Bone Marrow Mesenchymal Stem Cells Encapsulated in a Hydrogel

May 7, 2019 - Liver tissue engineering is going to be an effective treatment for end-stage liver disease. In this work, we distributed bone marrow ...
0 downloads 0 Views 7MB Size
Download PDF
Article Cite This: ACS Appl. Bio Mater. 2019, 2, 2444−2452

www.acsabm.org

Bone Marrow Mesenchymal Stem Cells Encapsulated in a Hydrogel System via Bioorthogonal Chemistry for Liver Regeneration Yajie Zhang,†,‡ Yue Zan,∥ Hong Chen,∥ Zhili Wang,† Tianyu Ni,‡ Min Liu,*,§ and Renjun Pei*,†,‡ †

School of Nano Technology and Nano Bionics, University of Science and Technology of China, Hefei 230026, China Institute for Interdisciplinary Research, Jianghan University, Wuhan 430056, China ∥ School of Pharmacy, Xi’an Jiaotong University, Xi’an 710061, China ‡ CAS Key Laboratory for Nano-Bio Interface, Division of Nanobiomedicine, Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences, Suzhou 215123, China Downloaded via NOTTINGHAM TRENT UNIV on August 13, 2019 at 11:07:43 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

§

S Supporting Information *

ABSTRACT: Liver tissue engineering is going to be an effective treatment for end-stage liver disease. In this work, we distributed bone marrow mesenchymal stem cells (BMSCs) into a fast-forming hydrogel system to develop a liver-mimicking construct for liver regeneration. The advantage of this hydrogel system was that this BMSC-encapsulating hydrogel could be formed via a bioorthogonal reaction between 2-cyanobenzothiazole and cysteine within several seconds. Thereafter, we explored the morphology, biocompatibility, and expressions of hepatic differentiation markers of this hydrogel system. These results illustrated that this system could provide a suitable niche for BMSC proliferation and differentiation, which could aid in future biomedical research of liver regeneration. KEYWORDS: bioorthogonal reaction, fast-forming hydrogel, BMSC-encapsulating, tissue engineering, liver regeneration

■

INTRODUCTION

reported that BMSCs are able to be induced to differentiate into hepatocytes, which makes them become perfect candidates to cure liver diseases.2,9,10 Current strategies for tissue regeneration focus on reconstructing liver-like tissue via biocompatible and implantable scaffolds to compensate liver function. A hydrogel, a scaffold with a highly hydrated tissue-like environment, is promising for fabricating native-mimicking tissue structures, in which living stem cells were encapsulated.11−13 Over the past decades, many attempts to form hydrogels have been reported. For example, triggers such as ionic, hydrophobic, or temperature have been used to form the hydrogels.14−16

End-stage liver disease, a serious disease with high morbidity and mortality rates, greatly threatens human health and life, including liver failure, cirrhosis, and liver cancer. Currently, liver transplantation is the most effective approach to cure this disease.1,2 However, due to the challenges, such as the critical shortage of donor organs, transplant rejection, and high expense,3,4 it is urgent to develop alternative therapies to overcome the above-mentioned challenges. Recently, great attention has focused on the concept of tissue engineering, which encapsulates stem cells into a 3D scaffold to generate a biomimetic organ in vitro.5 Bone marrow mesenchymal stem cells (BMSCs) are commonly used in liver tissue engineering since the BMSCs possess several advantages such as abundant source, pluripotency, and low immunogenicity.6−8 It has been © 2019 American Chemical Society

Received: February 25, 2019 Accepted: May 6, 2019 Published: May 7, 2019 2444

DOI: 10.1021/acsabm.9b00156 ACS Appl. Bio Mater. 2019, 2, 2444−2452

Article

ACS Applied Bio Materials

acid (4-arm PEG-CM, 20 kDa) were supplied by Xiamen Sinopeg Biotech CO., Ltd. 6-amino-2-cyanobenzothiazole (CBT), Boc-ethylmercapto-L-cysteine (dicyclohexylammonium) salt, isobutyl chloroformate (IBCF), N-methyl morpholine (NMP), and dithiothreitol (DTT) were supplied by Sigma. Hepatocyte growth factor (HGF), epidermal growth factor (EGF), and fibroblast growth factor (FGF) were obtained from Peprotech. The primers for cytokeratin 18 (CK18), α-fetoprotein (AFP), cytokeratin 19 (CK19), albumin (ALB), hepatocyte nuclear factor 4 alpha (HNF-4α), and glyceraldehyde-3phosphate dehydrogenase (GAPDH) were supplied by Sangon Biotech (Shanghai) Co., Ltd. BMSCs of 4−6 passages were used in all of the experiment. Synthesis of CBT- and Cys-Modified 4-Arm PEG. For the synthesis of 4-arm PEG-CBT, 4-arm PEG-CM was dissolved in THF; afterward, IBCF and NMP in 1.5× equivalent were added, and the mixture was stirred for 20 min. Next, CBT in 1.2× equivalent was added to the above solution, and the mixture was stirred overnight. Thereafter, the mixture was precipitated in diethyl ether to obtain PEG-CBT. Finally, the mixture was purified by dialyzing (MWCO = 3500) and lyophilized to obtain the final product. For the synthesis of 4-arm PEG-D-Cys, Boc-ethylmercapto-Lcysteine (dicyclohexylammonium) salt (Boc-D-Cys) was dissolved in anhydrous DMF, and then, DIEA, HOBT, and HBTU in 1.2× equivalent were added to the above solution to activate the carboxyl groups. After the mixture stirred for 15 min, 4-arm PEG-NH2 (0.2 times equivalent to the carboxyl groups) was added and the mixture was stirred overnight. Thereafter, the mixture precipitated in diethyl ether followed by removing the Boc protection group in 20% TFA in CH2Cl2. Finally, the solution was further purified by dialyzing (MWCO = 3500) and then lyophilized to obtain the final product (4-arm PEG-D-Cys). Preparation of PEG Hydrogels. The PEG hydrogels were fabricated through bioorthogonal reaction by adding DTT in PBS. Briefly, the solutions of 4-arm PEG-D-Cys (final concentration: 2.5% w/ v) and 4-arm PEG-CBT (final concentration: 2.5% w/v) were mixed together, followed by adding DTT (final concentration: 2 mM). Characterization of Hydrogels. Briefly, hydrogels were frozen in liquid nitrogen followed by freeze-drying. The structure of the lyophilized hydrogel was observed by SEM (Quanta, FEG 250) after being sputter-coated with gold. Rheological tests of the hydrogels were investigated on a Haake rotational rheometer (RS6000). Swelling studies were carried out as follows: The freeze-dried hydrogels were weighed as Wd. The wet hydrogels also were weighed (Ww) after about 2 days of immersion in PBS to reach equilibrium. The equation ((Ww − Wd)/Wd) was used to calculate the swelling ratio (SR) of hydrogels. Proliferation of BMSCs within the Hydrogel in Vitro. First, 4arm PEG-CBT was dissolved in PBS, and 4-arm PEG-D-Cys was dissolved in PBS containing DTT (final concentration: 2 mM). Then, BMSCs (1.5 × 106 cells/mL) were separately mixed with two precursor solutions (50 μL of 4-arm PEG-Cys and 50 μL of 4-arm PEG-CBT solution, final total concentration: 5% w/v, (2.5% w/v for PEG-D-Cys, 2.5% w/v for PEG-CBT)). Next, these two precursor solutions were mixed thoroughly. After the formation of the hydrogel, the hydrogels were transferred into a 24-well plate, and the media were replaced every 48 ∼ 72 h. In the end, the growth of encapsulated BMSCs was measured by a WST assay at different time points. Meanwhile, the cell viability of encapsulated BMSCs was also observed by the Live/Dead staining assay. Furthermore, the morphology of the lyophilized BMSCencapsulating hydrogel was observed by SEM. Cell Induction. BMSCs were encapsulated within a hydrogel according to the above-mentioned method. Briefly, the as-prepared hydrogel was cultured in the induction media containing DMEM/F-12, 12% FBS, 100 U/mL penicillin, 100 μg/mL streptomycin, 20 ng/mL HGF, 20 ng/mL bFGF, 20 ng/mL (EGF), 10−6 M dexamethasone, 50 mU/mL insulin, and the induction media changed every 48 ∼ 72 h. Thereafter, BMSC-encapsulated hydrogels were isolated for further investigation at certain times. Hepatic Specific Gene Expressions. The expressions of the hepatic-specific markers were analyzed at day 8, 16, and 24 by qRTPCR, including albumin (ALB), α-fetoprotein (AFP), cytokeratin 18 (CK18), cytokeratin 19 (CK19), hepatocyte nuclear factor 4α (HNF-

However, in vivo stabilities of these hydrogels are compromised due to the noncovalently cross-linked bonds with a relatively high sensitivity to the physiological environment.17,18 On the other hand, the obtained covalent hydrogels are promising biomaterials because of their good physical stability and controllable mechanical strength,19 including the Cu(I)catalyzed 1,3-dipolar cycloaddition reaction (CuAAC), Michael-type addition,20−22 enzyme-mediated cross-linking,23 Schiff base formation,24 and photopolymerization.25 However, the biosafety and gelation rate of hydrogels are also important parameters. In fact, the proposed chemical cross-linking methods have shown either some cytotoxicity or a low gelation rate.26−28 Bioorthogonal reactions have been discovered and applied widely in the biomedical field, which occur specifically between functional groups under physiological conditions, especially for labeling proteins. Among these bioorthogonal reactions, a thiol-based bioorthogonal reaction between 2cyanobenzothiazole (CBT) and cysteine (Cys) has attracted rapidly increasing interest, which happens in the firefly body and affords luciferin with fast reaction kinetics, high efficiency, biocompatibility, and no need of any catalyst.29−31 The secondorder rate constant of the CBT/Cys reaction (9.19 M−1 s−1) is much faster than other bioorthogonal reactions that have been already used in hydrogel forming, such as Staudinger ligation (10−3 M−1 s−1), strain-promoted azide−alkyne cycloadditions (SPAAC, 10−2 to 1 M−1 s−1),32−34 and the reaction between tetrazine and norbornene (1.9 M−1 s−1). Therefore, this biorthogonal reaction can be introduced into a fast-forming hydrogel system, which has a great biocompatibility, short gelation time, and in vivo stability. In this study, 4-arm poly(ethylene glycol) was used as a main structure and CBT/Cys-based bioorthogonal reaction pairs were modified onto the PEG and used as a cross-linker; then a binary PEG-based hydrogel system with fast kinetics was constructed. The gelation time of this hydrogel system can be controlled in several seconds, and BMSCs were also embedded simultaneously during the formation of a hydrogel. Thereafter, the mechanical properties, proliferation, and hepatic differentiation were investigated. Our results provide the proof for the research of the hydrogel−BMSCs complex in the treatment of liver diseases.

■

EXPERIMENTAL SECTION

Materials and Instruments. 4-Arm poly(ethylene glycol) amine (4-arm PEG-NH2, 20 kDa) and 4-arm poly(ethylene glycol) carboxylic

Table 1. RT-PCR Primers for ALB, AFP, CK18, CK19, and HNF-4α Genes gene ALB AFP CK18 CK19 HNF-4α GAPDH

prime sequence forward: GTGAGCGAGAAGGTCACCAA reverse: TTTCACCAGCTCAGCGAGAG forward: CACCATCGAGCTCGGCTATT reverse: GAGACAGGAAGGTTGGGGTG forward: GCCCTGGACTCCAGCAACT reverse: ACTTTGCCATCCACGACCTT forward: CTGGGTGGCAATGAGAAGAT reverse: TCAAACTTGGTCCGGAAGTC forward: ACCTCAACTCATCCAACAG reverse: GACACTGGTTCCTCTTATCT forward: TGGAGTCTACTGGCGTCTT reverse: TGTCATATTTCTCGTCCTTCA 2445

DOI: 10.1021/acsabm.9b00156 ACS Appl. Bio Mater. 2019, 2, 2444−2452

Article

ACS Applied Bio Materials Scheme 1. Synthesis Route (A) and Preparation of the BMSC-Encapsulating Hydrogel (B)

s), and 72 °C (30 s) for a total of 45 cycles and completed with a final extension at 72 °C (5 min). For quantitative PCR (qPCR), the Mastercycler nexus (Eppendorf) and SYBR Green I PCR Kit was used. Quantification of Albumin and Urea. The albumin secretion of BMSCs in the hydrogel system was evaluated at day 7, 14, and 21. Samples cultured in the complete media were collected as controls. The albumin secretions of the samples were measured by the enzyme-linked immunosorbent assay (ELISA) according to the manufacturer’s instructions (Abcam). The absorbance was measured at the wavelength

4α), and glyceraldehyde phosphate dehydrogenase (GAPDH) used as a control. A description of gene sequences was summarized in Table 1. At different time points, the culture media were removed followed by extensively washing with PBS. Total RNA was extracted by Trizol (Takara) according to the manufacturer’s instructions and quantified by UV spectroscopy. Reverse transcription PCR (RT-PCR) was then carried out with the PrimeScript RT Reagent Kit (Takara). Complementary DNA (cDNA) was initially activated at 95 °C (3 min), and then amplified at 95 °C (30 s), at annealing temperature (30 2446

DOI: 10.1021/acsabm.9b00156 ACS Appl. Bio Mater. 2019, 2, 2444−2452

Article

ACS Applied Bio Materials

Figure 1. (A, C) SEM images of prepared hydrogels. (B) The view of the hydrogel. (D, E) Morphologies of BMSCs within a scaffold. (F) G′, storage modulus; G″, loss modulus.

Figure 2. (A) Growth of BMSCs within hydrogels after culturing for 1, 5, and 7 days, *** p < 0.001. (B) Confocal images of BMSCs within the hydrogels culturing for 1, 5, and 7 days. (C) The 3D view of BMSCs within the PEG hydrogel culturing for 7 days. After rehydrating, the sections were incubated in 0.1% Triton X-100 for 20 min, rinsed in PBS 3 times, and subsequently in blocking buffer for 1 h to block nonspecific binding of immunoglobulin. After diluting in PBS 500 times, the sheep antirat albumin antibody was then added to the above samples, and the mixture was incubated overnight at 4 °C. Thereafter, the samples were washed with washing buffer, followed by incubating in Alexa Fluor 488-conjugated donkey antisheep IgG (diluting 200 times in PBS) for 50 min. Finally, the slices were

of 450 nm, and the albumin concentrations were calculated through a standard curve. The urea synthesis of BMSCs in the hydrogel system was evaluated at day 7, 14, and 21. Samples cultured in the complete media were collected as controls. The urea production test was performed with the Urea Nitrogen Kit as the manufacturer’s protocol described. Albumin Staining. The BMSC-encapsulating hydrogels were fixed with 4% (w/v) paraformaldehyde overnight followed by dehydrating. The fixed samples were cut into sections after embedding in paraffin. 2447

DOI: 10.1021/acsabm.9b00156 ACS Appl. Bio Mater. 2019, 2, 2444−2452

Article

ACS Applied Bio Materials

Figure 3. Hepatic-specific marker ALB (A), AFP (B), CK18 (C), CK19 (D), and HNF-4α (E) expressions of BMSCs encapsulated in the hydrogel at different stages by qPCR; * p < 0.05, ** p < 0.01, *** p < 0.001. counterstained with DAPI after removing the secondary antibody and photographed through a confocal microscope. Glycogen Storage. The sections of BMSC-encapsulating hydrogels were made as albumin staining, followed by deparaffinizing, hydrating, and permeabilizing. As negative samples, the glycogen in the slides was digested by treating with amylase before staining. Next, all of the slides were incubated in 0.5% periodic acid for 10 min to be oxidized. Thereafter, the slides were washed and incubated in Schiff’s reagent. Finally, the slices were washed with DI water for 10 min, and nuclei were subsequently counterstained in Mayer’s hematoxylin. The images were obtained using optical microscopy. Statistical Analysis. All data were reported as mean ± standard deviation for in vitro studies. Statistically significant was estimated through the Origin Pro 8.5 program, (p < 0.05).

differentiation of BMSCs and thus successfully incorporate into a target organ. Due to the excellent biocompatibility, nonimmunogenity, and hydrophilicity, PEG is one of the common materials in the biomedical area.35−37 In this work, we fabricated a fast-forming hydrogel via bioorthogonal chemistry between CBT and Cys (Scheme 1). The 1H NMR spectra (Figure S1A) and FT-IR (Figure S1B) were used to confirm that PEG-CBT and PEG-D-Cys conjugates were successfully synthesized. For the 1H NMR spectra, due to appearance of the characteristic peaks at δ 7.6, 8.1, and 8.4, which are assigned to the aromatic protons of CBT, new peaks at δ 1.5 are clearly identified as the methyl group of D-Cys. The substitution degrees of CBT and Cys are then calculated to be ∼75%. For the FT-IR spectra, the characteristic peaks at ∼1700 or 2100 cm−1 refer to the group of CONH or CN, which further demonstrates that PEG-CBT and PEG-D-Cys conjugates were successfully synthesized.

■

RESULTS AND DISCUSSION Synthesis of PEG Hydrogels. An ideal construction of a 3D scaffold should offer a microenvironment for the growth and 2448

DOI: 10.1021/acsabm.9b00156 ACS Appl. Bio Mater. 2019, 2, 2444−2452

Article

ACS Applied Bio Materials

Characterization of PEG Hydrogels. We fabricated a fastforming BMSC-encapsulating hydrogel. After adjusting the concentrations of the precursors, we found that the hydrogel with 2.5% w/v for PEG-D-Cys, 2.5% w/v for PEG-CBT, and 2 mM for DTT showed a proper gelation rate and great biocompatibility for tissue repairing. Therefore, the hydrogel was formed within several seconds (Video S1), and BMSCs within the hydrogel showed the optimal survival condition. The lyophilized hydrogels were examined under SEM. The hydrogel showed interconnected pores, and their sizes ranged from 100 to 300 μm (Figure 1A,C, and the view of the hydrogel shown in Figure 1B), which is beneficial for cell growth and nutrient diffusion. Thereafter, the morphology of the BMSC-encapsulating hydrogel was observed (Figure 1D,E), and lots of BMSCs were found within the scaffold. Figure 1F shows that the hydrogel was successfully formed (G′ > G″) with a relative stable mechanical strength. Furthermore, the SR of the hydrogel was measured to be 15.8, which displayed a high water absorption, thus providing an ideal niche for BMSC survival as well as nutrient and metabolite transportation. Cells Culturing in Hydrogels in Vitro. The cell proliferating status in the 3D hydrogel was investigated at various time points. The OD value of BMSCs is approximately at 0.25 after culturing for 1 day, and up to 0.85 after 7 days (Figure 2A). It could be indicated that the hydrogel provided a great niche to support growth of BMSCs. Meanwhile, Live/Dead cell staining was also applied at designated cultured times. After culturing for 24 h, a relatively low live BMSC density was observed under CLSM, while culturing for 7 days, the live BMSC density showed a remarkable increase, while a few dead BMSCs existed (Figure 2B). Furthermore, the spatial distribution of Live/Dead BMSCs was shown in Figure 2C; a great number of green fluorescence dots were observed. All of the above results illustrated that the PEG hydrogel system promoted the BMSC viability, owing to its excellent biocompatibility. Hepatic Related Gene Expressions. The expressions of hepatic-specific markers were quantified by qPCR, including ALB, AFP, CK18, CK19, and HNF-4α. As shown in Figure 3,

Figure 4. (A) ALB secretion of BMSCs within a hydrogel in complete and inductive media. (B) Urea synthesis of BMSCs within a hydrogel in complete and inductive media.

Figure 5. Fluorescent images of a hepatic marker of ALB of BMSCs within a hydrogel in the inductive media (A) and complete media (B). 2449

DOI: 10.1021/acsabm.9b00156 ACS Appl. Bio Mater. 2019, 2, 2444−2452

Article

ACS Applied Bio Materials

Figure 6. Glycogen accumulation analysis. (A) Slide for the PAS staining. (B) Slide was digested by amylase prior to staining.

groups (7.0 and 9.4). The synthesis level of urea showed the same trend as the secretion level of albumin. These results illustrated that urea and albumin productions increased with the time and that the inductive group produced more production than that of the control group. Immunocytochemistry and PAS Staining. To confirm the hepatocyte differentiation ability of the encapsulated cells, inductive groups were cultured in induction media, while the control group was cultured in complete media. As shown in Figure 5, on the 14th day, immunofluorescence staining shows that BMSCs in the inductive group are successfully differentiated to hepatocyte-like cells within PEG hydrogels. Furthermore, glycogen storage is another feature of mature hepatocytes. After culturing in hepatic differentiation media for 14 days, BMSC-encapsulating hydrogels were analyzed by PAS staining. All sectioned samples were deparaffinized and hydrated while some of the paraffin-embedded sections were pretreated with amylase to digest the glycogen and set as a control. As shown in Figure 6A, glycogen storage was observed in the inductive group. However, after digesting with amylase, the accumulation of glycogen greatly decreased (Figure 6B). These results further demonstrated that BMSCs could successfully differentiate to hepatocyte-like cells within PEG hydrogels.

most of the markers showed a relatively low gene expression at day 8, which were slightly higher than the control group. As time went on, further upregulation was observed at day 16 , and the hepatic-specific gene expression levels were higher than that of the controls. Furthermore, the gene expressions of AFP and HNF-4α (early hepatic makers) reached the highest level at day 16 but decreased significantly at day 24, which was in common with the nature liver development and indicated these BMSCs could be considered as adult hepatocytes.38−40 In turn, the expression of ALB and CK18 (later hepatocyte makers) upregulated obviously at day 16 followed by a further upregulation at day 24. Interestingly, the mRNA expression levels of the maker for cholangiocyte and bile duct cells (CK19) increased throughout the whole time of the differentiation procedure, suggesting the potential cholangiocyte and hepatocyte differentiation ability of stem cells.41 Quantification of Urea and Albumin. Albumin is a representative protein synthesized by hepatocytes, and its production represents a key trait of mature functional hepatocytes. The secretion level of urea is a functional analysis of hepatocytes.38,42 To detect albumin and urea productions of BMSCs within hydrogels cultured in induction media, we harvested the culture media on day 7, 14, and 21 for analysis, and BMSCs within hydrogels cultured in complete media were set as a control. As shown in Figure 4A, the value of the albumin secretion for the inductive groups was about 10.2 at day 7, which was up to more than 3 times in comparison with the control groups (2.8). Thereafter, the values for the inductive groups were dramatically increased to 28.1 and 41.4 at day 14 and 21, respectively, while the control groups maintained around 5. Similar results were also obtained for the urea synthesis. As shown in Figure 4B, the value of the urea synthesis for the inductive groups was about 14.7 at day 7, which was up to 3 times in comparison with the control groups (4.8), and the values increased to 34.5 and 44.2 at day 14 and day 21, respectively, which are much higher than that of the control

■

CONCLUSION In summary, a fast-forming hydrogel based on CBT- or Cysmodified 4-arm PEG was prepared via a bioorthogonal reaction for liver repair. Thereafter, the physiochemical and mechanical properties and hepatic differentiation were detailed investigated. The results showed the hydrogels were formed rapidly with a great biocompatibility. Furthermore, the experiments demonstrate that the BMSCs encapsulated in this hydrogel system showed a great viability and possessed a great hepatocyte differentiation ability. Such a fast-forming hydrogel system based on a bioorthogonal reaction will be an excellent candidate for biomedical applications. 2450

DOI: 10.1021/acsabm.9b00156 ACS Appl. Bio Mater. 2019, 2, 2444−2452

Article

ACS Applied Bio Materials

■

(11) Peppas, N.; Hilt, J.; Khademhosseini, A.; Langer, R. Hydrogels in Biology and Medicine: From Molecular Principles to Bionanotechnology. Adv. Mater. 2006, 18, 1345−1360. (12) Nicodemus, G.; Bryant, S. Cell Encapsulation in Biodegradable Hydrogels for Tissue Engineering Applications. Tissue Eng., Part B 2008, 14, 149−165. (13) Gao, Y.; Kong, W.; Li, B.; Ni, Y.; Yuan, T.; Guo, L.; Lin, H.; Fan, H.; Fan, Y.; Zhang, X. Fabrication and Characterization of CollagenBased Injectable and Self-Crosslinkable Hydrogels for Cell Encapsulation. Colloids Surf., B 2018, 167, 448−456. (14) Shim, W.; Yoo, J.; Bae, Y.; Lee, D. Novel Injectable pH and Temperature Sensitive Block Copolymer Hydrogel. Biomacromolecules 2005, 6, 2930−2934. (15) Sahu, A.; Choi, W.; Tae, G. A Stimuli-Sensitive Injectable Graphene Oxide Composite Hydrogel. Chem. Commun. 2012, 48, 5820−5822. (16) Zhao, L.; Zhu, L.; Liu, F.; Liu, C.; Dan, S.; Wang, Q.; Zhang, C.; Li, J.; Liu, J.; Qu, X.; Yang, Z. pH Triggered Injectable Amphiphilic Hydrogel Containing Doxorubicin and Paclitaxel. Int. J. Pharm. 2011, 410, 83−91. (17) LeRoux, M.; Guilak, F.; Setton, L. Compressive and Shear Properties of Alginate Gel: Effects of Sodium Ions and Alginate Concentration. J. Biomed. Mater. Res. 1999, 47, 46−53. (18) Ramachandran, S.; Tseng, Y.; Yu, Y. Repeated Rapid ShearResponsiveness of Peptide Hydrogels with Tunable Shear Modulus. Biomacromolecules 2005, 6, 1316−1321. (19) Brandl, F.; Sommer, F.; Goepferich, A. Rational Design of Hydrogels for Tissue Engineering: Impact of Physical Factors on Cell Behavior. Biomaterials 2007, 28, 134−146. (20) Lutolf, M.; Raeber, G.; Zisch, A.; Tirelli, N.; Hubbell, J. CellResponsive Synthetic Hydrogels. Adv. Mater. 2003, 15, 888−892. (21) Shu, X. Z.; Liu, Y.; Palumbo, F.; Luo, Y.; Prestwich, G. In Situ Crosslinkable Hyaluronan Hydrogels for Tissue Engineering. Biomaterials 2004, 25, 1339−1348. (22) Phelps, E.; Enemchukwu, N.; Fiore, V.; Sy, J.; Murthy, N.; Sulchek, T.; Barker, T.; Garcia, A. Maleimide Cross-Linked Bioactive PEG Hydrogel Exhibits Improved Reaction Kinetics and Cross-Linking for Cell Encapsulation and In Situ Delivery. Adv. Mater. 2012, 24, 64− 70. (23) Jin, R.; Teixeira, L.; Dijkstra, P.; Blitterswijk, C.; Karperien, M.; Feijen, J. Enzymatically-Crosslinked Injectable Hydrogels Based on Biomimetic Dextran−Hyaluronic Acid Conjugates for Cartilage Tissue Engineering. Biomaterials 2010, 31, 3103−3113. (24) Tan, H.; Li, H.; Rubin, J.; Marra, K. Controlled Gelation and Degradation Rates of Injectable Hyaluronic Acid-Based Hydrogels through a Double Crosslinking Strategy. J. Tissue Eng. Regener. Med. 2011, 5, 790−797. (25) Lee, S.; Tae, G. Formulation and In Vitro Characterization of an In Situ Gelable, Photo-Polymerizable Pluronic Hydrogel Suitable for Injection. J. Controlled Release 2007, 119, 313−319. (26) Patterson, D.; Nazarova, L.; Prescher, J. Finding the Right (Bioorthogonal) Chemistry. ACS Chem. Biol. 2014, 9, 592−605. (27) Kennedy, R.; Hassan, W.; Tochwin, A.; Zhao, T.; Dong, Y.; Wang, Q.; Tai, H.; Wang, W. In Situ Formed Hybrid Hydrogels from PEG Based Multifunctional Hyperbranched Copolymers: A RAFT Approach. Polym. Chem. 2014, 5, 1838−1842. (28) Wei, H.; Yang, J.; Chu, H.; Yang, Z.; Ma, C.; Yao, K. Diels-Alder Reaction in Water for the Straightforward Preparation of Thermoresponsive Hydrogels. J. Appl. Polym. Sci. 2011, 120, 974−980. (29) Liang, G.; Ren, H.; Rao, J. A Biocompatible Condensation Reaction for Controlled Assembly of Nanostructures in Living Cells. Nat. Chem. 2010, 2, 54−60. (30) Liang, G.; Ronald, J.; Chen, Y.; Ye, D.; Pandit, P.; Ma, M.; Rutt, B.; Rao, J. Controlled Self-Assembling of Gadolinium Nanoparticles as Smart Molecular Magnetic Resonance Imaging Contrast Agents. Angew. Chem., Int. Ed. 2011, 50, 6283−6286. (31) Nguyen, D.; Elliott, T.; Holt, M.; Muir, T.; Chin, J. Genetically Encoded 1,2-Aminothiols Facilitate Rapid and Site-Specific Protein

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsabm.9b00156. The 1H NMR and FT-IR data of 4-arm PEG-CBT and 4arm PEG-D-Cys (PDF)

■

Video S1 (MP4)

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. *E-mail: [email protected]. ORCID

Yajie Zhang: 0000-0002-9916-080X Min Liu: 0000-0003-4779-8489 Renjun Pei: 0000-0002-9353-3935 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was financially supported by the Strategic Priority Research Program of Chinese Academy of Sciences (XDA16020100), the Key Research Program of Chinese Academy of Sciences (ZDRW-ZS-2016-2), the Science and Technology Foundation of Suzhou (SYG201747), and the CAS/SAFEA International Innovation Teams Program.

■

REFERENCES

(1) Zheng, S.; Xu, X.; Wu, J.; Chen, J.; Wang, W.; Zhang, M.; Liang, T.; Wu, L.-M. Liver Transplantation for Hepatocellular Carcinoma: Hangzhou Experiences. Transplantation 2008, 85, 1726−1732. (2) Lin, J.; Meng, L.; Yao, Z.; Chen, S.; Yang, J.; Tang, Z.; Lin, N.; Xu, R. Use an Alginate Scaffold-Bone Marrow Stromal Cell (BMSC) Complex for the Treatment of Acute Liver Failure in Rats. Int. J. Clin. Exp. Med. 2015, 8, 12593−12600. (3) Kim, W.; Stock, P.; Smith, J.; Heimbach, J.; Skeans, M. A.; Edwards, B.; Harper, A.; Snyder, J.; Israni, A.; Kasiske, B. OPTN & SRTR Annual Data Report. Am. J. Transplant. 2013, 13, 73−102. (4) Wertheim, J.; Petrowsky, H.; Saab, S.; Kupiec-Weglinski, J.; Busuttil, R. Major Challenges Limiting Liver Transplantation in the United States. Am. J. Transplant. 2011, 11, 1773−1784. (5) Fiegel, H.; Kaufmann, P.; Bruns, H.; Kluth, D.; Horch, R.; Vacanti, J.; Kneser, U. Hepatic Tissue Engineering: From Transplantation to Customized Cell-Based Liver Directed Therapies from the Laboratory. J. Cell. Mol. Med. 2008, 12, 56−66. (6) Lin, B.; Whu, S.; Chen, C.; Hsu, F.; Chen, J.; Liu, H.; Chen, C.; Liou, H. Bone Marrow Mesenchymal Stem Cells, Platelet-Rich Plasma and Nanohydroxyapatite-type I Collagen Beads were Integral Parts of Biomimetic Bone Substitutes for Bone Regeneration. J. Tissue Eng. Regener. Med. 2013, 7, 841−854. (7) Engler, A.; Sen, S.; Sweeney, H.; Discher, D. Matrix Elasticity Directs Stem Cell Lineage Specification. Cell 2006, 126, 677−689. (8) Yang, W.; Ma, B. A Mini-Review: The Therapeutic Potential of Bone Marrow Mesenchymal Stem Cells and Relevant Signaling Cascades. Curr. Stem Cell Res. Ther. 2019, 14, 214−218. (9) Jiang, W.; Cheng, Y.; Yen, M.; Chang, Y.; Yang, V.; Lee, O. CryoChemical Decellularization of the Whole Liver for Mesenchymal Stem Cells-Based Functional Hepatic Tissue Engineering. Biomaterials 2014, 35, 3607−3617. (10) Ong, S.; Dai, H.; Leong, K. Inducing Hepatic Differentiation of Human Mesenchymal Stem Cells in Pellet Culture. Biomaterials 2006, 27, 4087−4097. 2451

DOI: 10.1021/acsabm.9b00156 ACS Appl. Bio Mater. 2019, 2, 2444−2452

Article

ACS Applied Bio Materials Labeling via a Bio-Orthogonal Cyanobenzothiazole Condensation. J. Am. Chem. Soc. 2011, 133, 11418−11421. (32) Lang, K.; Chin, J. Bioorthogonal Reactions for Labeling Proteins. ACS Chem. Biol. 2014, 9, 16−20. (33) DeForest, C.; Polizzotti, B.; Anseth, K. Sequential Click Reactions for Synthesizing and Patterning Three-dimensional Cell Microenvironments. Nat. Mater. 2009, 8, 659−664. (34) Zheng, J.; Callahan, L.; Hao, J.; Guo, K.; Wesdemiotis, C.; Weiss, R.; Becker, M. Strain-Promoted Cross-Linking of PEG-Based Hydrogels via Copper-Free Cycloaddition. ACS Macro Lett. 2012, 1, 1071− 1073. (35) Malkoch, M.; Vestberg, R.; Gupta, N.; Mespouille, L.; Dubois, P.; Mason, A.; Hedrick, J.; Liao, Q.; Frank, C.; Kingsbury, K.; Hawker, C. Synthesis of Well-Defined Hydrogel Networks using Click Chemistry. Chem. Commun. 2006, 26, 2774−2776. (36) Page, J.; Harmata, A.; Guelcher, S. Design and Development of Reactive Injectable and Settable Polymeric Biomaterials. J. Biomed. Mater. Res., Part A 2013, 101, 3630−3645. (37) Zhu, J. Bioactive Modification of Poly(ethylene glycol) Hydrogels for Tissue Engineering. Biomaterials 2010, 31, 4639−4656. (38) Lau, T.; Ho, L.; Wang, D. Hepatogenesis of Murine Induced Pluripotent Stem Cells in 3D Micro-cavitary Hydrogel System for Liver Regeneration. Biomaterials 2013, 34, 6659−6669. (39) Tai, B.; Du, C.; Gao, S.; Wan, A.; Ying, J. The use of a polyelectrolyte fibrous scaffold to deliver differentiated hMSCs to the liver. Biomaterials 2010, 31, 48−57. (40) Lin, N.; Lin, J.; Bo, L.; WeiDong, P.; Chen, S.; Xu, R. Differentiation of Bone Marrow-Derived Mesenchymal Stem Cells into Hepatocyte-like Cells in an Alginate Scaffold. Cell Proliferation 2010, 43, 427−434. (41) Kamiya, A.; Gonzalez, F.; Nakauchi, H. Identification and Differentiation of Hepatic Stem Cells during Liver Development. Front. Biosci., Landmark Ed. 2006, 11, 1302−1310. (42) Lee, J.; Choi, Y.; Yong, W.; Pati, F.; Shim, J.; Kang, K.; Kang, I.; Park, J.; Cho, D. Development of a 3D Cell Printed Construct Considering Angiogenesis for Liver Tissue Engineering. Biofabrication 2016, 8, No. 015007.

2452

DOI: 10.1021/acsabm.9b00156 ACS Appl. Bio Mater. 2019, 2, 2444−2452