SNP is located at the center of the ASO sequence (Figure 5). The ASO HTT1 was developed from a previous study where it showed good in vivo properties,22 and was therefore chosen as a starting point for this study. One to five high affinity S-cEt nucleotides was added to either the 3’ or the 5’ end of the parent ASO HTT1 to allow formation of a hairpin structure using the same design strategy as for the SRB-1 MB ASOs. The stability of the hairpin structure was determined by Tm experiments (Figure 5) and as anticipated longer stems lead to higher thermal stability. Patient derived fibroblast cells heterozygous at the SNP site were treated with the self-structured ASOs and transfected using electroporation. Reduction of mutant HTT (muHTT, fully complementary to ASOs) as well as the wild type HTT allele (wtHTT, G:T mismatch) was determined using an allele selective primer probe set.23 As above, it was observed that mRNA knock down efficiency against muHTT is reduced as the stability of the hairpin structure is increased (Figure 5). Few of the selfstructured ASOs significantly improved selective reduc-


ACS Chemical Biology tion between muHTT and wtHTT relative to parent ASO

HTT1, which is likely due to the relatively stable G:T

a

b

125

WT HTT Mu HTT

wtHTT % HTT protein

50

75 50 25

ASO

Sequence (5’ – 3’)

HTT1 HTT2 HTT3 HTT4 HTT5 HTT6 HTT7 HTT8 HTT9 HTT10 HTT11 HTT12 HTT13 HTT14 HTT15 HTT16 HTT17

TAAATTGTCATCACC TAAATTGTCATCACCA TAAATTGTCATCACCTA TAAATTGTCATCACCTTA TAAATTGTCATCACCTTTA TAAATTGTCATCACCATTTA GTAAATTGTCATCACC GGTAAATTGTCATCACC GGTTAAATTGTCATCACC GGTGTAAATTGTCATCACC GGTGATAAATTGTCATCACC GGCTAAATTGTCATCACCGCC GCTAAATTGTCATCACCGC TAATAAATTGTCATCACCTTA AATAAATTGTCATCACCTT TCTTAAATTGTCATCACCAGA CTTAAATTGTCATCACCAG

HTT15

HTT1

Saline

HTT17

HTT16

HTT15

HTT14

HTT13

HTT12

HTT11

HTT9

HTT10

HTT8

HTT7

HTT6

HTT5

HTT4

HTT3

HTT2

0 HTT1

0

c

100

muHTT

100 %HTT mRNA

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 9

Tm [stem]

Tm [muHTT]

Tm [wtHTT] (ΔTm)

NT NT NT 34.1 59.3 81.1 32.0 51.6 71.3 88.1 >95 NT NT 36.0 28.0 46.2 NT

53.7 61.3 60.3 59.3 58.1 50.2 55.8 54.4 52.3 50.8 53.1 51.2 61.2 64.6 64.0 67.6 64.6

52.2 (-1.5) 59.1 (-2.2) 58.3 (-2.0) 57.2 (-2.1) 55.7 (-2.4) 48.0 (-2.2) 54.2 (-1.6) 52.6 (-1.8) 50.1 (-2.2) 48.4 (-2.4) 51.0 (-2.1) 49.3 (-1.9) 58.9 (-2.3) 62.4 (-2.2) 61.7 (-2.3) 65.8 (-1.8) 62.9 (-1.7)

Figure 5. Potency and selectivity of hairpin structured ASOs in cell culture and in the brain of mice. A: Single dose (2 µM) reduction of muHTT and wtHTT mRNA upon treatment with ASO control HTT1 and self-structured ASOs HTT2-HTT17 in human GM04022 fibroblasts cells, B: HTT protein levels in brains of Hu97/18 mice 28 days after treatment with 300 µg HTT1 or HTT15, and C: Self-structured HTT ASO sequences and thermal denaturation temperatures for the hairpins by themselves and against muHTT and wtHTT RNA sequences 5’-AGACUUUUUCUGGUGAUGXCAAUUUAUUAA where X is A and G, respectively. ASO chemical modifications are color coded as in Figure 1.

wobble base pair. HTT15, however, is the most potent ASO in the series and exhibits slightly better allele selectivity relative to HTT1.

by 50%. HTT15 improved potency and reduced muHTT 90% while wtHTT was reduced to 40% relative to PBS control (Figure 5B).

To determine the effect of a hairpin structured ASOs in an animal the most potent and allele selective ASO in the series, HTT15, was selected. Control ASO HTT1 and hairpin structured ASO HTT15 was evaluated in Hu97/18 mice, which is a fully humanized mouse model of Huntington’s disease with SNPs associated with the expanded repeat.24 Mice (n = 4/group) were injected with ASO or vehicle control (PBS) in the right lateral ventricle (ICV) with a single bolus injection (300 µg). Animals were sacrificed after 28 days, brains harvested and HTT protein quantified in a 2 mm coronal slab from each hemisphere by allelic separation immunoblotting allowing separation of muHTT and wtHTT protein. Protein levels were normalized relative to calnexin loading control. Control ASO, HTT1, reduced muHTT by 80% while wtHTT was reduced

Discussion: PS modified ssASOs are being widely investigated as therapeutic agents to suppress diseaseassociated genes. The unique pharmacokinetic properties of single stranded PS ASOs, facilitates delivery of highly anionic macromolecules across cellular membranes without the need for additional formulations or delivery vehicles. In this study, we characterized FL-hairpin and MB ASOs as tools to measure the efficiency of ASO functional uptake into cells and for their ability to reduce gene expression in animal models. The fluorophore-quencher modified ASOs allowed straightforward characterization of ASO interactions with cellular moieties using a fluorescent read-out. Accordingly, moieties which have high probability of interacting with ASOs were evaluated including complementary


Page 7 of 9

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


RNA, total cellular RNA and proteins. Addition of one equivalent of complementary RNA is enough to reach maximum levels of fluorescence except when using a very stable stem (ON6, Figure 2). The lower fluorescence intensity of ON6 is likely a combination of slow kinetics and competition between binding to itself and to the RNA. A fluorescence time course experiment between ON5 and its PO backbone analog ON8, which has a stronger stem stability, reveals that the kinetics of hybridization is slower when the Tm of the stem increases (Figure S6). Fluorescence microscopy of cells transfected with ON4 – ON6 using cationic lipids show that ON4 exhibit brighter fluorescence than ON5 – ON6 which is very likely due to the lower stem stability of ON4 (Figure 4). Despite the lower fluorescence intensity of ON5 – ON6 the actual concentration of ASO in the cells is probably similar to ON4 – only the more efficient fluorescent quenching mediated by the stronger stem stability of ON5 – ON6 is responsible for the reduced fluorescence. Fluorescence is concentrated in intracellular compartments, mostly in endosomes and in the nucleus in agreement with previous reports.11 Since no complementary RNA is available in endosomes the fluorescence likely originates from a combination of high local concentration of MB, opening of the beacon due to protein binding and MB degradation. ON6 shows very little fluorescence throughout the cell and its high stem stability and low mRNA knock down efficiency explains the low fluorescence observed. Due to the relatively high fluorescence levels in the endosomes, MB ASOs are not able to allow sensitive detection of ASO binding to low abundant targets such as SRB-1 mRNA. To further investigate the effect of ASO secondary structure on RNA knock down efficiency hairpin structured ASOs were designed targeting a HTT SNP. Exon 1 of the HTT mRNA contains multiple CAG repeats and individuals with more than 35 repeats are at risk of acquiring Huntington’s Disease,25 an autosomal dominant disease leading to neuronal degeneration and ultimately death and for which there is currently no cure.26 We have recently examined allele selective reduction of HTT by targeting a SNP linked to the expanded repeat23 and since MBs have been commemorated for excellent mismatch discrimination21 we evaluated hairpin structured ASOs as allele selective ASOs. Very similar to the SRB-1 MB ASOs the self-structured HTT ASOs have reduced potency as the hairpin thermal stability increases (Figure 5). Knock down selectivity between mutant and wild type HTT was not improved relative to the control ASO in all cases except for HTT14 and HTT15. It is very likely that improved allele selectivity was not observed in most cases since no significant improvement in thermal discrimination against the challenging T:G mismatch was observed. It is possible, though, that other, more destabilizing mismatches, would have given better selectivity. Injecting hairpin structured ASO HTT15 into the CNS of mice improved potency relative to control ASO HTT1 suggesting that hairpin ASOs are capable of potent downregulation of gene expression in animals. Furthermore,

allele selectivity was slightly improved for HTT15 relative to HTT1 which suggests that the hairpin structure improves binding selectivity (Fig. 5B).

Conclusion

We show that FL-hairpin and MB ASOs can be used to downregulate gene expression in biological systems as well as for visualizing ASO uptake into cells. The efficiency for reducing gene expression was essentially determined by thermal stability of the hairpin. Biophysical characterizations revealed that the PS modified hairpins are stable in cells and not susceptible to opening and nonspecific fluorescence by binding cellular RNA and only minor binding to cellular proteins. SNP targeted hairpin ASOs showed good activity for reducing HTT mRNA, but allele selectivity was generally not improved relative to the parent ASO. This was likely a result of minimal thermal discrimination of the GT versus the AT base-pair at the SNP site. However, the hairpin ASO showed excellent activity for reducing HTT mRNA in the CNS of a transgenic mouse model of HD. This suggests that the hairpin structure does not prevent the ability of the ASO to be internalized into cells in a functional manner and demonstrates use of this technology in animal models.

Methods

Oligonucleotide synthesis: ONs were made on a 2 µmol scale on an ABI 394 DNA/RNA synthesizer using universal polystyrene-based VIMAD unylinker support. Fully protected nucleoside phosphoramidites were incorporated using standard solid-phase ON synthesis, i.e. 3% dichloroacetic acid in DCM for deblocking, 1 M 4,5dicyanoimidazole 0.1 M N-methylimidazole in acetonitrile as activator, acetic acid in THF and 10% 1methylimidazole in THF/pyridine for capping and 0.2 M phenylacetyl disulfide in pyridine:acetonitrile 1:1 (v:v) for thiolation. DNA and MOE amidites were dissolved to 0.1 M in acetonitrile while S-cEt amidites were dissolved to 0.2 M in acetonitrile:toluene 1:1 (v:v). DNA amidites were coupled for 2 times 4 min. while MOE and S-cEt amidites were coupled for 2 times 6 min. After synthesis was complete cyanoethyl groups were removed by treatment with trietylamine:acetonitrile 1:1 (v:v) for 25 min. Remaining protecting groups were cleaved in aq. conc. ammonia at 55 oC for 6 h. ONs were purified by strong anionic ionexchange high performance liquid chromatography using a linear gradient of buffer A to B. Buffer A: 50 mM NaHCO3; Buffer B: 50 mM NaHCO3 1.5 M NaBr, both buffers in acetonitrile:water 3:7 (v:v). Purified ONs were desalted using a C18 reverse-phase cartridge. Identity of ONs was determined by electrospray ionization mass spectrometry (Table S1). Fluorophore and/or quencher-modified ONs were made by Integrated DNA Technologies. Biophysical Characterization: Thermal denaturation temperatures were determined in 10 mM phosphate, 100 mM NaCl, 10 µM EDTA, pH 7 for either MB alone or MB:RNA 1:1 at a total of 8 µM ON. First, ON solutions



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

were heated to 85 oC then slowly cooled to the starting temperature (15 oC). UV absorbance (260 nm) was then determined in a quartz cuvette as a function of temperature using a temperature ramp of 0.5 oC per min. Tm values were determined using the hyperchromicity method incorporated into the instrument software. Fluorescence intensities were recorded using a fluorescence plate reader where each well contained 1 µM MB and various amounts of complementary RNA, mismatched RNA or proteins. Concentration of the ASOs is based on the extinction coefficient calculated using the nearest neighbor method. The optical density (OD) of mismatched (cellular) RNA was estimated to be 40 µg/mL per OD. 1 equivalent mismatched RNA is 18 RNA nucleotides. Fluorophore was excited at 494 nm and signal recorded at 521 nm. Measuring RNA knock down: MHT cells (SRB-1) or GM04022 fibroblasts (HTT) were placed in wells containing 10% fetal calf serum, streptomycin/penicillin and growth medium and varying amounts of MB/ASO was added. Fibroblasts were electroporated at 115 V for 6 msec while MHT, when transfected, was mixed with Lipofectamine 2000 (5 µg/mL) and growth medium changed after 4 h. Cells were maintained at 37 oC and 5% CO2 for 24 h. Then cells were washed with phosphate buffered saline and lysed. RNA was extracted using Qiagen RNeasy96 kit and RNA levels determined by Taqman rtPCR. RNA was normalized to ribogreen and all data are at least performed in duplicate. An example of calculation of IC50 values is provided in SI. Fluorescence microscopy: Cells were added to glass bottom culture dishes in growth medium and treated with ASO (75 nM) and transfected with Lipofectamine 2000 as described in the previous section. Before imaging the medium was changed to opti MEM. The cells were then analyzed under a fluorescence and a confocal laserscanning microscope. Metabolic stability: Cells were treated with ASO as explained above and after 24 h cells were homogenized using homogenization buffer (0.5% NP40 substitute in Trisbuffered saline, pH 8) with homogenization beads on a Retsch shaker. A 27mer fully PS MOE/DNA ON was added as an internal standard. Samples were extracted with phenol/chloroform followed by solid-phase extraction (SPE) of the resulting aqueous extract using phenylfunctionalized silica sorbent. Eluate from SPE was dried down using a warm forced-air (argon) evaporator and reconstituted in 150 µL 4 M urea, 25 mM EDTA. Samples were analyzed by liquid chromatography-mass spectrometry as described previously.27 HTT ASO potency in mouse brain: ASO delivery and tissue processing was done as previously described.28 Briefly, 2-3 month old mice were injected with 10 µL solutions of PBS with or without ASO into the right lateral ventricle. After 28 days mice were sacrificed, brains removed and sectioned in a 2 mm coronal brain matrix. Slab 2, which included portions of anterior cortex and striatum, was divided into right and left hemisphere por-

Page 8 of 9

tions, snap frozen, and lysed for evaluation of muHTT and wtHTT protein levels by allelic separation immunoblotting as previously described.22

ASSOCIATED CONTENT Supporting Information. This material is available free of charge via the Internet at http://pubs.acs.org.

AUTHOR INFORMATION Corresponding Author * Email: [email protected]

ACKNOWLEDGMENT We would like to acknowledge assistance with biophysical characterization from A. Berdeja and A. Watt as well as help with extraction of MB ASOs from cells from A. Chapell and S. Lee.

REFERENCES (1) Bennett, C. F., and Swayze E. E. (2010) RNA targeting therapeutics: molecular mechanisms of antisense oligonucleotides as a therapeutic platform. Ann. Rev. Pharmacol. Tox. 50, 259–293. (2) Eckstein, F. (2000) Phosphorothioate oligonucleotides: what is their origin and what is unique about them? Antisense Nucleic Acid Drug Dev. 10, 117–121. (3) Wu, H., Lima, W. F. and Crooke, S. T. (1999) Properties of cloned and expressed human RNase H1. J. Biol. Chem. 274, 28270–28278. (4) Teplova, M., Minasov, G., Tereshko, V., Inamati, G. B., Cook, P. D., Manoharan, M. and Egli, M. (1999) Crystal structure and improved antisense properties of 2’-O-(2-methoxyethyl)-RNA. Nat. Struct. Biol. 6, 535–539. (5) Seth, P. P., Siwkowski, A., Allerson, C. R., Vasquez, G., Lee, S., Prakash, T. P., Wancewicz, E. V., Witchell, D., and Swayze, E. E. (2009) Short antisense oligonucleotides with novel 2’-4’ conformationaly restricted nucleoside analogues show improved potency without increased toxicity in animals. J. Med. Chem. 52, 10–13. (6) Crooke, S. T. and Geary, R. S. (2013) Clinical pharmacological properties of mipomersen (Kynamro), a second generation antisense inhibitor of apolipoprotein B. Br. J. Clin. Pharmacol. 76, 269–276. (7) Yu, R. Z., Geary, R. S., Leeds, J. M., Watanabe, T., Moore, M., Fitchett, J., Matson, J., Burckin, T., Templin, M. V. and Levin, A. A. (2001) Comparison of pharmacokinetics and tissue disposition of an antisense phosphorothioate oligonucleotide targeting human Ha-ras mRNA in mouse and monkey. J. Pharm. Sci. 90, 182– 193. (8) Yu, R. Z., Kim, T.-W., Hong, A., Watanabe, T. A., Gaus, H. J. and Geary, R. S. (2007) Cross-species pharmacokinetic comparison from mouse to man of a second-generation antisense oligonucleotide, ISIS 301012, targeting human apolipoprotein B-100. Drug Metabolism Disposition, 35, 460–468. (9) Steward, A., Christian, R. A., Hamilton, K. O. and Nicklin, P. L. (1998) Co-administration of polyanions with a phosphorothioate oligodeoxynucleotide (CGP 69846A): a role for the scavenger receptor in its in vivo disposition. Biochem. Pharmacol. 56, 509– 516. (10) Bijsterbosch, M. K., Manoharan, M., Rump, E. T., De Vrueh, R. L., van Veghel, R., Tivel, K. L., Biessen, E. A., Bennett, C. F., Cook, P. D. and van Berkel, T. J. (1997) In vivo fate of phos-


Page 9 of 9

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


phorothioate antisense oligodeoxynucleotides: predominant uptake by scavenger receptors on endothelial liver cells. Nucleic Acids Res. 25, 3290–3296. (11) Koller, E., Vincent, T. M., Chappell, A., De, S., Manoharan, M. and Bennett, C. F. (2011) Mechanism of single-stranded phosphorothioate modified antisense oligonucleotide accumulation in hepatocytes. Nucleic Acids Res. 39, 4795–4807. (12) Tyagi, S., and Kramer, F. R. (1996) Molecular beacons: probes that fluoresce upon hybridization. Nat. Biotechnol. 14, 303 – 308. (13) Wang, K., Tang, Z., Yang, C. J., Kim, Y., Fang, X., Li, W., Wu, Y., Medley, C. D., Cao, Z., Li, J., Colon, P., Lin, H., and Tan, W. (2009) Molecular engineering of DNA: molecular beacons. Angew. Chem. Int. Ed. 48, 856–870. (14) Marras, S. A. E., Kramer, F. R., and Tyagi, S. (2002) Efficiencies of fluorescence resonance energy transfer and contactmediated quenching in oligonucleotide probes. Nucleic Acids Res. 30, e122. (15) Lima, W. F., Rose, J. B., Nichols, J. G., Wu, H., Migawa, M. T., Wyrzykiewicz, T. K., Siwkowski, A. M., and Crooke, S. T. (2007) Human RNase H1 discriminates between subtle variations in the structure of the heteroduplex substrate. Mol. Pharmacol. 71, 83–91. (16) Li, J. J., Fang, X., Schuster, S. M. and Tan, W. (2000) Molecular beacons a novel approach to detect protein – DNA interactions. Angew. Chem. Int. Ed. 39, 1049–1052. (17) Seth, P. P., Vasquez, G., Allerson, C. A., Berdeja, A., Gaus, H., Kinberger, G. A., Prakash, T. P., Migawa, M. T., Bhat, B., and Swayze, E. E. (2010) Synthesis and biophysical evaluation of 2’,4’constrained 2’O-methoxyethyl and 2’,4’-constrained 2’O-ethyl nucleic acid analogues. J. Org. Chem. 75, 1569–1581. (18) Stein, C. A., Subasinghe, C., Shinozuka, K., and Cohen, J. S. (1988) Physicochemical properties of phosphorothioate oligonucleotides. Nucleic Acids Res. 16, 3209–3221. (19) Abdelgany, A., Wood, M., and Beeson, D. (2007) Hairpin DNAzymes: a new tool for efficient cellular gene silencing. J. Gene Med. 9, 727–738. (20) Govan, J. M., Uprety, R., Thomas, M., Lusic, H., Lively, M. O., and Deiters, A. (2013) Cellular delivery and photochemical activation of antisense agents through a nucleobase caging strategy. ACS Chem. Biol. 8, 2272–2282.

(21) Bonnet, G., Tyagi, S., Libchaber, A., and Kramer, F. R. (1999) Thermodynamic basis of the enhanced specificity of structured DNA probes. Proc. Natl. Acad. Sci. USA. 96, 6171–6176. (22) Carroll, J. B., Warby, S. C., Southwell, A. L., Doty, C. N., Greenlee, S., Skotte, N., Hung, G., Bennett, C. F., Freier, S. M., and Hayden, M. R. (2011) Potent and selective antisense oligonucleotides targeting single-nucleotide polymorphisms in the Huntington disease gene / allele-specific silencing of mutant huntingtin. Mol. Ther. 19, 2178–2185. (23) Østergaard, M. E., Southwell, A. L., Kordasiewicz, H., Watt, A. T., Skotte, N. H., Doty, C. N., Vaid, K., Villanueva, E. B., Swayze, E. E., Bennett, C. F., Hayden, M. R., and Seth, P. P. (2013) Rational design of antisense oligonucleotides targeting single nucleotide polymorphisms for potent and selective suppression of mutant huntingtin in the CNS. Nucleic Acids Res. 41, 9634– 9650. (24) Southwell, A. L., Warby, S. C., Carroll, J. B., Doty, C. N., Skotte, N. H., Zhang, W., Villanueva, E. B., Kovalik, V., Xie, Y., Pouladi, M. A., et al. (2013)A fully humanized transgenic mouse model of Huntington disease. Hum. Mol. Genet. 22, 18–34. (25) MacDonald, M. E., Ambrose, C. M., Duyao, M. P., Myers, R. H., Lin, C., Srinidhi, L., Barnes, G., Taylor, S. A., James, M., Groot, N., MacFarlane, H., Jenkins, B., Anderson, M. A., Wexler, N. S., and Gusella, J. F. (1993) A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington’s disease chromosome. Cell, 72, 971–983. (26) Walker, F. O. (2007) Huntington’s disease. Lancet, 369, 218–228. (27) Griffey, R. H., Greig, M. J., Gaus, H. J., Liu, K., Monteith, D., Winniman, M., and Cummins, L. L. (1997) Characterization of oligonucleotide metabolism in vivo via liquid chromatography/electrospray tandem mass spectrometry with a quadrupole ion trap mass spectromenter. J. Mass. Spectrom. 32, 305–313. (28) Southwell, A. L., Skotte, N. H., Kordasiewicz, H. B., Østergaard, M. E., Watt, A. T., Carroll, J. B., Doty, C. N., Villanueva, E. B., Petoukhov, E., Kuljeet, V., et al. (2014) In vivo evaluation of candidate allele-specific mutant huntingtin gene silencing antisense oligonucleotides. Mol. Ther. 22, doi: 10.1038/mt.2014.153.


Biophysical and Biological Characterization of ... - ACS Publications

Recommend Documents