Environ. Sci. Technol. 2008, 42, 477–483
Bioreduction of Trichloroethene Using a Hydrogen-Based Membrane Biofilm Reactor J I N W O O K C H U N G , * ,†,‡ ROSA KRAJMALNIK-BROWN,‡ AND BRUCE E. RITTMANN‡ R&D Center, Samsung Engineering Co. Ltd., 415-10 Woncheon-Dong, Youngtong-Gu, Suwon-Si, Gyeonggi-Do, Korea 443-823, and Center for Environmental Biotechnology, Biodesign Institute at Arizona State University, P.O.Box 875701, Tempe, Arizona 85287-5801
Received September 27, 2007. Revised manuscript received October 1, 2007. Accepted October 9, 2007.
A H2-based, denitrifying membrane-biofilm reactor (MBfR) was effective for removing trichloroethene (TCE) by reductive dechlorination. When TCE was first added to the MBfR, reductive dechlorination took place immediately and then increased over 18 weeks, and TCE was completely dechlorinated to ethene by about 120 days. These results indicate that TCEdechlorinating bacteria were present naturally in the H2based biofilm, and that enrichment for TCE-dechlorinating bacteria occurred. Dehalococcoides were documented in the MBfR biofilm before and after TCE feeding. Their proportion, quantified using the 16S rRNA gene, increased from 2.9 to 12% after TCE addition. This is the first report in which Dehalococcoides are proven to be present as part of an autotrophic biofilm community active in reductive dechlorination of TCE to ethene in a laboratory controlled experiment. Based on the complete reduction of TCE to ethene, the 16S rRNA clone libraries results, and the amount of tceA and bvcA, it appears that at least two Dehalococcoides strains were present in the enriched biofilm. One of them seems to be a new strain that is unique for having tceA and bvcA reductive dehalogenases.
Introduction The chlorinated solvent trichloroethene (TCE) has been widely used as a cleaning agent and solvent for many military, commercial, and industrial applications (1–3). This widespread use, along with its improper handling, storage, and disposal, has resulted in frequent detection of TCE in groundwater (4–6). TCE has the potential to cause liver damage and malfunctions in the central nervous system (7), and it is considered a likely human carcinogen (8). An important mechanism for the detoxification of TCE is reductive dechlorination (2, 9–11), which can occur under methanogenic and sulfate-reducing conditions (12–14) or under chlororespiring conditions, where TCE is used as an electron acceptor (3, 15–17). In reductive dechlorination, TCE is sequentially reduced by 2-electrons to the 1,1-dichloroethene (1,1-DCE), 1,2-cis-dichloriethene (cis-DCE), or 1,2trans-DCE (trans-DCE) isomers, to vinyl chloride (VC), and * Corresponding author phone 82-31-260-6053; fax: 82-31-2606008; e-mail:
[email protected]. † Samsung Engineering Co. Ltd. ‡ Biodesign Institute at Arizona State University. 10.1021/es702422d CCC: $40.75
Published on Web 12/19/2007
2008 American Chemical Society
to ethene (18); in some cases, reduction continues to form ethane (9, 18–21). Reductive dechlorination is an electron-consuming process and is often limited by the availability of suitable electron donors. The biodegradation of TCE and intermediates has been achieved using different electron donors, such as methanol (22), acetate (23, 24), lactate (25), butanol (26), fructose (27), and hydrogen gas (H2) (28–34). H2 is generally considered to be the ultimate electron donor for the reductive dechlorination process. H2 also has advantages of being nontoxic compared to some organic donors. Consequently, current efforts to stimulate reductive dechlorination focus on means to deliver H2 to microorganisms. The most common approach today is addition of fermentable substrates (30, 33, 35). H2 also can be delivered directly by H2 sparging, H2-generating electrodes, and H2 diffusion through a gastransfer membrane. The membrane biofilm reactor (MBfR), a new technical approach for bioreduction of oxidized contaminants (36–41), delivers H2 directly as the electron donor by its diffusion through the wall of a bubbleless gas-transfer membrane. Bacteria that live as a biofilm on the outer wall of the membrane oxidize the H2, and the electrons are used by the bacteria to reduce one or several electron acceptors present in the water. Although several species belonging to diverse groups of bacterial genera are involved in partial reductive dechlorination of TCE to cis-DCE (42, 43), the genus Dehalococcoides appears to contain the strains involved in ethene formation (44–50). Ironically, most Dehalococcoides are not able to completely dechlorinate TCE to ethene. For example, Dehalococcoides ethenogenes (50) and strain FL2 (17) can use TCE and cis-DCE as electron acceptors, but not VC. Likewise, strain BAV1 can utilize cis-DCE and VC as electron acceptors, but is unable to use TCE (48). To date, strain GT is the only Dehalococcoides strain proven to use TCE, cis-DCE, and VC as electron acceptors (51). Thus, it is important to distinguish which Dehalococcoides strains are present. Dehalococcoides strains with different metabolic capabilities have identical 16S rRNA genes; hence the 16S rRNA gene of Dehalococcoides is not a good target for discriminating Dehalococcoides strains for metabolic capability. Detection of the genes for reductive dehalogenase enzymes (RDases) can overcome this limitation and have been used as a fingerprint of indication Dehalococcoides present in mixed cultures (51–53). Some of the characterized RDase encoding genes in Dehalococcoides include tceA, bvcA, and vcrA. Strains FL2 and 195 contain the tceA gene (54), and no VC RDase has been reported present in these cultures. Strain BAV1 does not contain the tceA gene, and the VC RDase reported for this strain is bvcA. Strains GT (51) and culture VS have the vcrA gene (55). Because of the strong similarity among 16S rRNA genes in Dehalococcoides, RDase genes have been used to characterize Dehalococcoides strains and cultures (51–53). Although much emphasis has been given recently to Dehalococcoides physiology and RDase genes and their expression, all of these Dehalococcoides laboratory studies were performed with suspended cultures (45, 46, 48, 50, 51). However, Dehalococcoides presumably are present in bioremediation and biotreatment settings in suspension and as part of biofilms. One of the limitations to investigate Dehalococcoides growth as part of a biofilm has been the lack of an adequate biofilm-reactor system. Besides being a promising technology for reduction of oxidized contaminants, the MBfR also has the potential to be an experimental platform for studying reductive dechlorinators in biofilms. VOL. 42, NO. 2, 2008 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
477
FIGURE 1. Schematic of the bench-scale MBfRs used to investigate TCE dechlorination. The objectives of this study were to investigate the TCEdechlorination potential in a denitrifying, H2-based MBfR, to document the stoichiometric reduction of TCE to ethene, and to explore the presence of chlororespiring bacteria and Dehalococcoides spp. in the MBfR’s biofilm. The results provide information important for TCE dechlorination to ethene and for Dehalococcoides growth in a biofilm in a laboratory setting.
Materials and Methods Experimental Set-Up and Operating Conditions. Except for the feeding of TCE, the MBfR system was the same as described in Chung et al. (34–36), and a schematic of MBfR system used in this study is shown in Figure. 1. In short, the MBfR consisted of two glass tubes connected with Norprene tubing and plastic barbed fittings. One glass tube contained a main bundle of 32 hollow-fiber membranes (model MHF 200TL, a composite bubble-less gas-transfer membrane produced by Mitsubishi Rayon), each 25 cm long. We collected biofilm samples by cutting short lengths of a separate fiber, located in the second glass tube, which allowed us to collect samples without disturbing the main bundle of fibers and without causing a significant change in total biofilm surface area in the reactor. The tubes were mounted directly on the head of a peristaltic pump (Gilson Minipuls 3, Middleton, WI) so that the contents inside the MBfR could be recirculated with a flow rate of 150 mL/min. With the feed flow rate set at 1.0 mL/min, the recirculation ratio was 150, which promoted completely mixed conditions and a dense biofilm (56). We set the standard H2 pressure to the inside of the fibers at 2.5 psi (0.17 atm). Inoculation was the same as Chung et al. (36): The inoculum came from the pilot-scale MBfR used for perchlorate and nitrate reduction at La Puente, California. The pilotscale MBfR treated groundwater containing approximately 5 mg-N/L of nitrate and 60 µg/L of perchlorate, and it had no exposure to TCE. The biofilm developed from indigenous bacteria present in the aquifer (40). We started up the MBfRs by supplying H2 to the membrane and recirculating the liquid for 24 h to establish a biofilm. Then, we fed influent medium that contained no TCE at a rate of 0.2 mL/min. The concentration of nitrate (0.08 mM) in the effluent reached steady-state after around 3 days, and then we increased the feed rate of influent medium to 1.0 mL/min and maintained this flow rate to the end of the experiments. The nitrate + sulfate feed medium and its preparation, except for the addition of sulfate and TCE, were the same as the nitrate medium described by Chung et al. (36–38). Sulfate was added to the nitrate medium as FeSO4 × 7H2O. We purged all feed media with nitrogen gas to eliminate dissolved O2 in 478
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 42, NO. 2, 2008
the influent. The feed flow rate of the nitrate + sulfate medium was 0.98 mL/min after start up. After nitrate was completely removed in the MBfR (20 days), we added TCE to the influent of the MBfR, and these operating conditions were maintained for another 132 days. To add TCE to the influent, we injected a TCE stock solution, which was deionized water containing approximately 50 mg TCE/L, at the rate of 0.02 mL/min into the feed line of the nitrate + sulfate medium using a second manifold pump. Thus, the total influent feed flow rate was 1 mL/min. The nominal influent concentrations of the potential acceptors were 5 mg/L of NO3--N/L (0.08 mM), 4.8 mg-SO42-/L (50 µM), and 1000 µg/L (7.6 µM) of TCE, and we measured the actual concentrations daily. Sampling and Analysis. We monitored the performance of the MBfRs by analyzing influent and effluent samples for soluble nitrate, nitrite, sulfate, and sulfide according to standard procedures (57). We carried out analyses for nitrate and nitrite by ion chromatography using an AS-11 column, an AG-11 precolumn, and a 200 µL injection loop, as described in Nerenberg et al. (40). We measured the sulfate concentration using a capillary ion analyzer (CIA, Millipore Corp., Milford, MA) and the dissolved sulfide concentration in the aqueous phase using a colorimetric method based on methylene blue (58). We routinely determined the concentrations of TCE and its reductive-dechlorination products, 1,1-DCE, cis-DCE, trans-DCE, VC, and ethene, by gas chromatography (GC). We analyzed a 0.5 mL headspace sample by a GC (HP 5890, Hewlett-Packard, Palo Alto, CA) with a Rtx-503.2 capillary column (20 m × 0.18 mm × 1.00 µm, Restek, Bellefonte, Pa) and a flame ionization detector (FID) after solid-phase microextraction (SPME) from the headspace above a 2 mL aqueous sample. An SPME fiber (100 µm polydimethylsiloxane coating), purchased from Supelco (Bellefonte, PA), was inserted into the injection port and allowed to remain there for 10 s prior to starting the GC run. The conditions of the GC were initial temperature of 50 °C held for 3.5 min, a temperature ramp with a gradient of 25 °C/min to 115 °C, a second ramp at 10 °C/min to 250 °C, and then the temperature held at 250 °C for 3 min The detection limit was approximately 0.05 µM for all chlorinated compounds and ethene. We determined the GC calibration factors based on known masses of TCE, 1,1-DCE, cis-DCE, trans-DCE, VC, and ethene added to 160 mL serum bottles containing 100 mL of distilled–deionized water. We allowed the contents of the sealed bottles to equilibrate at 25 °C and then analyzed the contents by GC with SPME. We computed the aqueous concentrations of TCE and its reaction products using reported Henry’s constants (59, 60). DNA Extraction and PCR-Based Tools to Detect Key Dechlorinating Populations. We collected three biofilm samples for molecular analyses on days 0, 60, and 90 after nitrate was completely reduced and TCE was added. These correspond to days 20, 80, and 110 of operation, since we added TCE at day 20. We took the biofilm samples as 2–3 cm sections from the single fiber in the MBfR. We extracted DNA from the biofilm sample using the Ultra Clean soil DNA kit (MoBio Laboratories Inc., Solana Beach, CA), which includes bead beating and a spin-column purification step (61). We confirmed successful extraction by gel electrophoresis and stored the DNA at -20 °C for further processing. We performed PCR reactions in a final volume of 25 µL. The final concentrations of each chemical in a single reaction tube were: PCR buffer (1×) (Eppendorf, California), MgCl2 2.5 mM (Eppendorf, California, BSA (0.13 mg/mL), dNTPs (0.25 mM each) (Invitrogen, California), Primers (1 mM each), and Taq DNA polymerase (0.5 µL) (Eppendorf, California), and 2 ng/µL of community DNA. PCR reactions were performed with water, instead of template DNA, as a negative
TABLE 1. Real-Time PCR Primers and Probes and Conditions Used primer/probe
primers sequences 5′f3′
Bac1055YF Bac1392R Bac1115Pr Dhc1200F
ATGGYTGTCGTCAGCT ACGGGCGGTGTGTAC FAM- CAACGAGCGCAACCC-TAMRA CTGGAGCTAATCCCCAAAGCT
Dhc1271R Dhc1240Pr TceA1270F TceA1336R TceA1294Pr Bvc925F Bvc1017R Bvc977Probe Vcr1022F Vcr1093R Vcr1042Probe
CAACTTCATGCAGGCGGG FAM-TCCTCAGTTCGGATTGCAGGCTGAA-TAMRA ATCCAGATTATGACCCTGGTGAA GCGGCATATATTAGGGCATCTT FAM-TGGGCTATGGCGACCGCAGG-TAMRA AAAAGCACTTGGCTATCAAGGAC CCAAAAGCACCACCAGGTC FAM-TGGTGGCGACGTGGCTATGTGG-TAMRA CGGGCGGATGCACTATTTT GAATAGTCCGTGCCCTTCCTC FAM-CGCAGTAACTCAACCATTTCCTGGTAGTGG-TAMRA
control. PCR conditions included an initial denaturation of 92 °C for 2 min, followed by 30 cycles of 94 °C for 30 s alternated with the annealing temperature indicated in Table 1 for 45 s, and 72 °C for 2 min We separated the amplification products by horizontal gel electrophoresis on a 1.5-percent agarose gel (Amresco, Solon, OH) stained with ethidium bromide (Sigma Chemical Co., St. Louis, MO) and visualized under UV light. We captured the gel images using a gel documentation system (Gel DOC 2000, Biorad, CA). We used the amplicon generated with general bacterial primers 8F (5′-AGAGTTTGATCCTGGCTCAG-3′) and 1525R (5′-AAGGAGGTGATCCAGCCGCA-3′) to establish clone libraries using a TOPO-TA cloning kit (Invitrogen, California) and performed the cloning procedure following the manufacturer’s recommendations. We ligated PCR products into the TA cloning vector pCR2.1 and introduced the ligated vector into chemically competent Escherichia coli cells. We picked 48 white colonies that presumably had an insert for this library. To verify transformation, we first screened the clones using direct PCR with primers targeting the TA cloning vector, flanking the inserted 16S rRNA gene fragment as described previously (62). Every clone that had an insert was partially sequenced using an M13 primer. Quantification of General Bacterial 16S rRNA Genes, Dehalococcoides 16S rRNA Genes, and Reductive Dehalogenase (RDase) Genes. We performed quantitative realtime PCR (qRT-PCR) for enumeration of general 16S rRNA bacterial genes, Dehalococcoides 16S rRNA genes, and three previously characterized RDase genes present in specific Dehalococcoides strains, i.e., tceA (54), bvcA (63), and vcrA (55). Table 1 summarizes the names, conditions, and sequences of the primers and probes used for real time PCR. Each reaction tube had a 20 µL reaction volume containing 1 × iQ Supermix (2 × Supermix contains 100 mM KCl, 40 mM Tris-HCl, pH 8.4, 0.4 mM of each dNTP, iTaq DNA polymerase 50 units/mL, 6 mM MgCl2,) (Biorad), Taqman probe (300 nM) forward and reverse primers (300 nM), and 2 µL DNA template from each sample. The PCR conditions were as follows: 3 min at 95 °C followed by 40 cycles of 15 s at 95 °C and 1 min at the annealing temperature specified in Table 1. We carried out all PCRs in a spectrofluorimetric thermal cycler (IQ5 sequence detection system, Biorad). We generated calibration curves (log DNA concentration versus an arbitrarily set cycle threshold value CT, which is determined by the Instrument) using triplicate 1:10 serial dilutions of cloned DNA of known concentration and compared the CT values obtained for each sample with the standard curve to determine copy numbers. We performed all PCR experiments in triplicate along with appropriate controls (e.g., no
annealing temperature (°C)
reference
general bacterial 16S rDNA
52 °C
52
dehalococcoides sp. 16S rDNA
58 °C
48
tceA gene
58 °C
64
bvcA gene
58 °C
52
vcrA gene
58 °C
52
target gene
template DNA) and obtained a linear range of 6 orders of magnitude. The detection limit in these experiments was 12 copies for tceA and 17 copies for bvcA, vcrA, and 16S rRNA. We used plasmids containing Dehalococcoides sp. strain BAV1 16S rRNA genes as standards to construct general bacterial and Dehalococcoides calibration curves. We quantified the plasmids concentration using a NanoDrop instrument (Wilmington, DE) and appropriately diluted to a concentration of 10 ng/uL; then, we diluted theses standards using a 1 in 10 serial dilutions protocol. For RDase calibration curves, we used plasmids containing tceA, bvcA,, and vcrA. For copy-number estimates, we assumed an average molecular weight of 660 for a base pair in dsDNA. The plasmid used for calibration curves targeting the 16S rRNA gene had a 16S rRNA gene insert size of about 1500 bp. The plasmids used for tceA, bvcA, and vcrA had gene-insert sizes of 3500 bp, 1500 bp, and 1500 bp, respectively. The combined size of the vector plus the insert (plasmid size) was 5.4 × 103 bp for 16S rRNA genes, bvcA, and vcrA, and it was 7.3 × 103 bp for tceA. The equation used to estimate the copy number per µL in the standards used for the calibration curve was (42, 52) as follows: gene copies / reaction ) (DNAc × ng / µL) × (6.023 × 1023bp / mol bp) × (1 copy / plasmid size bp)×1mol bp DNA / 660g DNA × 1g / 109ng × (µLDNA used) To calculate the gene copies/ cm2, we used the following equation: 1 gene copies gene copies )× × × reaction mix µLDNA used in PCR cm2 total µLDNA (1) biofilm area(cm2)
(
) (
(
)
)
The regression parameters obtained with the calibration curves were the following: for bvcA, tceA, Dhc-16S rRNA gene and bacterial 16S rRNA the slopes gene were -3.21, -3.39, -3.66, and -4.62, respectively. The Y intercepts were 39.3, 42.1, 43.0, 46.6, respectively, and the R2 were higher than 0.99 for all cases except for bacterial 16S rRNA, for which the R2 was 0.98. Sequences obtained in this study have been deposited into the Genbank database under accession numbers EU169839-EU169847.
Results and discussion Startup and Steady States. Figure 2 summarizes the startup and concentration profiles for NO3-, NO2-, TCE, 1,1-DCE, cis-DCE, trans-DCE, VC, and ethene in the MBfR effluent. In the first several days of operation, some nitrate was converted only to nitrite, but the nitrate and nitrite concentrations in the effluent dropped to less than 0.1 µM within 20 days. After VOL. 42, NO. 2, 2008 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
479
TABLE 2. Electron-Equivalent Fluxes for TCE, cis-1,2-DCE, VC, Total VOC, and Nitrate Using Results in the Effluent from the TCE-fed MBfR at Day 150a electron-equivalent flux unit b
TCE to cis-1,2-DCE cis-1,2-DCE to VCc VC to ethened TCE to ethenee nitrate to N2f
eq/m2d
% distribution of fluxes
0.0054 0.0054 0.0054 0.0162 0.1421
3.4 3.4 3.4 10.2 89.8
a The membrane surface area used in the calculation of flux is 72.6 cm2. The influent concentration of TCE, nitrate, sulfate, and hydrogen pressure were fixed at 7.6, 80, 50, and 2.5 psi, respectively, in all experiments. b calculated by
FIGURE 2. Concentrations of nitrate, nitrite, TCE, 1,1-DCE, cis-1,2-DCE, trans-1,2-DCE, VC, and ethene in the effluent. Influent concentrations are 0.08 mM NO3--N, 50 µM sulfate, and 7.6 µM TCE. (left Y axis: TCE, 1,1-DCE, cis-1,2-DCE, trans-1,2-DCE, VC, and ethene in µM) and right Y axis: NO3--N and NO2--N in mM). Error bars are the standard deviations for three independent assays. Sulfate reduction was not detected during this experiment. nitrate and nitrite were completely removed, we added TCE to the feed at 7.6 µM, beginning on day 20. The dechlorination of TCE to cis-DCE began almost immediately, indicated by 0.09 µM cis-DCE at day 25 (second sampling). TCE reached its minimum concentration (∼0.6 µM, corresponding to ∼92% removal) by 120 days. cis-DCE and VC were transient intermediates that peaked at ∼3.0 µM cis-DCE at day 65 and ∼3.3 µM VC at day 95, but then disappeared. Steady-state reduction of TCE to ethene (to ∼6.2 ( 0.3 µM or 82% of the influent TCE) was evident by day 140, or after 120 days of feeding TCE. By 150 days, 93% of TCE loss was accounted for by the ethene produced. We did not detect 1,1-DCE and trans-DCE above the detection limit of 0.05 µM, which suggests that dechlorination occurred only via cis-DCE. We did not detect sulfide during this experiment, and sulfate reduction was negligible for the operating period in Figure 2. Electron-Equivalent Fluxes. Table 2 shows the electronequivalent fluxes for TCE to cis-DCE, cis-DCE to VC, VC to ethene, and TCE to ethene during the final steady-state period, around day 150. Also, the electron-equivalent flux for nitrate is provided for comparison. The calculation methods, shown in the notes below Table 2, consider that dechlorinations of TCE to cis-DCE, cis-DCE to VC, and VC to ethene are 2 electron equivalents per step. The H2 utilizations for each electron acceptor are proportional to the electron fluxes, since each H2 mole has 2 electron equivalents. Table 2 also presents the percentage distributions among the fluxes. Nitrate reduction was by far the biggest consumer of electrons (89%). Since the effluent concentrations for cis-DCE and VC were nearly zero at 150 days, the electron-equivalent fluxes for the three steps of reductive dechlorination were the same and represented 3.4% of the electron flow each. Thus, the first step, TCE reduction to cis-DCE, was the rate-limiting step. Since a small concentration of TCE remained in the effluent, it is possible that this reaction was H2 limited. Increasing the H2 pressure or reducing the NO3- input may allow greater reduction of TCE, as it did for selenate reduction in a similar setting (34). Key Dechlorinating Populations in the MBfR Biofilm. We detected Dehalococcoides in the DNA from the biofilm samples collected by days 80 and 110, or after 60 and 90 days of feeding TCE. The bacterial clone library consisted of 48 clones that are summarized in Table 3. The most dominant clones in the library were Lysobacter sp., Dehalococcoides 480
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 42, NO. 2, 2008
)Je- TCE )
Influent flowrate(Q) · removed TCE(∆S) , Total biofilm surface(aV) · EWTCE
where Q is in m3/d, ∆S is in g-TCE/m3, aV is in m2, EWTCE is 131.68 in g-TCE/2e- equivalent for reduction of TCE to cis1,2-DCE, and J is in e--eq/m2 · d. c calculated by )Je- cis-1,2-DCE ) Je-TCE Influent flow rate(Q) · remaining cis - 1, 2 - DCE(S) , Total biofilm surface(aV) · EWcis-1,2-DCE where Q is in m3/d, S is in g-cis-1,2-DCE/m3, aV is in m2, EWcis-1,2-DCE is 97.0 in g-cis-1,2-DCE/2e- equivalent for reduction of cis-1,2-DCE to VC, and J is in e--eq/m2 · d. d calculated by )Je-VC ) Je-cis-1,2-DCE Influent flowrate(Q) · remaining VC(S) , Total biofilm surface(aV) · EWVC where Q is in m3/d, S is in g-VC/m3, aV is in m2, EWVC is 62.6 in g-VC/2e- equivalent for reduction of VC to ethene, and J is in e--eq/m2 · d. e calculated by )J totale-TCE ) Je-TCE + Je-cis-1,2-DCE + Je-VC , where J totale-TCE is total VOC flux. f calculated by )Je- NO3--N )
Influent flowrate(Q) · removed NO3- - N(∆S) , Total biofilm surface(aV) · EWNitrate
where Q is in m3/d, ∆S is in g- NO3--N/m3, aV is in m2, EWNitrate is 14 in g-NO3--N/5e- equivalent for reduction of nitrate to nitrogen gas, and J is in e--eq/m2 · d.
sp., and Dechlorosoma suillum. Dehalococcoides were abundant in the clone library tarfeting the 16S rRNA gene, and no other known dechlorinators (e.g., Desulfuromonas, Dehalobacter, Deshulfitobacterium, Sulfurospirillum, and Geobacter) were present in the clone library, indicating that Dehalococcoides most likely were the main known dechlorinators in the MBfR biofilm. We identified at least two distinct Dehalococcoides 16S rRNA sequences in the biofilm. One is most similar (but not identical) to strain BAV1, and the second one is most similar (but not identical) to strain CBDB1. An important finding of the research is that TCE reducers and Dehalococcoides in particular were present in the MBfR biofilm that was active in nitrate and perchlorate reductions, even though it had not been exposed to TCE. Previous research has shown that Dehalococcoides can be present in environments where no previous TCE or chlorinated solvents has occurred (44), and as a clear example strain FL2 (17) was isolated from a pristine river sediment. We believe that some Dehalococcoides were present in the initial water inoculum and that autotrophic selection with H2 as the direct electron donor favored their accumulation. The current understanding of Dehalococcoides metabolism is that it requires acetate as its carbon source
TABLE 3. 16S rRNA Genes Detected in the Clone Library from Biofilm Samples in the TCE-Reducing MBfR sequence name
accession number
closest Genbank match (as of Sept 19 2007)
% identity (query bp/target bp)
number of clones in TCE-MBfR
J28–4 J28–5
EU169839 EU169840 EU169842 EU169841
99 (1528/1532) 99 (1440/1461) 99 (1427/1453) 99 (1524/1530) 99 (1522/1537) 99 (1510/1514) 99 (1495/1502) 99 (1482/1485) 99 (1484/1485) 99 (1514/1520) 99 (1433/1457)
4 1
J28–17
Dechlorosoma suillum uncultured Geothrix spa Geothrix fermentansb AuS2VC111 Lysobacter sp. Shinshu-th3b AuS2VC111 Lysobacter sp. BBCT6b Dehalococcoides sp. CBDB1 Dehalococcoides sp. BAV1 Pseudoxanthomonas mexicana uncultured beta proteobacterium SBR1001b beta proteobacterium G5G6b Spirochaeta sp. grapes
J28–14 J28–28 J28–39 J28–34 J28–36
EU169846 EU169847 EU169843 EU169844
J28–42
EU169845
23c
15c 1 1
95 (1440/1507) 99 (1455/1467)
1
a
Highest correlated sequence belongs to another clone, i.e. non cultured microorganism. b Isolate with the highest percentage match. c Not all Dehalococcoides and Lysobacter clones were completely sequenced. The sum of all of them is presented and he different clones found are listed.
TABLE 4. Reductive Dehalogenase Genes Present in Dehalococcoides Isolatesa strain
bvcA
tceA
vcrA
Ethenogenes 195 FL2 BAV1 GT VS CBDB1
+ -
+ + -
+ + -
References 54, 17, 48, 51 55, 64
55, 63 63 63 63
a + indicates the RDase has been reported present; indicates RDase has been tested for and reported absent.
FIGURE 3. Quantitative real-time PCR analysis of Dehalococcoides-containing biofilm before and after TCE addition using specific primers and probes. The bar graphs represent biofilm samples taken on days 20, 80, and 110 (or 0, 60, and 90 days after TCE feeding). All samples were run in triplicate, and standard deviation error bars are included in the figure. Bac ) general bacterial 16S rRNA gene, Dhc ) Dehalococcoides 16S rRNA gene. vcrA was targeted, but not detected. (16, 17, 48, 65, 66), but our feed medium contained no acetate. If Dehalococcoides truly requires acetate, then the autotrophic reactions involving H2 and CO2 must have produced acetate in at least trace amounts. This could have occurred directly through the action of homoacetogens (67) or indirectly through the transformation of soluble microbial products. Alternately, Dehalococcoides may not have a strict requirement for acetate. Our studies could not discriminate among these alternatives, but should stimulate future study. Quantification of Dehalococcoides and RDase genes. Figure 3 shows the qRT-PCR results for day 20, 80, and 110 (or 0, 60, and 90 days after TCE addition). By day 80, general bacterial 16S rRNA genes decreased to about one-third of the day-20 values, from 4.6 × 107 to 1.3 × 107 gene copies/ cm2. On the other hand, Dehalococcoides 16S rRNA genes stayed almost constant at ∼106 gene copies/cm2. The decrease of general bacterial 16S rRNA genes resulted in a higher percentage (8%) of Dehalococcoides 16S rRNA genes with respect to the total bacterial rDNA at 80 days, compared to 2.9% at day 20. As the biofilm community continued to adapt to TCE in the MBfR, quantified Dehalococcoides 16S rRNA genes and general bacterial 16S rRNA genes increased in numbers, and the proportion of Dehalococcoides 16S rRNA genes relative to quantified general bacterial 16S rRNA genes
also continued increasing: On day 110, quantified Dehalococcoides 16S rRNA genes were 1.9 × 107 gene copies/cm2, while general bacterial 16S rRNA genes were 1.6 × >108. Thus, the proportion of Dehalococcoides 16S rRNA genes to general bacterial 16S rRNA genes increased to 12%. Quantification of reductive dehalogenase genes (Figure 3) indicates the presence of tceA (64) and bvcA (68), but the absence of vcrA (69) in the initial culture and in the adapted MBfR biofilm. Dehalococcoides are reported have one 16S rRNA gene per genome and one tceA or bvcA gene/genome. Our data suggest the presence of the tceA gene in all of the Dehalococcoides in the biofilm, since tceA ) Dhc. However, the copy numbers detected for bvcA show that not all Dehalococcoides in the reactor contained this gene. This observation and the results from the clone libraries suggest the presence of at least two different strains of Dehalococcoides in the biofilm: one Dehalococcoides strain that has only the tceA gene and possibly a second Dehalococcoides strain that has tceA and bvcA. The first strain is at least partially responsible for the reduction from TCE to cis-DCE. The second Dehalococcoides strain is likely to work together with the first strain during the dechlorination of TCE to cis-DCE and is likely responsible for the complete dechlorination of VC to ethene. Similar results were observed by Holmes et al. (53), where two Dehalococcoides strains were identified in the ANAS culture through the use of real time PCR. One of them had the tceA gene and seemed to be responsible of TCE and cis-DCE dechlorination, and the second one had vcrA and seemed to be responsible of VC dechlorination. Table 4 summarizes known contents of the 3 RDases previous to our study. The presence of tceA and bvcA on a Dehalococcoides strain has not been reported before. The number of bvcA genes in the reactor decreased from day 20 to day 80 and then increased again by day 110. A VOL. 42, NO. 2, 2008 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
481
decrease of bvcA genes in the presence of TCE as an electron acceptor was also observed by Sung et al. (51). bvcA genes increase once dechlorination of TCE produces cis-DCE and VC, which can then be used as electron acceptors by bvcAhosting Dehalococcoides. Ritalahti et al. (52) showed that the diversity of RDases is not covered by the three RDases used as a target in this study. The fact that other RDases can be present in our biofilm is a possibility; however, our data suggest that all the Dehalococcoides in our culture have tceA and some have bvcA also. In summary, we provide the first report in which Dehalococcoides are proven to be present as part of an autotrophic biofilm community active in reductive dechlorination of TCE to ethene in a laboratory controlled experiment. At least two different Dehalococcoides strains were present in the enriched biofilm, and one of them seems to be a new strain that is unique for having tceA and bvcA RDases.
(15)
(16) (17)
(18)
(19)
Acknowledgments
(20)
This work was supported by a grant from the National Water Research Institute (NWRI). We acknowledge the valuable contributions of our research partners at MontgomeryWatson-Harza: Samer Adham, Geno Lehman, and Kuangping Chiu. We thank Frank E. Löffler for providing all plasmids used as controls for PCRs in this study.
(21) (22)
Literature Cited (1) Gossett., J. M.; Zinder, S. H. Microbiological Aspects Relevant To Natural Attenuation of Chlorinated Ethenes. Symposium of the Natural Attenuation of Chlorinated Organics in Groundwater; U.S. Environmental Protection Agency: Dallas, TX, 1996. (2) Bradley, P. M. Microbial degradation of chloroethenes in groundwater systems. Hydrol. J. 2000, 8, 104–111. (3) McCarty, P. L. Breathing with chlorinated solvents. Science 1997, 276, 1521–1522. (4) Westrick, J. J.; Mello, J. W.; Thomas, R. F. The groundwater supply survey. J. Am. Water Works. Ass. 1984, 76, 52–29. (5) Mackay, D. M.; Cherry, J. A. Groundwater contamination: pumpand-treat remediation. Environ. Sci. Technol. 1989, 28, 630– 636. (6) Abelson, P. H. Inefficient remediation of ground-water pollution. Science 1990, 250, 733. (7) U.S. EPA. National Primary Drinking Water Regulations: Technical Factsheet on: Trichloroethylene; United States Environmental Protection Agency, http://www.epa.gov/OGWDW/dwh/ t-voc/trichlor.html, 1995. (8) U.S. EPA. Trichloroethylene Health Risk Assessment: Synthesis and Characterization, External Review Draft, EPA/600/P-01/ 002A; United States Environmental Protection Agency, Office of Research and Development: Washington, DC, 2001. (9) Ellis, D. E.; Lutz, E. J.; Odom, J. M.; Buchanan, R. J.; Bartlett, C. L.; Lee, M. D.; Harkness, M. R.; Deweerd, K. A. Bioaugmentation for accelerated in situ anaerobic bioremediation. Environ. Sci. Technol. 2000, 34, 2254–2260. (10) Sherwood, L. B.; Slater, G. F.; Sleep, B.; Witt, M.; Klecka, G. M.; Harkness, M.; Spivack, J. Stable carbon isotope evidence for intrinsic bioremediation of tetrachloroethene and trichloroethene at area 6, Dover Air Force Base. Environ. Sci. Technol. 2001, 35, 261–269. (11) Lendvay, J. M.; Löffler, F. E.; Dollhopf, M.; Aiello, M. R.; Daniels, G.; Fathepure, B. Z.; Gebhard, M.; Heine, R.; Helton, R.; Shi, J.; Krajmalnik-Brown, R.; Major, Jr. C.L.; Barcelona, M. J.; Petrovskis, E.; Hickey, R.; Tiedje, J. M.; Adriaens, P. Bioreactive barriers: a comparison of bioaugmentation and biostimulation for chlorinated solvent remediatio. Environ. Sci. Technol. 2003, 37, 1422– 1431. (12) Semprini, L.; Kampbell, D. H.; Wilson, J. T. Anaerobic transformation of chlorinated aliphatic-hydrocarbons in a sand aquifer based on spatial chemical-distributions. Water Res. 1995, 31, 1051–1062. (13) Buscheck, T. E.; O’Reilly, K. T.; Hickman, G. In Situ and On-site Bioremediation (3); Battelle Press: Columbus, OH, 1997; pp 149– 164. (14) McCartyP. L. WilsonJ. T. Natural Anaerobic Treatment of a TCE Plume, St. Joseph, MI, NPL Site. in Bioremediation of Hazardous Wastes,EPA/600R-92/126; U.S. Environmental Protection Agency, 482
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 42, NO. 2, 2008
(23) (24)
(25) (26) (27)
(28)
(29)
(30)
(31) (32) (33) (34)
(35) (36)
Center for Environmental Research Information: Cincinnati, OH,1992; pp4750. Maymó-Gatell, X.; Tandoi, V.; Gossett, J. M.; Zinder, S. H. Characterization of an H2-utilizing enrichment culture that reductively dechlorinates tetrachloroethene to vinyl chloride and ethene in the absence of methanogenesis and acetogenesis. Appl. Environ. Microbiol. 1995, 61, 3928–3933. Maymó-Gatell, X.; Chien, Y.; Gossett, J. M.; Zinder, S. H. Isolation of a bacterium that reductively dechlorinates tetrachloroethene to ethene. Science 1997, 276, 1521–1522. He, J.; Sung, Y.; Krajmalnik-Brown, R.; Ritalahti, K. M.; Löffler, F. E. Isolation and characterization of Dehalococcoides sp. Strain FL2, a trichloroethene (TCE)- and 1,2-dichloroethene-respiring anaerobe. Environ. Microbiol. 2005, 7, 1442–1450. DiStefano, T. D.; Gossett, J. M.; Zinder, S. H. Reductive dehalorination of high concentrations of tetrachloroethene to ethane by an anaerobic enrichment culture in the absence of methanogenesis. Appl. Environ. Microbiol. 1991, 57, 2287–2292. Harkness, M. R.; Bracco, A. A.; Brennan, M. J. Jr.; Deweerd, K. A.; Spivack, J. L. Use of bioaugmentation to stimulate complete reductive dechlorination of trichloroethene in Dover soil columns. Environ. Sci. Technol. 1999, 33, 1100–1109. Löffler, F. E.; Ritalahti, K. M.; Tiedje, J. M. Dechlronation of chloroethenes is inhibited by 2-bromoethanesulfonate in the absence of methanogens. Appl. Environ. Microbiol. 1997, 63, 4982–4985. Rosner, B. M.; McCarty, P. L.; Spormann, A. M. In vitro studies on reductive vinyl chloride dehalogenation by an anaerobic mixed culture. Appl. Environ. Microbiol. 1997, 63, 4139–4144. Pressman, J.G.; Georgiou, G.; Speitel, G. E. Jr. Scale-up considerations for a hollow-fiber-membrane bioreactor treating trichloroethylene-contaminated water. Water Environ. Res. 2005, 77, 533–542. Krumholz, L. R. Desulfuromonas chloroethenica sp. nov. uses tetrachloroethylene and trichloroethylene as electron acceptors. Int. J. Syst. Bacteriol. 1997, 47, 1262–1263. Löffler, F. E.; Li, J.; Urbance, J. W.; Tiedje, J. M. Characterization of strain BB1, a tetrachloroethene (PCE)-dechlorinating anaerobe. Presented at the 98th General Meeting of the American Society for Microbiology, Atlanta, GA, May 17–21, 1998; Abstract Q-177. Boopathy, R.; Peters, R. Enhanced biotransformation of trichloroethylene under mixed electron acceptor conditions. Curr. Microbiol. 2001, 42, 134–138. Yu, S.; Semprini, L. Kinetics and modeling of reductive dechlorination at high PCE and TCE concentrations. Biotechnol. Bioeng. 2004, 88, 451–464. Drzyzga, O.; Gottschal, J. C. Tetrachloroethene dehalorespiration and growth of Desulfitobacterium frappieri TCE1 in strict dependence on the activity of Desulforvibrio fructosivorans. Appl. Environ. Microbiol. 2002, 68, 642–649. DiStefano, T. D.; Gossett, J. M.; Zinder, S. H. Hydrogen as an electron donor for dechlorination of tetrachloroethene by an anaerobic mixed culture. Appl. Environ. Microbiol. 1992, 58, 3622–3629. Smatlak, C. R.; Gossett, J. M.; Zinder, S. H. Comparative kinetics of hydrogen utilization for reductive dechlorination of tetrachloroethene and methanogenesis in an anaerobic enrichment culture. Environ. Sci. Technol. 1996, 30, 2850–2858. Fennell, D. E.; Gossett, J. M.; Zinder, S. H. Comparison of butyric acid, ethanol, lactic acid, and propionic acid as hydrogen donors for the reductive dechlorination of tetrachloroethene. Environ. Sci. Technol. 1997, 31, 918–926. Ballapragada, B. S.; Stensel, H. D.; Puhakka, J. A.; Ferguson, J. F. Effect of hydrogen on reductive dechlorination of chlorinated ethenes. Envrion. Sci. Technol. 1997, 31, 1728–1734. Yang, Y.; McCarty, P. L. Competition for hydrogen within a chlorinated solvent dehalogenating anaerobic mixed culture. Environ. Sci. Technol. 1998, 32, 3591–3597. Yang, Y.; McCarty, P. L. Biomass, oleate, and other possible substrates for chloroethene reductive dehalogenation. Bioremed. J. 2000, 4, 125–133. Heimann, A. C.; Friis, A. K.; Jakobsen, R. Effects of sulfate on anaerobic chloroethene degradation by an enriched culture under transient and steady-state hydrogen supply. Water Res. 2005, 39, 3579–3586. Wu, W. M.; Nye, J.; Jain, M. K.; Hickey, R. F. Anaerobic dechlorination of trichloroethylene (TCE) to ethylene using complex organic materials. Water Res. 1998, 32, 1445–1454. Chung, J.s; Nerenberg, R.; Rittmann, B. E. Bio-reduction of selenate using a hydrogen-based membrane biofilm reactor. Envrion. Sci. Technol. 2006, 40, 1664–1671.
(37) Chung, J.; Nerenberg, R.; Rittmann, B. E. Bio-reduction of soluble chromate using a hydrogen-based membrane biofilm reactor. Water Res. 2006, 40, 1634–1642. (38) Chung, J.; Ryu, H.; Abbaszadegan, M.; Rittmann, B. E. Community structure and function in a H2-based membrane biofilm reactor capable of bioreduction of selenate and chromate. Appl. Microbiol. Biotechnol. 2006, 72, 1330–1339. (39) Lee, K. C.; Rittmann, B. E. Applying a novel autohydrogenotrophic hollow-fiber membrane biofilm reactor for denitrification of drinking water. Water Res. 2002, 36, 2040–2052. (40) Nerenberg, R.; Rittmann, B. E. Hydrogen-based, hollow-fiber membrane biofilm reactor for reduction of perchlorate and other oxidized contaminants. Water Sci. Technol. 2004, 49, 223–230. (41) Rittmann, B. E.; Nerenberg, R.; Lee, K. C.; Najm, I.; Gillogly, T. E.; Lehman, G. E.; Adham, S. S. Hydrogen-based hollow-fiber membrane biofilm reactor (MBfR) for removing oxidized contaminants. Water Supply 2004, 4, 127–133. (42) Holliger, C.; Wohlfarth, G.; Diekert, G. Reductive dechlorination in the energy metabolism of anaerobic bacteria. FEMS Microbiol. Rev. 1998, 22, 383–398. (43) Smidt, H.; deVos, W. M. Anaerobic microbial dehalogenation. Annu. Rev. Microbiol. 2004, 58, 43–73. (44) Hendrickson, E. R.; Payne, J. A.; Young, R. M.; Starr, M. G.; Perry, M. P.; Fahnestock, S.; Ellis, D. E.; Ebersole, R. C. Molecular analysis of Dehalococcoides 16S ribosomal DNA from chloroethene-contaminated sites through North America and Europe. Appl. Environ. Microbiol. 2002, 68, 485–495. (45) Cupples, A. M.; Spormann, A. M.; McCarty, P. L. Growth of a Dehalococcoides-like microorganism on vinyl chloride and cisdichloroethene as electron acceptors as determined by competitive PCR. Appl. Environ. Microbiol. 2003, 69, 953–959. (46) Duhamel, M.; Wehr, S. D.; Yu, L.; Rizvi, H.; Seepersad, D.; Dworatzek, S. Comparison of anaerobic dechlorinating enrichment cultures maintained on tetrachloroethene, trichloroethene, cis-dichloroethene and vinyl chloride. Water Res. 2002, 36, 4193–4202. (47) He, J.; Ritalahti, K. M.; Yang, K. L.; Koenigsberg, S. S.; Löffler, F. E. Detoxicification of vinyl chloride to ethane coupled to growth of an anaerobic bacterium. Nature 2003, 424, 62–65. (48) He, J.; Ritalahti, K. M.; Aiello, M. R.; Löffler, F. E. Complete detoxification of vinyl chloride by an anaerobic enrichment culture and identification of the reductively dechlorinating population as a Dehalococcoides species. Appl. Environ. Microbiol. 2003, 69, 996–1003. (49) LöfflerF. E. RitalahtiK. M. 16S rDNA-based tools identify Dehalococcoides species in many reductively-dechlorinating enrichment cultures. In Anaerobic Dehalogenation, SFB 193 Biological Waste Water Remediation; Kormller, M. A.,Ed.; Technical University: Berlin, Germany20015368. (50) Maymó-Gatell, X.; Nijenhuis, I.; Zinder, S. H. Reductive dechlorination of cis-1,2-dichloroethene and vinyl chloride by “Dehalococcoides ethenogenes”. Environ. Sci. Technol. 2001, 35, 516– 521. (51) Sung, Y.; Ritalahti, K. M.; Apkarian, R. P.; Loffler, F. E. Quantitative PCR confirms purity of strain GT, a novel trichloroethene-toethene-respiring Dehalococcoides isolate. Appl. Environ. Microbiol. 2006, 72, 1980–1987. (52) Ritalahti, K. M.; Amos, B. K.; Sung, Y.; Wu, Q. Z.; Koenigsberg, S. S.; Loffler, F. E. Quantitative PCR targeting 16S rRNA and reductive dehalogenase genes simultaneously monitors multiple Dehalococcoides strains. Appl. Environ. Microbiol. 2006, 72, 2765–2774. (53) Holmes, V. F.; He, J. Z.; Lee, P. K. H.; Alvarez-Cohen, L. Discrimination of multiple Dehalococcoides strains in a trichloroethene enrichment by quantification of their reductive dehalogenase genes. Appl. Environ. Microbiol. 2006, 72, 5877– 5883.
(54) Magnuson, J. K.; Romine, M. F.; Burris, D. R.; Kingsley, M. T. Trichloroethene reductive dehalogenase from Dehalococcoides ethenogenes: sequence of tceA and substrate range characterization. Appl. Environ. Microbiol. 2000, 66, 5141–5147. (55) Müller, J. A.; Rosner, B. M.; Von Abendroth, G.; MeshulamSimon, G.; McCarty, P. L.; Spormann, A. M. Molecular identification of the catabolic vinyl chloride reductase from Dehalococcoides sp. strain VS and its environmental distribution. Appl. Environ. Microbiol. 2004, 70, 4880–4888. (56) Chang, H. L.; Rittmann, B. E.; Amar, D.; Heim, R.; Ehlinger, O.; Lesty, Y. biofilm detachment mechanisms in a liquid-fluidized bed. Biotechnol. Bioeng. 1991, 38, 499–506. (57) APHA. Standard Methods for the Examination of Water and Wastewater, 19th ed. American Public Health Association: Washington, DC, 1998. (58) Cline, J. D. Spectrophotometric determination of hydrogen sulfide in natural waters. Limnol. Oceangr. 1969, 14, 454–458. (59) Heron, G.; Christensen, T. H.; Enfield, C. G. Henry’s law constant for trichroloethylene between 10 and 95°C. Environ. Sci. Technol. 1998, 32, 1433–1437. (60) U.S. EPA. Engineered Approaches to In Situ Bioremediation of Chlorinated Solvents: Fundamentals and Field Applications, EPA 542-R-00–008; U.S. Government Printing Office: Washington, DC, 2000. (61) Tsai, Y.; Rochelle, P. A. Extractionm of nucleic acids from environmental samples. In Environmental Molecular Microbiology: Protocols and Applications. Rochelle, P. A., Ed.; Horizon Scientific Press: Wymondham, UK, 2001. (62) Zhou, J. Z.; Davey, M. E.; Figueras, J. B.; Rivkina, E.; Gillichinsky, D.; Tiedje, J. M. Phylogenetic diversity of a bacterial community determined from Siberian tundra soil DNA. Microbiology 1997, 143, 3913–3939. (63) Krajmalnik-Brown, R.; Hölscher, T.; Thomson, I. N.; Saunders, F. M.; Ritalahti, K. M.; Löffler, F. E. Genetic identification of a putative vinyl chloride reductase in Dehalococcoides sp. strain BAV1. Appl. Environ. Microbiol. 2004, 70, 6347–6351. (64) Johnson, D. R.; Lee, P. K. H.; Holmes, V. F.; Alvarez-Cohen, L. An internal reference technique for accurately quantifying specific mRNAs by real-time PCR with a application to the tceA reductive dehalogenase gene. Appl. Environ. Microbiol. 2005, 71, 3866–3871. (65) Seshadri, R.; Adrian, L.; Fouts, D. E.; Eisen, J. A.; Phillippy, A. M.; Methe, B. A.; Ward, N. L.; Nelson, W. C.; Deboy, R. T.; Khouri, H. M.; Kolonay, J. F.; Dodson, R. J.; Daugherty, S. C.; Brinkac, L. M.; Sullivan, S. A.; Madupu, R.; Nelson, K. T.; Kang, K. H.; Impraim, M.; Tran, K.; Robinson, J. M.; Forberger, H. A.; Fraser, C. M.; Zinder, S. H.; Heidelberg, J. F. Genome sequence of the PCE-dechlorinating bacterium Dehalococcoides ethenogenes. Science 2005, 307, 105–108. (66) Adrian, L.; Szewzyk, U.; Wecke, J.; Gorisch, H. Bacterial dehalorespiration with chlorinated benzenes. Nature 2000, 408, 580–583. (67) Ollivier, B.; Cordruwisch, R.; Lombardo, A.; Garcia, J. L. Isolation and characterization of Sporomusa acidovorans sp. nov., a methylotrophic homoacetogenic bacterium. Arch. Microbiol. 1985, 142, 307–310. (68) Löffler, F. E.; Sun, Q.; Li, J.; Tiedje, J. M. 16S rRNA Gene-based detection of tetrachloroethene (PCE)-dechlorinating Desulfuromonas and Dehalococcoides species. Appl. Environ. Microbiol. 2000, 66, 1369–1374. (69) Schlötelburg, C.; von Wintzingerode, F.; Göbel, U. B. Structure and dynamics of an anaerobic 1,2-dichloropropane dechlorinating bioreactor culture. Schriftenr. Biol. Abwasserreinigung TU Berlin 2001, 15, 107–125.
ES702422D
VOL. 42, NO. 2, 2008 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
483
