Boronic acid functionalized Au nanoparticles for selective microRNA

May 9, 2018 - Fiber-optic surface plasmon resonance (SPR) sensors are small, accurate and convenient tools for monitoring biological interaction...
0 downloads 0 Views 788KB Size
Download PDF
Subscriber access provided by UNIVERSITY OF THE SUNSHINE COAST

Article

Boronic acid functionalized Au nanoparticles for selective microRNA signal amplification in fiber-optic SPR sensing system Siyu Qian, Ming Lin, Wei Ji, Huizhen Yuan, Yang Zhang, Zhenguo Jing, Jianzhang Zhao, Jean-François Masson, and Wei Peng ACS Sens., Just Accepted Manuscript • DOI: 10.1021/acssensors.7b00871 • Publication Date (Web): 09 May 2018 Downloaded from http://pubs.acs.org on May 9, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

Boronic acid functionalized Au nanoparticles for selective microRNA signal amplification in fiberfiber-optic SPR sensing system Siyu Qian1, Ming Lin1, Wei Ji2*, Huizhen Yuan1, Yang Zhang1, Zhenguo Jing1, Jianzhang Zhao2, Jean-François Masson3, Wei Peng1* 1

College of Physics and Optoelectronics Engineering,Dalian University of Technology, Dalian, 116024, China

2

State Key Laboratory of Fine Chemicals, Dalian University of Technology, Dalian, 116024, China

3 Department of Chemistry, Université de Montréal, Montréal,Québec, H3C 3J7, Canada KEYWORDS: boronic acid; surface plasmon resonance (SPR); fiber-optic SPR sensors; microRNA detection; gold nanoparticles ABSTRACT: MicroRNA (miRNA) regulates gene expression and plays fundamental roles in multiple biological processes. However, if both single strand RNA and DNA can bind with capture DNA on the sensing surface, selectively amplifying the complementary RNA signal is still challenging for researchers. Fiber-optic surface plasmon resonance (SPR) sensors are small, accurate and convenient tools for monitoring biological interaction. In this paper, we present a high sensitivity microRNA detection technique using phenylboronic acid functionalized Au nanoparticles (PBA-AuNPs) in fiber-optic SPR sensing system. Due to the inherent difficulty to directly detect the hybridized RNA on the sensing surface, the PBAAuNPs were used to selectively amplify the signal of target miRNA. The result shows that the method has high selectivity and sensitivity for miRNA, with a detection limit at 2.7×10-13 M (0.27 pM). This PBA-AuNPs amplification strategy is universally applicable for RNA detection with various sensing technologies, such as surface-enhanced Raman spectroscopy and electrochemistry among others.

Nucleic acid detection is increasingly recognized as a valuable tool for fundamental studies in the biological and biomedical fields, but also for disease diagnosis and treatment.1-2 MicroRNA (miRNA) is a small non-coding sequence with 19 to 23 nucleotides that plays important roles in cell proliferation, differentiation 3-4, and tumors 56 . For instance, Lethal-7 (Let-7) is one of the first discovered miRNA.7 Let-7a, a family member of Let-7, can suppress the tumor cell growth and metastasis, which have great potential for cancer therapy.8-9 Thus, developing a simple and convenient method for miRNA detection is essential for understanding the mechanism of gene regulation and disease therapy. In the past decades, different strategies have been proposed for nucleic acid detection, such as fluorescence10, electrochemistry11-12, surfaceenhanced Raman scattering13, and surface plasmon resonance (SPR) 14-15 among others. Despite these advances, efforts must still be deployed for improving nucleic acid sensing, specifically for improving the sensitivity and selectivity. Wang et al. used CdTe/CdS core-shell quantum dots for DNA and miRNA detection. With the addition of target nucleic acid sequence, the fluorescence intensity of quantum dots was quenched by an organic quencher via Förster resonance energy transfer.16 Zou et al. reported a novel two steps method to construct gold-nanorod functionalized polydiacetylene microtube for miRNA detec-

tion. The miRNA can displace the complementary DNA from the surface of Au@PDA microtube, which lead to the fluorescence enhancement.17 Peng et al. proposed a rolling circle amplification (RCA) method for miRNA detection on electrode surface. The DNA tetrahedron decorated gold electrode was employed as the recognition interface. Then, hybridization between DNA tetrahedron, microRNA, and primer probe initiated RCA on the electrode surface. Silver nanoparticles attached to the PCA products provided a significant electrical signal.18 In most sandwich structures, complementary DNA was usually selected as a recognition unit to load on the enhancing object. The complex fabrication process of enhancing object is inconvenient in real time detection, because it needs to change the DNA sequence on enhancing object for complementary pairing with different nucleic acid analytes. Thus, developing a simple and convenient method for highly sensitive and selective nucleic acid detection is still challenging. SPR sensing is attractive for RNA detection. Due to the collective oscillation of electrons at the interface of metal/dielectric, SPR sensing is capable of detecting refractive index changes around sensing surface.19 SPR sensing has the unique ability of being insensitive to electromagnetic interference, while also promoting sample integrity and avoiding contamination of the sample. Most of the commercial SPR instruments are based on Kretsch-

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

mann prism configuration.20-21 The shortcomings of prism-based SPR instruments are complex optics and mechanical structure, making them more difficult to engineer for remote sensing. In contrast, fiber-optic SPR sensors with their compact size and simple structure are very convenient for implanting and indwelling sensing in vivo in clinical test and disease diagnosis.22 In most case, the SPR sensing technique is usually applied to study the interaction of analytes with high molecular weight. The detection of small molecular weight analytes is still challenging, as these analytes causes slight refractive index changes that are more difficult to be detected. In these cases, extrinsic labels should be utilized to enhance the SPR signal via formation a sandwich structure.23 Au nanoparticles (AuNPs) with unique characteristics, such as high density, large dielectric constant and good biocompatibility are ideal materials for signal enhancement.24 However, classical AuNPs need to be modified by unique nucleic acid with complementary sequences for specific nucleic acid detection and thus, are not generally applicable. Each new assay design requires the reoptimization of AuNPs, which is time consuming and costly. In order to develop a universal nanoparticle-based amplification strategy for RNA, one must exploit the ubiquitous ribose backbone of RNA. Boronic acid can specific bind with cis-diol groups and has been widely used in sensor technology 25-26 chromatography 27 and biological research 28-29. While most of boronic acid-based research has focused on the purification and detection of sugar or glycoprotein, 30-31 the application of boronic acid in nucleic acid recognition is attractive despite not being widely reported. RNA can be selectively recognized by boronic acid through binding with the cis-diol group, which is lacking in DNA and thus imparting the selectivity of boronic acids for RNA in presence of DNA. In this paper, the phenylboronic acid modified AuNPs were synthesized and used to selectively amplify miRNA (Let-7a) signal in fiber-optic SPR sensing system. EXPERIMENTAL SECTION Materials. All the DNA and RNA single strand sequence were purchased from Sheng Gong Co. Ltd (Shanghai, China). 6-Mercapto-1-hexanol (MCH) and ethylenediaminetetraacetic acid (EDTA) were purchased from TCI. Diethyl pyrocarbonate (DEPC) was purchased from J&K Chemical. Water was treated with DEPC and autoclaved for 25 min before used. Fiber-optic SPR sensing system. The sensing fiber is multimode with core diameter of 400 μm and numerical aperture of 0.37, as described in previous studies 32. Briefly, the fiber was first cut into 7 cm pieces. The jacket and cladding were removed for 5 mm length in the center of the fiber as the sensing surface. Finally, a 2 nm Cr and 50 nm Au were sputtered on the sensing surface consecutively on the sensing region by ion beam sputtering deposition.

The sensing part of the fiber was connected to the sensing system by two SMA905 connectors. In detection process, a halogen light source (HL-2000, Ocean Optics) was coupled to the fiber optic SPR probe. Through total internal reflection, surface plasmons were excited at the interface of the metal layer. A resonance dip was found in the transmission spectrum of the SPR sensor, which can be measured by a spectrometer (HR4000, Ocean Optics). The signal was analyzed and processed in real time by a custom Labview program. Sensing surface modification. After sputtering the metal layer on the sensing surface, the fiber-optic SPR probe was immediately immersed in 1.0 μM HS-ssDNA and 1.0 μM MCH in 1.0 M KH2PO4 solution for 2 h. The probe was then transferred to 1 mM MCH aqueous solution for 1 h. The high concentration of MCH treatment can remove the physical adsorption of HS-ssDNA and block the unreacted surface, which is necessary to reduce the nonspecific binding.33 The sensing region was rinsed thoroughly with water and dried before hybridization. AuNPs preparation and modification with PBA. The AuNPs were synthesized according the method previously reported with slight modifications 34-35. Before the experiment, all the glassware was thoroughly washed in aqua regia (HCl:HNO3=3:1) for 2 h, then rinsed with deionized water and dried. In 250 mL round bottom flasks, 1 mL of 1% HAuCl4 and 100 mL deionized water were mixed and heated to boiling under vigorous stirring. Then, 4 mL of 1% sodium citrate aqueous solution was rapidly added and boiling was continued for 15 min. During this time, the mixture solution gradually turned red wine. The average diameter of AuNPs was 19 nm (Figure S1). The synthetic methods for m-mercapto alkylphenylboronic acid (referred to PBA) is reported previously. (Figure S2, S3). For PBA-AuNPs fabrication, a total of 10 μL 1 mM PBA in ethanol was added to 5 mL of the AuNPs with stirring for 2 h and kept in room temperature for 4 h before used. HS-ssDNA/MCH monolayer and PBA-AuNPs characterizations. XPS served to verify the HS-ssDNA/ MCH modification on optic-fiber. The elemental composition on the sensing surface was analyzed with an ESCALAB™ 250Xi (ThermoFisher) and Al K Alpha source with an energy step of 0.050 eV. The analysis was performed by scanning the sample 20 times. The XPS spectrum was calibrated by the C1s binding energy. Silicon wafers instead of fiber-optic were used for the HSssDNA/MCH monolayer characterization. Briefly, 2 nm Cr and 50 nm Au were subsequently sputtered on the silicon wafer surface. The sensing surface modification procedure is the same as described above for the fiber-optic sensor. For PBA-AuNPs characterization, nanoparticles were centrifuged, dropped on silicon wafer and dried. The PBA-AuNPs on silicon wafer was characterized by attenuated total reflection (ATR) infrared spectrometer (Nicolet iN10 MX & iS10).

ACS Paragon Plus Environment

Page 2 of 9

Page 3 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

Fig. 1. Schematic representation of miRNA detection by fiber-optic SPR sensing system (Ⅰ) Capture DNA/MCH modification on the sensing surface (Ⅱ) Single strand RNA or DNA hybrid on the sensing surface (Ⅲ) PBA-AuNPs selectively bind with RNA to amplify the signal Nucleic acid hybridization and signal amplification on the sensing surface. As shown in Fig.1, the hybridization process was performed in a hybridization buffer (10 mM phosphate buffer pH 7.0 with 0.3 M NaCl and 1 mM EDTA). The single stranded RNA or DNA in hybridization buffer were incubated on sensing surface for 2 h. After the hybridization, the sensing region was thoroughly rinsed with water. Then, the sensing surface was further incubated with PBA-AuNPs for 30 min. RESULTS AND DISCUSSION Principle of miRNA detection by PBA-AuNPs. We propose a novel approach for detection of miRNA by using PBA-AuNPs as a generally applicable signal amplification technique in RNA sensing, demonstrated here with fiber optic SPR sensing system. The capture single strand DNA (HS-ssDNA) was first immobilized on the sensing surface (Fig. 1). The capture DNA can bind with the target RNA with a specific sequence through complementary paring. Generally, RNA leads to a low signal response in SPR sensing system due to its low molecular weight. By contrast, AuNPs with high mass are able to induce a huge variation in refractive index after attaching on the sensing surface. The electromagnetic field coupling between the plasmonic the AuNPs (localized surface plasmon reso-

nance, LSPR) and propagating plasmons on the gold surface can further inducing signal amplifying in SPR sensing system. 14, 24 As shown in Fig. 2, although DNA and RNA are similar compounds, a major difference in RNA as compared to DNA is the structure of five carbon sugar. The sugar in DNA is deoxyribose that contains only one hydroxyl group. However, the sugar in RNA is ribose, which contains two hydroxyl groups (that is 1,2-cis diol structure). PBA shows strong binding capacity with 1,2-cis diol structure due to the formation of a cyclic boronate ester, but shows low binding capacity for one hydroxyl compounds.36 Accordingly, the PBA-AuNPs can preferentially bind with the captured RNA sequence to amplify the sensing signal. Characterization of the HS-ssDNA/MCH monolayer and PBA-AuNPs. The HS-ssDNA/MCH monolayer was self-assembled on the gold film and was further characterized by XPS. As shown in Fig. S-4, S2p spectrum exhibited two distinct peaks at 161.8 eV and 163.0 eV with 2:1 area ratio and splitting of 1.2 eV, which indicate thiol groups bind on the gold film through forming S-Au bond and there is no unbound thiol on the sensing surface.37 The peaks of N1s and P2p are unique signal for HS-ssDNA sequence, because the N and P elements only contain in

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 9

Fig. 2. The principle of PBA binds with RNA. Boronic acid can selectively recognize RNA through binding with cis-diol group in RNA unit.

phosphate groups and nucleobase respectively. The splitting peaks of O1s suggest that the O element must exist in at least two valence states, which can further validate that the HS-ssDNA exist on sensing surface.

infrared spectrometer. Fig. 3(A) shows the ATR infrared spectrum in the regions from 1000 to 1800 cm-1. It indicate that an obvious the B-O stretching band occur at 1375 cm-1, which is in accordance with previously reported.38 The wide peak from around 1500 cm-1 to 1630 cm-1 can attribute to the C=C stretch in aromatic ring. Fig. 3 (B) exists four peaks in PBA-AuNPs from about 2800 cm-1 to 2950 cm-1 which can attribute to the CH2 antisymmetric and symmetric bands.39 The ATR infrared spectrum can confirm the PBA successfully load on the AuNPs. Let-7a detection. The fiber-optic SPR sensor was used to monitor the sequence of steps leading to miRNA detection. As shown in Fig. 4(A), in processⅠ: hybridization buffer was injected to make a steady baseline to guarantee the fiber-optic sensing system is steady. In process Ⅱ, the hybridization buffer containing target RNA sequence (Let-7a) on the sensing surface for complementary paring for 2h. Then, in process Ⅲ, we injected the pure water into the sensing system to remove all the ingredients. It should be pointed out that the hybrid RNA sequence could not be removed due to its interaction with capture DNA modified on the sensing surface. Finally, the PBA-AuNPs solution was injected in order to amplify the sensing signal though binding with hybrid RNA. Obviously, the interferences in the sample can be removed in process Ⅲ and cannot disturb the signal amplifying by PBA-AuNPs in process Ⅳ.

Fig. 3 ATR infrared spectrum of dried PBA-AuNPs on silicon wafer (A) 1000-1800 cm-1 wavenumber (B) 2740-3040 cm-1 wavenumber Additionally, the PBA monolayer modified AuNPs dropped on the silicon wafer were characterized by ATR

Fig. 4(A) shows that the hybridization signal of Let7a on sensing surface was too weak to be detected directly. This may be attributed to the low concentration and low molecular weight of Let-7a, which cannot produce a large refractive index change in the sensing region. By contrast, the PBA-AuNPs can amplify the signal significantly though binding with hybrid RNA on the sensing surface. The resonance wavelength shifted significantly within 10 min after adding PBA-AuNPs and gradually reached a plateau within 30 min.

ACS Paragon Plus Environment

Page 5 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

Table 1. The single strand DNA and RNA sequences used in the sensing system Sequence (5’—3’) HS-ssDNA

HS-(CH2)6–TTTTTTAACTATACAA C

Capture DNA

Let-7a

UGAGGUAGUAGGUUGUAUAGUU

Complementary paring

DNA-1

ACTCCATCATCGTTGTATAGTT

Complementary paring

RNA-2

UGAGGUAGUAGGUUGUUUAGUU

Single base mismatch

RNA-3

UGAGGUAGUAGGUUGU_UAGUU

Single base deletion

RNA-4

UUGUACUACACAAAAGUACUG

Random sequence

the relative standard deviation (RSD) of the amplification signal by PBA-AuNPs is about 13.1%.

Fig. 5. PBA-AuNPs amplification signal stability (Let-7a, 10-8 M)

Fig. 4. Let-7a hybridization and signal amplification (A) The real time sensorgram of Let-7a (10-8 M) with the fiberoptic SPR sensor. Ⅰ: Hybridization buffer Ⅱ: Let-7a in hybridization buffer Ⅲ: Water Ⅳ: PBA-AuNPs in water (B) The linear relationship between amplified signal and the logarithm of Let-7a concentration. Insert: the wavelength shift in the presence of PBA-AuNPs with different concentrations of Let-7a. (from 0 M to 10-7 M) Fig. 4(B) shows the plot of signal response versus the logarithm value of Let-7a concentration displayed a linear relationship in the range of 10-12 M to 10-7 M. The insert picture is the real-time sensorgram of Let-7a in each concentration at 0 M, 10-12 M, 10-11 M, 10-10 M, 10-9 M, 10-8 M, 107 M. The limit of detection (LOD) was determined by signal-to-noise of 3 plus the background signal and obtained 2.7 ×10-13 M for Let-7a. We also tested signal stability of PBA-AuNPs by probe Let-7a in 10-8 M for 8 times (Fig. 5). It shows that

Selectivity measurement. Complementary DNA sequence and different kinds of single strand RNA including signal base mismatch, single base deletion and random RNA sequence were used to test the selectivity of the sensing system (Table 1). The blank was performed with a PBA-AuNPs solution directly exposed to the sensing system in absence of RNA and DNA. Fig. 6 shows the selectivity of our proposed sensing system for Let-7a (complementary pairing), DNA-1(complementary pairing), RNA-2 (single base mismatch), RNA-3 (single base deletion); RNA-4 (random sequence). All the single strand nucleic acids were tested at 10-8 M. Fig. 6 (A) is the real-time sensorgram amplified by PBA-AuNPs. Both of Let-7a and DNA-1 can be captured by HS-ssDNA on the sensing surface though complementary pairing. The PBA-AuNPs show obviously amplification signal (1.94 nm) to Let-7 through binding with the cis-diol group. Comparatively, the DNA-1 show relatively low amplification signal (0.67 nm). This can attribute to the low binding capacity between PBA and DNA due to the DNA’s deoxy structure. It should be noticed that the blank group, which the PBAAuNPs directly expose to the HS-ssDNA on the sensing surface, shows only 0.07 nm wavelength shift. It suggests that PBA-AuNPs have very low background noise in Let7a sensing. To compare with DNA-1 and blank groups,

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

both of them are PBA-AuNPs interaction with DNA，but show different signal response. That may be attributed to some reasons. The PBA used in the research contain an alky chain with 11 carbons, which need more space to bind with nucleic acid. And the diameter of AuNPs (about 19 nm) is larger than the nucleic acid. If the distance between sensing surface and the PBA-AuNPs is too short, it may hinder the PBA-AuNPs recognition ability. This result may benefit to optimize PBA-AuNPs system to improve the RNA detection in the future.

Fig. 6. Signal selective enhancement by PBA-AuNPs (A) Real-time signal response monitoring (B)The selectivity of miRNA SPR sensors. Let-7a (complementary pairing), DNA-1(complementary pairing), RNA-2 (single base mismatch), RNA-3 (single base deletion); RNA-4 (random sequence), Blank (none RNA or DNA). All the nucleic acids were tested at 10-8 M. The RNA-2 (single based mismatch sequence) and RNA-3 (single base mismatch) shows similarly low resonance (0.59 nm and 0.49 nm) when exposing to PBA-AuNPs (Fig. 6 (B)). The signal of RNA-4 is a little higher than the blank group, which may attribute to some nonspecific adsorption RNA-4 on the sensing surface. Besides, in order to test the generality of our proposed sensor, another two kinds of sequences were test. The nucleic sequence and testing result shows in Table S-1 and Fig. S-5. The complementary RNA and complementary DNA were detected at the concertation of 10-8 M. It shows that the PBA-AuNPs shows same performance to distinguish RNA

Page 6 of 9

and DNA by selectively amplifying the complementary RNA sequence. It should be pointed out that the selectivity and sensitivity of our proposed miRNA sensor is realized according to the following two aspects: 1) The target Let-7a with specific sequence can be recognized and captured on the sensing surface by HS-ssDNA through the complementary paring. 2) The PBA-AuNPs were utilized to further enhance the signal of target RNA selectively. To our knowledge, there are few papers have reported to distinguish DNA and RNA with same sequence by one method. Most of the published research papers focus on detecting DNA or RNA, they do not have ability to differentiate them especially when both of DNA and RNA can complementary pairing on the sensing surface. However, our proposed method can differentiate the RNA and DNA with same sequence due to the unique characteristic of PBA-AuNPs. A comparison between our proposed method and previous works in SPR platforms are shown in Table S-2. It is clear that the LOD of our proposed meth-

od is comparable to other reported method. More importantly, our method can be used to distinguish the RNA and DNA with same sequence, indicating that our proposed method has higher selectivity as compared with other reported method. Besides, in many previous research works, Au nanoparticles modified with complementary DNA are used to enhance the sensing signal. However, different complementary DNA sequences are required for the different target RNA sequences, which results in an optimization process to be repeated for each assay. It should be pointed out that the PBA-AuNPs is a very simple and convenient technique for miRNA signal amplification in fiber-optic SPR sensors. First, the PBAAuNPs could differentiate DNA and RNA analytes by preferentially binding with cis-diol in RNA unit. Second, the PBA-AuNPs will be generally applicable for RNA signal amplification. Third, the fiber-optic SPR sensor offers a small and portable instrument that has more potential application in biological analysis and clinical diagnosis. CONCLUSION In summary, we demonstrated a novel approach for selective detection of Let-7a from the amplification signal in fiber-optic SPR sensing system with PBA-AuNPs to circumvent the issue of the low response from the direct hybridization of RNA in SPR sensing. In this novel sensing scheme, PBA-AuNPs were used to enhance the SPR signal of target RNA by binding the cis-diol groups of RNA. The unique advantages of PBA-AuNPs system is the ability to differentiate RNA and DNA though amplifying RNA signal selectively. This work can be further investigated for developing and applying PBA-AuNPs technique in various sensing platforms.

ACS Paragon Plus Environment

Page 7 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors directly targeting RTKN in human colon cancer. Biochem. Biophys. Res. Commun. 2016, 478 (2), 739-745.

ASSOCIATED CONTENT The supporting information is available free of charge via the Internet at http://pubs.acs.org. TEM images of AuNPs (Fig. S-1); Chemical structure and synthetic method of PBA (Fig. S-2, S-3); XPS spectra of HS-ssDNA/MCH monolayer sensing surface (Fig. S-4); Selective enhancement by PBA-AuNPs; Table S-1 The nucleic acid sequences; Table S-2 Comparison of different amplification strategies for nucleic acid detection by SPR sensors.

AUTHOR INFORMATION

Corresponding author: Wei Peng , Wei Ji E-mail: [email protected]; [email protected]

ACKNOWLEDGMENT This research was financially supported by National Nature Science Foundation of China (61520106013, 61727816, 11474043, 21603021, 61505019). We also acknowledge the support from the Fundamental Research Funds for the Central Universities (DUT15RC(3)115).

REFERENCES (1) Dong, H.; Lei, J.; Ding, L.; Wen, Y.; Ju, H.; Zhang, X., MicroRNA: Function, Detection, and Bioanalysis. Chem. Rev. 2013, 113 (8), 6207-6233. (2) Sidransky, D., Nucleic Acid-Based Methods for the Detection of Cancer. Science 1997, 278 (5340), 10541058. (3) Bartel, D. P., MicroRNAs: Genomics, Biogenesis, Mechanism, and Function. Cell 2004, 116 (2), 281-297. (4) Shenoy, A.; Blelloch, R. H., Regulation of microRNA function in somatic stem cell proliferation and differentiation. Nat. Rev. Mol. Cell Biol. 2014, 15 (9), 565-576. (5) Jin, M.; Zhang, T.; Liu, C.; Badeaux, M. A.; Liu, B.; Liu, R.; Jeter, C.; Chen, X.; Vlassov, A. V.; Tang, D. G., miRNA-128 Suppresses Prostate Cancer by Inhibiting BMI-1 to Inhibit Tumor-Initiating Cells. Cancer Res. 2014, 74 (15), 4183-4195. (6) Calin, G. A.; Croce, C. M., MicroRNA signatures in human cancers. Nat. Rev. Cancer 2006, 6 (11), 857-866. (7) Reinhart, B. J.; Slack, F. J.; Basson, M.; Pasquinelli, A. E.; Bettinger, J. C.; Rougvie, A. E.; Horvitz, H. R.; Ruvkun, G., The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 2000, 403 (6772), 901-906. (8) Li, B.; Chen, P.; Chang, Y.; Qi, J.; Fu, H.; Guo, H., Let-7a inhibits tumor cell growth and metastasis by

(9) Lee, H.; Han, S.; Kwon, C. S.; Lee, D., Biogenesis and regulation of the let-7 miRNAs and their functional implications. Protein & Cell 2016, 7 (2), 100-113. (10) Causa, F.; Aliberti, A.; Cusano, A. M.; Battista, E.; Netti, P. A., Supramolecular Spectrally Encoded Microgels with Double Strand Probes for Absolute and Direct miRNA Fluorescence Detection at High Sensitivity. J. Am. Chem. Soc. 2015, 137 (5), 1758-1761. (11) Torrente-Rodríguez, R. M.; Campuzano, S.; Montiel, V. R.-V.; Montoya, J. J.; Pingarrón, J. M., Sensitive electrochemical determination of miRNAs based on a sandwich assay onto magnetic microcarriers and hybridization chain reaction amplification. Biosens. Bioelectron. 2016, 86, 516-521. (12) Azimzadeh, M.; Rahaie, M.; Nasirizadeh, N.; Ashtari, K.; Naderi-Manesh, H., An electrochemical nanobiosensor for plasma miRNA-155, based on graphene oxide and gold nanorod, for early detection of breast cancer. Biosens. Bioelectron. 2016, 77, 99-106. (13) Ye, L.-P.; Hu, J.; Liang, L.; Zhang, C.-y., Surfaceenhanced Raman spectroscopy for simultaneous sensitive detection of multiple microRNAs in lung cancer cells. Chem. Commun. 2014, 50 (80), 11883-11886. (14) He, L.; Musick, M. D.; Nicewarner, S. R.; Salinas, F. G.; Benkovic, S. J.; Natan, M. J.; Keating, C. D., Colloidal Au-Enhanced Surface Plasmon Resonance for Ultrasensitive Detection of DNA Hybridization. J. Am. Chem. Soc. 2000, 122 (38), 9071-9077. (15) Goodrich, T. T.; And, H. J. L.; Corn, R. M., Direct Detection of Genomic DNA by Enzymatically Amplified SPR Imaging Measurements of RNA Microarrays. J. Am. Chem. Soc. 2004, 126 (13), 4086-7. (16) Su, S.; Fan, J.; Xue, B.; Yuwen, L.; Liu, X.; Pan, D.; Fan, C.; Wang, L., DNA-Conjugated Quantum Dot Nanoprobe for High-Sensitivity Fluorescent Detection of DNA and micro-RNA. ACS Appl. Mater. Interfaces 2014, 6 (2), 1152-1157. (17) Zhu, Y.; Qiu, D.; Yang, G.; Wang, M.; Zhang, Q.; Wang, P.; Ming, H.; Zhang, D.; Yu, Y.; Zou, G.; Badugu, R.; Lakowicz, J. R., Selective and sensitive detection of MiRNA-21 based on gold-nanorod functionalized polydiacetylene microtube waveguide. Biosens. Bioelectron. 2016, 85, 198-204. (18) Miao, P.; Wang, B.; Meng, F.; Yin, J.; Tang, Y., Ultrasensitive Detection of MicroRNA through Rolling Circle Amplification on a DNA Tetrahedron Decorated Electrode. Bioconjug. Chem. 2015, 26 (3), 602-607. (19) Homola, J., Surface Plasmon Resonance Sensors for Detection of Chemical and Biological Species. Chem. Rev. 2008, 108 (2), 462-493. (20) Kretschm.E; Raether, H., RADIATIVE DECAY OF NON RADIATIVE SURFACE PLASMONS EXCITED BY

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

LIGHT. Zeitschrift Fur Naturforschung Part aAstrophysik Physik Und Physikalische Chemie 1968, A 23 (12), 2135-2136.

ical cytosensor based on boronic acid functional polythiophene. Biosens. Bioelectron. 2017, 90, 6-12.

(21) Zhao, S. S.; Bukar, N.; Toulouse, J. L.; Pelechacz, D.; Robitaille, R.; Pelletier, J. N.; Masson, J.-F., Miniature multi-channel SPR instrument for methotrexate monitoring in clinical samples. Biosens. Bioelectron. 2015, 64 (Supplement C), 664-670.

(30) Zhang, X.; Wang, J.; He, X.; Chen, L.; Zhang, Y., Tailor-Made Boronic Acid Functionalized Magnetic Nanoparticles with a Tunable Polymer Shell-Assisted for the Selective Enrichment of Glycoproteins/Glycopeptides. ACS Appl. Mater. Interfaces 2015, 7 (44), 24576-24584.

(22) Caucheteur, C.; Guo, T.; Albert, J., Review of plasmonic fiber optic biochemical sensors: improving the limit of detection. Anal. Bioanal. Chem. 2015, 407 (14), 3883-3897.

(31) Wu, X.; Li, Z.; Chen, X.-X.; Fossey, J. S.; James, T. D.; Jiang, Y.-B., Selective sensing of saccharides using simple boronic acids and their aggregates. Chem. Soc. Rev. 2013, 42 (20), 8032-8048.

(23) Bai, Y.; Feng, F.; Zhao, L.; Wang, C.; Wang, H.; Tian, M.; Qin, J.; Duan, Y.; He, X., Aptamer/thrombin/aptamer-AuNPs sandwich enhanced surface plasmon resonance sensor for the detection of subnanomolar thrombin. Biosens. Bioelectron. 2013, 47, 265-270.

(32) Masson, J. F.; Obando, L.; Beaudoin, S.; Booksh, K., Sensitive and real-time fiber-optic-based surface plasmon resonance sensors for myoglobin and cardiac troponin I. Talanta 2004, 62 (5), 865-870.

(24) Szunerits, S.; Spadavecchia, J.; Boukherroub, R., Surface plasmon resonance: signal amplification using colloidal gold nanoparticles for enhanced sensitivity. In Rev. Anal. Chem, 2014; Vol. 33, p 153. (25) Nishiyabu, R.; Iizuka, S.; Minegishi, S.; Kitagishi, H.; Kubo, Y., Surface modification of a polyvinyl alcohol sponge with functionalized boronic acids to develop porous materials for multicolor emission, chemical sensing and 3D cell culture. Chem. Commun. 2017, 53 (25), 3563-3566. (26) Qian, S.; Liang, Y.; Ma, J.; Zhang, Y.; Zhao, J.; Peng, W., Boronic acid modified fiber optic SPR sensor and its application in saccharide detection. Sens. Actuators, B 2015, 220, 1217-1223. (27) Lin, Z.; Sun, L.; Liu, W.; Xia, Z.; Yang, H.; Chen, G., Synthesis of boronic acid-functionalized molecularly imprinted silica nanoparticles for glycoprotein recognition and enrichment. J. Mater. Chem. B 2014, 2 (6), 637-643. (28) Zhao, D.; Xu, J.-Q.; Yi, X.-Q.; Zhang, Q.; Cheng, S.-X.; Zhuo, R.-X.; Li, F., pH-Activated Targeting Drug Delivery System Based on the Selective Binding of Phenylboronic Acid. ACS Appl. Mater. Interfaces 2016, 8 (23), 14845-14854. (29) Dervisevic, M.; Senel, M.; Sagir, T.; Isik, S., Highly sensitive detection of cancer cells with an electrochem-

(33) Herne, T. M.; Tarlov, M. J., Characterization of DNA Probes Immobilized on Gold Surfaces. J. Am. Chem. Soc. 1997, 119 (38), 8916-8920. (34) 34. Grabar, K. C.; Freeman, R. G.; Hommer, M. B.; Natan, M. J., Preparation and Characterization of Au Colloid Monolayers. Anal. Chem. 1995, 67 (4), 735-743. (35) Bi, X.; Du, X.; Jiang, J.; Huang, X., Facile and Sensitive Glucose Sandwich Assay Using In Situ-Generated Raman Reporters. Anal. Chem. 2015, 87 (3), 2016-2021. (36) Li, D. J.; Chen, Y.; Liu, Z., Boronate affinity materials for separation and molecular recognition: structure, properties and applications. Chem. Soc. Rev. 2015, 44 (22), 8097-8123. (37) Castner, D. G.; Hinds, K.; Grainger, D. W., X-ray Photoelectron Spectroscopy Sulfur 2p Study of Organic Thiol and Disulfide Binding Interactions with Gold Surfaces. Langmuir 1996, 12 (21), 5083-5086. (38) Barriet, D.; Yam, C. M.; Shmakova, O. E.; Jamison, A. C.; Lee, T. R., 4-Mercaptophenylboronic Acid SAMs on Gold:  Comparison with SAMs Derived from Thiophenol, 4-Mercaptophenol, and 4-Mercaptobenzoic Acid. Langmuir 2007, 23 (17), 8866-8875. (39) Park, J.-S.; Vo, A. N.; Barriet, D.; Shon, Y.-S.; Lee, T. R., Systematic Control of the Packing Density of Self-Assembled Monolayers Using Bidentate and Tridentate Chelating Alkanethiols. Langmuir 2005, 21 (7), 2902-2911.

ACS Paragon Plus Environment

Page 8 of 9

Page 9 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

TOC only

ACS Paragon Plus Environment

9