'Candidatus Liberibacter asiaticus' minimally alters expression of

Subscriber access provided by Kaohsiung Medical University

Article

‘Candidatus Liberibacter asiaticus’ minimally alters expression of immunity and metabolism proteins in the hemolymph of Diaphorina citri, the insect vector of Huanglongbing. Angela Kruse, John S. Ramsey, Richard Johnson, David G. Hall, Michael J. MacCoss, and Michelle Heck J. Proteome Res., Just Accepted Manuscript • DOI: 10.1021/acs.jproteome.8b00183 • Publication Date (Web): 14 Aug 2018 Downloaded from http://pubs.acs.org on August 14, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 56 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Proteome Research

‘Candidatus Liberibacter asiaticus’ minimally alters expression of immunity and metabolism proteins in the hemolymph of Diaphorina citri, the insect vector of Huanglongbing. Angela Kruse1, 2**, John S. Ramsey2, 3**, Richard Johnson4 David G. Hall5, Michael J. MacCoss4, Michelle Heck1,2,3,* 1

Section of Plant Pathology and Plant-Microbe Biology, School of Integrated Plant Sciences,

Cornell University, Ithaca, New York 14853, United States 2

Boyce Thompson Institute, Ithaca, New York 14853, United States

3

Emerging Pests and Pathogens Research Unit, Robert W. Holley Center, USDA ARS, Ithaca,

New York 14853, United States 4

Department of Genome Sciences, University of Washington, Seattle, Washington 98195, United

States 5

U.S. Horticultural Research Laboratory, Subtropical Insects and Horticulture Research Unit,

USDA Agricultural Research Service, Ft. Pierce, Florida 34945, United States of America * To whom correspondence should be addressed: Michelle Heck, [email protected], 607-2545453 **Authors contributed equally

Abstract Huanglongbing (HLB), also known as citrus greening disease, is the most serious disease of citrus plants. It is associated with the Gram-negative bacterium ‘Candidatus Liberibacter asiaticus’

1 ACS Paragon Plus Environment

Journal of Proteome Research 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(CLas), which is transmitted between host plants by the hemipteran insect vector Diaphorina citri in a circulative, propagative manner involving specific interactions with various insect tissues, including the hemolymph, fluid that occupies the body cavity akin to insect blood. High resolution quantitative mass spectrometry was performed to investigate the effect of CLas exposure on D. citri hemolymph at the proteome level. In contrast to the broad proteome effects on hundreds of proteins and a diverse array of metabolic pathways previously reported in gut and whole insect proteome analyses, the effect of CLas on the hemolymph was observed to be highly specific, restricted to key immunity and metabolism pathways, and lower in magnitude than that previously observed in the whole insect body and gut. Vitellogenins were abundantly expressed and CLasresponsive. Gene-specific RNA expression analysis suggests that these proteins are expressed in both male and female insects, and may have roles outside of reproductive vitellogenesis. Proteins for fatty acid synthesis were found to be up-regulated, along with metabolic proteins associated with energy production, supported at the organismal level by the previously published observation that D. citri individuals experience a higher level of hunger when reared on CLas-infected plants. Prediction of post-translational modifications identified hemolymph proteins with phosphorylation and acetylation upon CLas exposure. Proteins derived from the three most prominent bacterial endosymbionts of the psyllid were also detected in the hemolymph, and several of these have predicted secretion signals. A DNAK protein, the bacterial HSP70, detected in the hemolymph expressed from Wolbachia pipientis was predicted to encode a eukaryotic nuclear localization signal. Taken together, these data show specific changes to immunity and metabolism in D. citri hemolymph involving host and endosymbiont proteins. These data provide a novel context for proteomic changes seen in other D. citri tissues in response to CLas and align with organismal data on the effects of CLas on D. citri metabolism and reproduction.


Page 2 of 56

Page 3 of 56 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Keywords: Asian citrus psyllid, hemolymph, Candidatus Liberibacter asiaticus, Huanglongbing, proteomics, metabolism, immunity Introduction Citrus production worldwide is currently threatened by the spread of Huanglongbing (HLB, also known as citrus greening disease), which affects all commercial citrus varieties, reducing fruit yield and quality and leading to tree death.1-3 The bacteria associated with HLB, ‘Candidatus Liberibacter asiaticus’ (CLas), ‘Candidatus Liberibacter americanus’ (CLam) and ‘Candidatus Liberibacter africanus’ (CLaf) are transmitted by at least two different species psyllids, plant-infesting insect pests in the order Hemiptera, in a circulative, propagative manner.4 Diaphorina citri, the Asian citrus psyllid, is the major vector responsible for the spread of CLas, the bacterium associated with HLB in North America. D. citri ingests the bacterium from the phloem sap of infected trees during feeding. CLas is acquired through the gut, where it can be found in endoplasmic reticulum-derived vacuoles.5 The bacterium travels through the circulating fluid in the body cavity of D. citri, known as hemolymph, to access the salivary glands. CLas passes through the salivary tissues by unknown mechanisms and is incorporated into the saliva of D. citri. D. citri delivers the bacterium to new uninfected host trees during feeding. Although the bacterium colonizes and replicates in its insect vector host,4, 6 the insect derives some positive effects from association with CLas, including increased fecundity, and increased expression of genes and proteins associated with insecticide resistance

7-8

. D. citri

nymphs exposed to CLas develop more rapidly, and fly farther and faster as adults.9-10 On the other hand, there is a negative impact on insect lifespan upon exposure to CLas, and the insects feed more, indicating a higher hunger level.11 Confocal microscopy reveals extensive nuclear morphological changes in the guts of adult insects which have acquired the pathogen,12-13 although 3 ACS Paragon Plus Environment


D. citri nymphs are resistant to these effects.13 D. citri transcriptome and proteome analyses show an upregulation of transcripts and proteins involved in defense and immunity (including phenoloxidase, vitellogenin, esterase, transferrin, and hemocyanin) in response to pathogen exposure.8, 14 D. citri exposed to CLas are also more susceptible to an entomopathanogenic fungus as well as certain insecticides.7,

15

These findings demonstrate that CLas elicits an immune

response from D. citri and underscores the importance of understanding the insect immune system’s role in vector-Liberibacter interactions. The D. citri genome is a dynamic scaffold that supports our understanding of immunity and other molecular pathways present in the insect. Improved annotation of the D. citri genome has provided comprehensive and accurate models for genes involved in immunity, including RNAi directing machinery, pathogen recognition molecules, genes from the JAK/STAT pathway, and stress and pathogen response.16 This effort also produced a database of manually curated D. citri gene models called the MCOT transcriptome v1.0, which improves the quality of OMICs data analyses.16 Analysis of the D. citri genome reveals that this insect, like other hemipterans including the pea aphid (Acyrthosiphon pisum) 17 the potato psyllid (Bactericera cockerelli) 18, the whitefly (Bemesia tabaci) 19, the kissing bug (Rhodnius prolixus) 20, the brown planthopper (Nilaparvata lugens) 21 and the white-backed plant hopper (Sogatella furcifera) 22, possesses a highly reduced immune system, lacking a complete immune deficiency (IMD) pathway which targets Gramnegative bacteria

23

. The incompleteness or absence of this pathway in D. citri and other

hemipteran insects has been hypothesized to facilitate the establishment of symbiotic bacterial partners within the insect. For D. citri, these include Wolbachia pipientis (Wolbachia), ‘Candidatus Carsonella ruddii’ (Carsonella), and ‘Candidatus Profftella armatura’ (Profftella).2425


Page 4 of 56

Page 5 of 56 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Hemolymph is a critical component of the D. citri immune system, where it coordinates the insect’s immune system activity. Cellular immunity is mediated by hemocytes, invertebrate blood cells which are capable of direct phagocytosis of microbial cells. Humoral immunity in insects is mediated by the phenoloxidase pathway and secreted antimicrobial peptides.26 The composition of insect hemolymph changes during development,27 in response to changes in nutritional state 28 and pathogen challenge 29. The site of synthesis for most hemolymph proteins is the insect fat body.30 This organ wraps around the insect gut, thus directly contacting the hemolymph, and is a major site of protein synthesis, energy storage, and metabolism.30 Several well-conserved proteins involved in cellular immunity, including vitellogenin, apolipophorin and phenoloxidase proteins, are abundant in arthropod hemolymph

31

and are

conserved in the genomes of D. citri, other psyllids and other hemipteran insects 18, 32. Vitellogenin is a lipoprotein with functions in vertebrate and invertebrate reproduction and immunity, which is synthesized in the insect fat body in response to juvenile hormone signaling and secreted into the hemolymph.30 As a major yolk protein precursor protein in eggs, vitellogenin plays a nutritional role during vitellogenesis, and has been shown to function in insect immunity by binding to pathogen lipopolysaccharides and peptidoglycans.33-34 Vertical transmission of vitellogenin from mother to offspring has been reported to enable the intergenerational transfer of immune elicitors in honeybees.35 We identified ten vitellogenin proteins in D. citri hemolymph, and established a naming convention to more simply and clearly discuss them (Table S3). Apolipophorin is another lipoprotein with roles in development and immunity.36 It carries out the transport of lipids through the hemolymph for delivery to target tissues to meet metabolic demands. Immune functions attributed to apolipophorin include binding to microbial cell wall components as a pattern recognition receptor, influencing hemocyte adhesion and phagocytosis of invading microbes, and



Page 6 of 56

promoting clot formation.37 In contrast, melanization provides an alternate mechanism for microbial encapsulation that is executed by the humoral immune system.

Melanization of

hemolymph after wounding is a conserved arthropod immune response driven by the activity of phenoloxidase proteins.38 Melanin deposited on the surface of pathogens in the hemolymph leads to their encapsulation and the resulting structures appear as darkened spots.39 The hemolymph metabolome

40

and proteome

41

of D. citri have recently been characterized and revealed the

presence of these proteins and associated metabolites in the insect’s blood. The metabolome analysis was performed on hemolymph collected from healthy insects (not infected with CLas), while the proteome analysis was performed using only one biological replicate collected from healthy and CLas-exposed D. citri. In the latter study, the lack of biological replication precluded a quantitative analysis for differentially expressed proteins in response to CLas infection.41 Thus, the roles of these hemolymph proteins and immune system pathways in interactions with CLas remain unknown from these previous studies. We adapted the quantitative mass spectrometry workflow that we have used to perform quantitative proteomics on both whole insect protein extracts and dissected gut protein extracts from healthy and CLas-exposed D. citri 8, 14, 42 to test the hypothesis that CLas infection induces changes in the expression of hemolymph proteins in D. citri. Experimental Section Insect Colonies Adult D. citri were obtained from lab colonies raised on healthy and CLas-infected citron plants (Citrus medica) at the US Horticultural Research Laboratory (USDA ARS, Fort Pierce, FL). Age-synchronized, adult insects (males and females) were collected for hemolymph extraction by


Page 7 of 56 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


vacuum aspiration from healthy plants [CLas(-) samples] and from infected plants [CLas(+) samples]. Quantitative PCR to Determine CLas Titer DNA was extracted from individual adult psyllids and used for quantitative PCR using HLBaspr primers, as described in 43. Psyllids were considered to be CLas positive using a cycle threshold (Ct) value cutoff of 36, as in 43. Hemolymph Extraction Live insects were placed in a droplet of sterile PBS, pH 7.4 under a dissecting microscope. A small incision in the cuticle was made with a scalpel immediately above the first leg at the base of the first coxa, near the junction of the head and thorax (Figure 1). A hand-pulled glass capillary was inserted into the incision and hemolymph was allowed to diffuse into the capillary. Several microliters were collected from each insect. A bulb was used to eject the sample into a tube placed in dry ice. Hemolymph samples from 50 insects were pooled to generate a biological replicate. Three biological replicates each were collected for D. citri raised on CLas+ and CLas- citron plants.



Figure 1. Hemolymph extraction method showing site of hemolymph collection. Hemolymph was extracted by making an incision in the insect exoskeleton and inserting a glass capillary into the incision site. The site of capillary insertion is indicated by the white arrow. The first leg was removed to improve visualization of the site, and the capillary was inserted posterior to the first leg.

Protein Sample Preparation A total of 80 µL of 0.2% RapiGest surfactant (Waters Corporation, Milford MA) in 50mM ammonium bicarbonate was added to each biological replicate (3 each for CLas+ and CLas8 ACS Paragon Plus Environment

Page 8 of 56

Page 9 of 56 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


hemolymph). Cell membranes were disrupted using a probe sonicator on ice for two cycles of 15 seconds each at 15% amplitude. Protein concentration was quantified using a bicinchoninic acid (BCA) assay (Thermofisher Scientific, Waltham MA). For each sample, 30 µg of protein was diluted in 50 mM ammonium bicarbonate to a final volume of 117 μL. Proteins were reduced by adding 100mM ditihiotreitol (DTT, Sigma-Aldrich, St. Louis, MO) to a final concentration of 10mM and incubating at 56°C for 1 hour. Cysteines were alkylated with methyl methanethiosulfonate (ThermoFisher Scientific, Waltham MA) at a final concentration of 30 mM with incubation at 25°C for one hour. Proteins were digested using 1 µg of sequencing grade modified trypsin (Promega, Madison, WI) per sample and incubated at 37°C overnight. Oasis mixed-mode cation exchange (MCX) solid phase extraction cartridges (Waters Corporation, Milford, MA) was used to remove lipids and other contaminants from the digested peptides. Peptide samples were dried using a centrifugal evaporator. Mass Spectrometry Analysis The dried tryptic digests were solubilized in 90 µl of 0.1% trifluoracetic acid and 2% acetonitrile by vortexing for 10 minutes at 37 °C and bath sonication for 5 minutes to give a final concentration of 0.333 µg/µl, based on prior BCA protein assays. The solubilized digests were centrifuged at 14,000 g for 5 minutes to pellet any particulates that might cause HPLC clogging, and a portion of each supernatant was carefully removed and placed into autosampler vials. All mass spectrometry was performed on an LTQ-Orbitrap-Lumos (ThermoFisher Scientific, Waltham, MA). Three microliters (~1 µg) was loaded from the autosampler onto a 150 µm Kasil fritted trap packed with Reprosil-Pur C18-AQ (3 µm bead diameter, Dr. Maisch GmbH, Ammerbuch-Entringen, Germany) to a bed length of 2 cm at a flow rate of 2 µl/min for five minutes. After loading and desalting, the trap was brought in-line with a pulled fused-silica 9 ACS Paragon Plus Environment


capillary tip (75 µm i.d.) packed with 30 cm of the same material as the trap, which was mounted in an in-house constructed nanospray source. Peptides were eluted off the trap and column using a Waters Nanoacquity binary UPLC pump using a gradient of 2–25% acetonitrile in 0.1% formic acid over 100 minutes, followed by an additional 25–60% gradient over 40 minutes. The trap and column were subsequently washed for five minutes each with 60% and 95% acetonitrile in 0.1% formic acid, all at a flow rate of 250 nL/min. One injection was performed for each biological replicate sample. Data acquisition employed the orbitrap for MS1 scans at a resolution of 120,000 at m/z 200, an AGC setting of 4 e5 with a maximum fill time of 50 msec. For MS2, the linear ion trap was used with an AGC of 1 e4 and a 35 msec maximum fill time. The number of MS2 scans between each MS1 scan was such that the time between MS1 scans was less than three seconds. A quadrupole isolation width of m/z 1.2 was used for precursor selection, and fragments were generated using a HCD collision energy of 32%. Monoisotopic precursor selection was on, with a preference for peptide-like isotope clusters, precursor charge states of 2 to 7 were targeted for MS2 if they had a minimum intensity of 5 e3, and dynamic exclusion excluded the same precursor for 10 seconds. Mass Spectrometry Data Analysis Spectral data were converted from Thermo Raw files to Mascot Generic Format (MGF) using ProteoWizard MSConvertGUI.44 These files were searched against a combined database containing predicted proteins from D. citri, its endosymbionts ‘Ca. Carsonella ruddii’, ‘Ca. Profftella armatura, Wolbachia pipientis as well as CLas using Mascot Daemon 2.3.2 (Matrix Science, Boston, MA). The database had a total of 47,160 combined insect and microbial sequences as well as 112 common contaminant sequences (trypsin, keratin, etc.). The database is available to download at (ftp://ftp.citrusgreening.org/annotation/MCOT/). The search parameters 10 ACS Paragon Plus Environment

Page 10 of 56

Page 11 of 56 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


allowed for fixed methylthio modification and variable modifications (methionine oxidation; asparagine, glutamine deamidation) with a peptide mass tolerance of ±20ppm and fragment mass tolerance of ±0.6Da. A maximum of one missed cleavage was allowed. Scaffold (Proteome Software, Portland, OR) was used for spectral counting and statistical analysis. Peptides were identified at a 90% threshold with a 0.04% decoy false discovery rate (FDR). Proteins were identified with a 95% threshold and 0.4% decoy FDR with a minimum of 2 matching peptides. Statistical analysis of peptide spectral counts between CLas(-) and CLas(+) hemolymph protein samples was performed using the Fisher’s Exact Test (N=3, Benjamini-Hochberg corrected pvalue < 0.05). The total weighted spectral counts for each protein are reported in this study. No spectral count normalization was used. Cluster analysis was used to group proteins with shared peptides. All mass spectrometry proteome data were submitted to ProteomeXchange via the PRIDE database with the dataset identifiers PXD009257 and 10.6019/PXD009257. Username: [email protected]; Password: xbRbEcDT. Posttranslational modification (PTM) site localization Mass spectrometry data were analyzed to identify acetylated and phosphorylated proteins. Mascot searches were performed according to the parameters specified above, with the addition of the following variable modifications: lysine acetylation, and serine, threonine, and tyrosine phosphorylation. Scaffold PTM (Proteome Software, Portland, OR) was used to annotate PTM sites derived from mass spectrometry sequencing results. Scaffold PTM analyzes MS/MS spectra identified as modified peptides and calculates Ascore values and site localization probabilities for each modification, where an Ascore > 20 indicates that the probability of the given PTM is >99%.45 Signal peptide and nuclear localization signal prediction



Page 12 of 56

The SignalP 4.1 server (http://www.cbs.dtu.dk/services/SignalP/) was used to identify classical

Sec

signal

sequences,

and

the

SecretomeP

2.0

server

(http://www.cbs.dtu.dk/services/SecretomeP/) was used to identify classical Sec signal sequences and non-classical secretion signals, in the bacterial proteins identified in the D. citri hemolymph samples.46-47

The seqNLS platform (http://mleg.cse.sc.edu/seqNLS/) was used to identify

predicted nuclear localization signals in the hemolymph bacterial proteins predicted to contain secretion signals.48 Protein Gel Electrophoresis A 5 µg aliquot of hemolymph protein extract from each biological replicate was used in denaturing gel electrophoresis for protein visualization and size estimation. The protein samples were boiled with 2X Laemlli buffer (Bio-Rad, Hercules, CA) at 80°C for five minutes, centrifuged at maximum speed for two minutes, and run on a precast 10% acrylamide mini-protean gel (Biorad, Hercules, CA). Sypro ruby protein gel stain (Thermo Fisher Scientific, Waltham, MA) was used for protein visualization. Phylogenetic Analysis of Vitellogenins Sequences of 20 vitellogenin and lipid-binding proteins from 18 insect species were obtained from NCBI, along with seven vitellogenin and lipid-binding protein sequences detected in D. citri egg and hemolymph. The accession numbers of these sequences are as follows: Apis mellifera (NP_001011578.1), Laodelphax striatella (AGJ26478.1), Bombyx mandarina (BAB32642.2), Cimex lectularius (BAU36889.1), Bemisia tabaci (ADU04392.1), Aedes aegypti (AAA18221.1), Bombyx mori (BAA06397.1), Spodoptera exigua (ALR35190.1), Anopheles minimus (AHN13887.1), Drosophila melanogaster (NP_511103.1, NP_524634.2), Blattella


Page 13 of 56 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


germanica

(CAA06379.2),

(EFN86099.1),

Tribolium

Vespula castaneum

vulgaris

(AER70365.1),

(XP_970210.1),

Harpegnathos

Danaus

plexippus

saltator plexippus

(OWR44310.1), Spodoptera litura (ABU68426.1), Nilaparvata lugens (BAF75351.1), Bactericera cockerelli (KX752432.1, ATY35166.1) Diaphorina citri (MCOT05282.3.CO, MCOT03523.1.CT,

MCOT16505.2.CT,

MCOT18962.0.CT,

XP_008476565.1,

XP_008487105.1, MCOT06562.2.CT). Multisequence alignment was carried out for these sequences using Clustal.49 Mega7 was used to generate a phylogenetic tree using maximum likelihood prediction.49 Molecular analysis of vitellogenin transcripts in Diaphorina citri RNA was extracted from pools of sexed insects using an RNeasy kit (Qiagen, Hilden, Germany). A DNase digestion was performed using a TURBO DNA-free kit (Invitrogen, Carlsbad, CA). RNA was converted to cDNA using iScript cDNA synthesis kit (Bio-Rad, Hercules, CA). RedTaq polymerase (Sigma-Aldrich, St. Louis, MO) was used to perform PCR using the following primer sequences: Egg Vg-1: MCOT03523.1.CT /XM_017449335.1 (5’ CTTCGCTTTTGACAACCACA 3’, 5’ CATTTCTCCTCCAACGGAAA 3’), Hemolymph Vg1: MCOT18962.0.CT/XM_008488263.2 (5’ GTGGTCTCCAGTGGTACTCG 3’, 5’ TTCCCAGGTTGGCAGGTTTT 3’), Hemolymph Vg-2: XP_008487105.1/XM_008488883.2 (5’ AACCACCCACAAGCTGAACA 3’, 5’ ACTTGGATTTTGGCGTTGGC 3’), Hemolymph Vg-5: MCOT05282.3.CO/XM_008486930 (5’ TCAGTCGGCCATTCAGCTTT 3’, 5’ GTTGCAGGATGGAGACAAGGA 3’), A Cathepsin L gene (MCOT02772.0.CT) was amplified as a control for cDNA quality in Figure 6 using the (5’ GTAGATATTCCAGAGGGTGATG 3’, 5’ TCCGTACCATAGCCTACCACTAG 3’) primer set. Primer design was facilitated by the use of Primer3 software. Conventional PCR was 13 ACS Paragon Plus Environment


performed using each primer set and allowed to proceed for 30 cycles. Gel electrophoresis was used to visualize PCR products, along with the Generuler 1kb plus ladder (Thermo Fisher Scientific, Waltham, MA). Results and Discussion CLas infection status of the insects used in this study Infection rates of D. citri by CLas is variable and depends on a variety of factors, including differences in methodology, source plant genotypes, infection level, CLas strains, D. citri populations and/or environmental conditions.13 qPCR is a widely used technology for CLas detection and estimation of CLas titer in D. citri because there is a linear relationship between the log of the CLas copy number and Ct value between 10 and 107 copies per assay.3 Agesynchronized, adult D. citri were collected from healthy and CLas-infected citron (Citrus medica) trees for proteomic analysis of the hemolymph. CLas qPCR43 was performed on a subset of the insects used in this study and used to determine that 73% (22/30) of insects collected from infected trees harbored CLas in their bodies, using a Ct value cutoff of 36. The average Ct value of these insects which tested positive for CLas was 31.20, and the range of Ct values was between 23.26 and 35.93. The qPCR results for each insect can be found in Table S6.

Hemolymph protein quantification To assess the integrity of the extracted hemolymph proteins, we used SDS-PAGE. Five µg of protein from each sample were analyzed, and the largest bands were observed at 75 kDa and >100 kDa (Figure 2), showing that the protein extraction method was robust and the extracted proteins remained intact prior to tryptic digestion. Peptides identified using high-resolution mass spectrometry were assigned to a total of 2845 psyllid and microbial proteins, and spectral counting


Page 14 of 56

Page 15 of 56 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


was used to estimate protein abundance (Table S1). While a high number of spectral counts generally indicates that a protein is present at higher abundance that a protein to which a low number of mass spectra are mapped, other factors (such as the protein size and number of tryptic peptides) affect the relationship between spectral counts and protein abundance. In many animals, a small number of proteins are present at extremely high levels in blood samples, making identification of low-abundance proteins a challenge and leading to the development of strategies to deplete high-abundance proteins prior to mass spectrometry analysis.51 We organized the hemolymph proteome into four classes based on spectral count distribution to evaluate whether the data were characterized by a small number of proteins was being identified by a large percentage of the mass spectra. The Class 1 proteins, with spectral counts between 100-1000, are considered to be the most abundant hemolymph proteins identified; this class consists of 29 proteins to which 19% of the total spectra mapped (Table 1, Figure 3). A total of 64 proteins were defined as Class 2 proteins with 50-100 spectral counts. Proteins with 1050 and under 10 spectral counts were defined as Class 3 and 4, respectively. Over 80% of the spectra were mapped to proteins other than the most abundant Class 1 proteins, indicating that our data represent a broad distribution of proteins expressed at high, moderate, and low levels (Figure 3).



Figure 2. Analysis of the Diaphorina citri hemolymph proteome using 1-D SDS PAGE. Hemolymph protein samples containing 5µg of protein each were run on a 10% tris glycine gel using SDS-PAGE. The first lane contains a protein ladder with markers at 75 kDa and 25 kDa. The next three lanes contain protein from psyllids unexposed to CLas (CLas -) and the following three lanes contain protein from psyllids exposed to CLas (CLas +).

Table 1. List of D. citri hemoymph proteins classified as highly abundant based on spectral counting (Class 1 proteins, 100-1000 spectral counts). 16 ACS Paragon Plus Environment

Page 16 of 56

Page 17 of 56 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Average Spectral Counts Protein Descriptiona

Protein IDb

CLas(+)c

CLas(-)d

Apolipophorins-like

XP_008467797.1

810

753

Apolipophorin

MCOT16505.2.CT

525

475

Hemolymph Vg-1*

MCOT18962.0.CT

322

249

Fatty acid synthase*

MCOT04192.0.CO

315

248

Hemolymph Vg-2*

XP_008487105.1

205

149

Acetyl-CoA carboxylase

MCOT04321.0.CO

191

155

ATP-citrate lyase

MCOT19010.0.CT

192

150

Transferrin-like

XP_008470513.1

154

171

ATP synthase subunit beta

MCOT02123.0.CT

160

163

Apolipophorin-III

MCOT16586.0.CT

169

154

Uncharacterized protein

XP_008484178.1

138

164

Uncharacterized protein

XP_008481036.1

142

153

Pyruvate kinase

MCOT20611.0.CT

146

149

Fructose-bisphosphate aldolase MCOT17575.0.CT

147

142

Enolase

XP_008481466.1

135

137

MCOT04270.0.CT

131

130

Gamma-glutamyl phosphate reductase, glutamate-5semialdehyde dehydrogenase



Page 18 of 56

Glyceraldehyde-3-phosphate dehydrogenase

MCOT21774.0.CT

132

121

Phenoloxidase subunit A3

MCOT04554.0.CT

121

122

2-oxoglutarate dehydrogenase

MCOT14151.0.CT

112

130

Fatty acid synthase

MCOT09479.0.MT

134

107

Hemolymph Vg-3

XP_008486488.1

132

102

Translation elongation factor 2

XP_008481482.1

115

109

Phosphoglycerate kinase

MCOT21282.1.CT

108

115

Phosphorylase

MCOT15534.0.CO

109

113

Malate dehydrogenase

MCOT10574.0.MT

107

108

putative

MCOT03659.1.CT

97

117

ATP synthase subunit alpha

MCOT01082.0.CT

100

108

Aconitate hydratase

MCOT06112.2.CC

98.6

104

Pyruvate carboxylase

MCOT04325.0.CT

99.5

100

Glucose dehydrogenase,

a

Annotated description of protein identified. bAccession number (Protein ID) for given protein as

defined by NCBI or by the MCOT transcriptome database containing D. citri and D. citri endosymbiont proteins established in.16 cThe average number of spectral counts in each CLas(+) sample analyzed. dThe average number of spectral counts in each CLas(-) sample analyzed. *Protein is differentially expressed (Table 2) Proteins with values in bold were used for expression analysis (Figure 6) and are designated Hemolymph Vg-1 (MCOT18962.0.CT) and Hemolymph Vg-2 (XP_008487105.1) for this analysis. 18 ACS Paragon Plus Environment

Page 19 of 56 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Distribution of the average number of spectral counts per protein identified in each hemolymph protein sample. For each protein, the number of spectral counts assigned was averaged over the six biological replicate hemolymph samples [3 CLas(+), 3 CLas(-)]. The majority (77%) of the proteins were represented by fewer than 10 spectral counts, while ~1% of the proteins were represented by >100 spectral counts each. The number of differentially expressed (DE) proteins belonging to each class are indicated.

Analysis of Class 1 Hemolymph Proteins The most abundant proteins identified in the hemolymph samples (in Class 1) include the lipoproteins vitellogenin and apolipophorin, and proteins involved in fatty acid biosynthesis (ATP citrate lyase, Acetyl-CoA carboxylase and fatty acid synthase, Figure 4, Table 1). This is consistent with results from hemolymph analysis in other arthropods, where lipid synthesis and transport are among the central functions and these lipid metabolism proteins have been found to 19 ACS Paragon Plus Environment


be highly abundant.41, 52-53 Fatty acid synthesis requires large amounts of NADPH, and it is notable that many of the highly expressed D. citri hemolymph proteins function in NADPH production. Several dehydrogenase proteins are also expressed at high levels – these proteins oxidize substrates by reducing NAD+ or NADP+ to NADP or NADPH, respectively, resulting in the accumulation of reducing potential which is required for a range of biosynthetic reactions including fatty acid synthesis. Malate dehydrogenase, isocitrate dehydrogenase, malic enzyme, and the pentose phosphate pathway enzymes glucose-6-phosphate dehydrogenase and transaldolase are among the D. citri proteins involved in NADPH production which are in Classes 1 and 2 in the hemolymph (Table S1).

Other notable protein classes identified at high levels in the hemolymph are

phenoloxidases, which function in the anti-bacterial melanization response, and spermine oxidases, which are involved in the metabolism of polyamines, critical cellular factors which have been found to be involved in vitellogenesis in the mosquito.54

Figure 4. Fatty acid biosynthesis proteins detected in the Diaphorina citri hemolymph proteome. A majority of the most abundant hemolymph proteins are lipoproteins or have functions 20 ACS Paragon Plus Environment

Page 20 of 56

Page 21 of 56 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


related to fatty acid biosynthesis. The lipoproteins apolipophorin and vitellogenin are the most abundant hemolymph proteins, followed by fatty acid synthase (FAS). ATP citrate lyase (ACL) and acetyl CoA carboxylase (ACC) catalyze subsequent steps in the conversion of citrate to the fatty acid precursor malonyl CoA in the cytosol. These enzymatic conversions feed into fatty acid synthesis, which produces molecules including apolipophorin and vitellogenin, which possess both lipid-binding and immune functions. Vitellogenin is found to be more abundant in CLas(+) hemolymph, and apolipophorin is highly abundant but not CLas-responsive. FAS, ACL, and ACC are also highly abundant. Protein names are highlighted in bold faced font, and each is a Class 1 protein with average total spectral counts between 100-1000.

Three proteins annotated as apolipophorin were among the top ten most abundant proteins identified in the hemolymph (Table 1). The abundance of these proteins in D. citri hemolymph is consistent with blood proteome data from other insects, and reinforces the role of hemolymph in insect immunity.41 Apolipophorin is known to be an important immunity protein in insects, and is involved in immediate immune response in Galleria mellonella upon challenge by several bacterial pathogens.55 G. mellonella is a phytophagous Lepidopteran insect with an entirely different feeding mode from D. citri. The conserved immune function of apoliphorins in disparate insect orders suggests that these proteins may have ancestral immune functions in arthropods. The abundant hemolymph lipid proteins apolipophorin and vitellogenin are thought to have evolved from a common ancestral protein, establishing an evolutionarily ancient history of multi-functional lipid-binding proteins.56 Apolipophorin is a lipid-binding protein and binds the lipoteichoic acids of bacterial cells.41 Analysis of Differentially Expressed Proteins 21 ACS Paragon Plus Environment


Biological replication allowed us to determine which proteins are differentially expressed in CLas(+) hemolymph. Eleven proteins were found to be more abundant in CLas(+) compared to CLas(-) hemolymph (Table 2). Four of these (three vitellogenins and a fatty acid synthase) are in Class 1. Only two proteins, an endonuclease and a transposon-associated protein, both in Class 3, were found to be more abundant in CLas(-) compared to CLas(+) hemolymph (Table 2). Differentially expressed proteins were detected in each of the four described classes, indicating that proteomic response to CLas occurs along the entire dynamic range of the hemolymph proteome (Figure 3). Strikingly, the magnitude of these fold-changes were small relative to foldchanges which have been reported in other D. citri proteome studies from our lab.8, 42


Page 22 of 56

Page 23 of 56 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 2. Diaphorina citri proteins differentially abundant in CLas(+) compared to CLas(-) samples.

Dynamic Protein Descriptiona

Protein IDb

CLas (+)c

CLas (-)d

Log2 Fold

Range

CLas

Presence in other

Changee

Classificationf

effectg

D. citri tissuesh

Hexamerinlike protein 4

Gut, up in nymph MCOT02134.0.CT

10.4

0

NA

Class 3

Up

Hemocyanin 2

and adults Gut, up in nymph

XP_008477908.1

7.07

0.65

3.43

Class 4

Up

and adult

MCOT16075.1.CO

8.26

0.94

3.13

Class 4

Up

None

XP_008486251.1

9.74

1.97

2.29

Class 4

Up

None

MCOT04848.1.CO

12.2

3.15

1.95

Class 3

Up

Nymph and adult

MCOT22668.0.CC

23

9.66

1.25

Class 3

Up

Gut

MCOT14373.1.CT

68.6

44.4

0.62

Class 2

Up

Nymph and adult

GTP cyclohydrolas e1 Glucose dehydrogenas e Fatty acid synthase Heat shock protein Fatty acid synthase 2 Hemolymph Vg-4

Up in nymph and XP_008476565.1

119

80.1

0.57

Class 2

Up

Hemolymph Vg-2

adult Up in nymph and

XP_008487105.1

205

149

0.46


Class 1

Up

adult


Page 24 of 56

Hemolymph Vg-1

Up in nymph and MCOT18962.0.CT

322

249

0.36

Class 1

Up

adult Gut, present in

Fatty acid synthase

nymph, up in MCOT04192.0.CO

315

248

0.34

Class 1

Up

adults

Transposon Ty3-G GagPol

Gut, down in adult

polyprotein

MCOT20335.0.CT

4

17.3

-2.1

Class 3

Down

and nymphs

Endonuclease

MCOT00573.0.CT

11.8

25.9

-1.1

Class 3

Down

None

a

Annotated description of protein identified. bAccession number (Protein ID) for given protein as

defined by NCBI or by the MCOT transcriptome database containing D. citri and D. citri endosymbiont proteins established in.16 cThe average number of spectral counts in each CLas(+) sample analyzed. dThe average number of spectral counts in each CLas(-) sample analyzed. eThe Log2 of the fold change calculated by division of spectral counts from CLas(+) samples by spectral counts from CLas(-) samples. fThe dynamic range classification of the protein in which Class 1 proteins have 100-100 average spectral counts, Class 2 have 50-100 spectral counts, and Classes 3 and 4 have 10-50 and 0.45

indicates possible secretion) (Table 5). The majority of the predicted secreted proteins (14) are from Wolbachia, while one each are from Carsonella and Profftella. The Carsonella and Profftella predicted secreted proteins are both annotated as cold shock proteins. Most of the Wolbachia predicted secreted proteins have no known function, with the others annotated as a membrane protein and molecular chaperones (Table 5). All four proteins containing classical signal sequences are from Wolbachia.



Page 40 of 56

Table 5. Microbial proteins from D. citri hemolymph predicted by SecretomeP 2.0 to have secretory (Sec) pathway signal peptides or non-classical secretion signals.

Signal Sequence

Avg Spectral counts

Typed

over all samplese

Endosymbionta

Protein Descriptionb

Protein IDc

Wolbachia

membrane protein

WP_017532194.1 Sec pathway

1.8

Wolbachia

hypothetical protein


5.2

Wolbachia



1.8

Wolbachia

membrane protein


12.0

WP_017532612.1 Non-classical

4.4

molecular chaperone Wolbachia

DnaK* molecular chaperone

Wolbachia

GroES


5.3

Wolbachia



0.8

Wolbachia



1.3

Wolbachia



3.5

Wolbachia



6.3

Wolbachia

membrane protein


4.7

heat-shock protein Wolbachia

Hsp20


0.5

Wolbachia



2.5

Profftella

cold-shock protein


2.3


Page 41 of 56 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Carsonella

a

cold-shock protein


1.3

The D. citri endosymbiont producing the listed protein, including Wolbachia sp. (Wolbachia),

Profftella armatura (Profftella) and Carsonella rudii (Carsonella). bAnnotated description of protein identified. cAccession number (Protein ID) for given protein as defined by NCBI or by the MCOT transcriptome database containing D. citri and D. citri endosymbiont proteins. dThe type of secretory signal, with secretory (Sec) pathway signal peptides predicted by SignalP and Non-classical secretion signals predicted by Secretome 2.0. eThe average number of spectral counts from all samples, including CLas(+) and CLas(-). *

Protein is predicted to have a nuclear localization signal

Secreted bacterial proteins have great potential to directly influence host cellular pathways, and translocation to the host nucleus is a particularly interesting mechanism to accomplish this that can be employed by pathogenic and symbiotic bacteria.76-78 Thus, the predicted secreted proteins from Table 5 were analyzed for the presence of a nuclear localization signal (NLS) using the seqNLS web server.48 Using the default cut-off value (final score >0.86 indicates high likelihood of NLS), a predicted NLS was found for one out of 16 predicted secreted bacterial proteins found in D. citri- the Wolbachia molecular chaperone DnaK (WP_017532612.1). The predicted NLS sequence, 514EEKAQEDEKRK524, is at the C terminus of the protein. DnaK is the predominant prokaryotic member of the Hsp70 family of molecular chaperones, and shares strong sequence identity with eukaryotic Hsp70 proteins. Bacterial DnaK and its functional partner DnaJ have been shown to play a critical role in host-microbe interactions, with mutations in DnaK/DnaJ in Brucella



Page 42 of 56

suis, Campylobacter jejuni, and Salmonella enterica rendering the bacteria unable to colonize host cells, while they retained the ability to grow in culture.79 Molecular chaperones are among the most highly expressed proteins of endosymbiotic bacteria associated with hemipteran insects,80-83 and the endosymbiont proteins described here with predicted secretion and nuclear localization signal may play critical roles in stress and immune responses in D. citri. Secreted Wolbachia proteins may play a role in regulating interactions with CLas. The titers of Wolbachia and CLas have been shown to be positively correlated.13 A small Wolbachia protein was found to repress a lytic promoter called holin in a CLas-infecting phage withing D. citri.84 At least two strains of Wolbachia have been characterized in D. citri populations surveyed thus far.85 Secretion of proteins that interfere with host gene expression may also help to regulate interactions with coinfecting Wolbachia strains. Future studies should focus on understanding how Wolbachia proteins interact with D. citri cells and other obligate intracellular bacteria within the D. citri microbiome. Tissue-Specific OMIC’s provides a high resolution snapshot of CLas-D. citri interactions The number of differentially abundant proteins identified between CLas(-) and CLas(+) hemolymph samples is far fewer than were identified in similar proteomics studies using guts and whole insects as starting material (Table 6). Whereas less than 0.5% of the identified hemolymph proteins were found to be differentially abundant between CLas(-) and CLas(+) samples, nearly 10% of proteins identified from whole adult D. citri and over 13% of D. citri gut proteins were found to be differentially abundant (Table 6). The hemolymph is known to function in the insect immune response, and immune functions have been attributed to some of the most abundant hemolymph proteins (apolipophorin, vitellogenin, and transferrin) in other systems.

These

findings suggest that hemolymph-mediated immunity may be constitutively primed or alternatively, the immune response to CLas is tissue specific. The large number of gut proteins 42 ACS Paragon Plus Environment

Page 43 of 56 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


showing changes in abundance in response to CLas suggests that the pathogen induces a strong immune response in this organ, the initial site of pathogen acquisition into insect cells. Six out of 11 D. citri proteins found to be more abundant in CLas(+) compared to CLas(-) hemolymph are fatty acid synthases and vitellogenins. One of these vitellogenin proteins (XP_008487105.1), which was found at ~30% higher abundance in CLas(+) compared to CLas(-) hemolymph, was found at ~100 fold higher abundance in CLas(+) compared to CLas(-) whole adult D.citri samples.86 Other related vitellogenins and fatty acid synthases were also more abundant in whole adult CLas(+) compared to CLas(-) D. citri, as was the hemocyanin 2 protein,86 which was also more abundant in CLas(+) compared to CLas(-) hemolymph (Table 2). Transferrin was found to be abundant but not differentially expressed in D. citri hemolymph in response to CLas (Table 1). This protein is was found to be upregulated in whole D. citri adult CLas(+) samples, but was downregulated in CLas(+) guts, while iron scavenging ferritin proteins were up-regulated in CLas(+) guts.8, 42 Table 6. Summary of results from proteomics studies of CLas(-) and CLas(+) D. citri samples.

D. citri sample (host

Total

Differentially abundant

plant)a

proteinsb

proteinsc

%d

Hemolymph (citron)

2845

13

0.46

Whole nymph (citron)

3948

81

2.05

Whole adult (sweet orange)

3764

340

9.03

Whole adult (citron)

3668

356

9.71

Gut (citron)

1641

226

13.8



a

The D. citri sample submitted for proteomic analysis. The host plant on which the D. citri were

reared is given in parentheses. bThe total number of proteins identified in the sample. cThe number of proteins that were differentially abundant in CLas(+) compared to CLas(-) samples. dThe percent of total detected proteins that were differentially abundant in CLas(+) compared to CLas() samples.

Tissue-specific proteomics analysis reveals the effects of CLas on different components of the circulative transmission pathway in the insect vector. Whole body proteome data from adults and nymph D. citri, combined with gut and hemolymph proteome data, provide a highly resolved picture of regulation in D. citri tissues and responses to CLas (Figure 7).8 Taken together, these data reveal differences in iron transport and sequestration among different organs and CLas exposure states. Iron binding proteins are abundant in the D. citri, and are known to be affected by CLas exposure.8,87 In the whole body, the iron transport protein transferrin is up-regulated in CLas(+) insects. In the gut, transferrin is down-regulated, but the iron scavenging protein ferritin is up-regulated. In the D. citri hemolymph, transferrin is among the ten most abundant proteins, but is not CLas-responsive. This indicates that the gut is an iron-limited environment in which D. citri cells bind iron, whereas in the whole body and hemolymph, iron is being actively transported by transferrin. The gut shows up-regulation in apoptotic proteins, down-regulation in citric acid cycle enzymes and severe changes in gut nuclear morphology,12-13 whereas the whole body shows a slight up-regulation in citric acid cycle enzymes. These pathways are unaffected in the hemolymph in response to CLas. Vitellogenin was up-regulated in the hemolymph and whole body, but undetected in the gut. This analysis shows that the effect of CLas on D. citri hemolymph is minimal and highly specific, and demonstrates the importance of the increased resolution 44 ACS Paragon Plus Environment

Page 44 of 56

Page 45 of 56 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


afforded by tissue-specific analysis. The dampened response to CLas we observed in the hemolymph as compared to other tissues is most consistent with very minor effects of CLas that have been observed at the organismal level.7, 11, 88 Alternatively, it is possible that larger, sexspecific effects are occurring in the D. citri hemolymph in response to CLas and we could not have observed them because we pooled males and females in during hemolymph collection. If the latter were true, the result would be observed as compressed fold-change ratios of CLas-responsive hemolymph proteins. That said, even if the latter were true, the fold-change ratios would still be small relative to what has been published for other D. citri tissues in response to CLas. Other possibilities to explain these results may include hemolymph responses to CLas at the level of post-translational processing.



Figure 7. Schematic representation showing trends of proteome and transcriptome regulation in psyllid organs. Proteins involved in the citric acid (TCA) cycle and iron transport and scavenging, and vitellogenesis/vitellogenin-related immunity show tissue-specific regulation in response CLas. TCA cycle enzymes are up-regulated in the whole body, down-regulated in the gut, and their expression is unaffected in the hemolymph. Iron transport is up-regulated in the whole body, down-regulated in the gut along with up-regulation of iron scavenging and apoptotic proteins, and unaffected in the hemolymph. Vitellogenin proteins are up-regulated in the whole body, unaffected in the gut, and up-regulated in the hemolymph.


Page 46 of 56

Page 47 of 56 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Conclusions The proteome analysis of the D. citri hemolymph is consistent with molecular signatures of the vector manipulation hypothesis,89 where CLas is manipulating the physiological environment in the psyllid for its own benefit.7 Hemolymph from CLas-infected adult insects shows changes in energy metabolism proteins, immunity proteins and lipid transport proteins as compared to un-infected adults. The study provides a snapshot of the psyllid’s immune response to CLas, which may vary in intensity and context with CLas titer, CLas genotype, D. citri genotype and infection rate,90-91 D. citri developmental stage, host plant genotype,92 and environmental condition. An analysis of D. citri isofemale lines for CLas acquisition and transmission show that heritable, natural variation for CLas acquisition and transmission exists among D. citri populations,73 and these differences may reside in the cellular and humoral immune responses within the insect. CLas may have sex-specific effects on males and females, which have been reported previously.13 The current study would not have been able to readily identify those changes since the hemolymph proteome analysis was performed on hemolymph extracted and pooled from mixed sex adults. D. citri also exists in at least three color morphs.93 The color morphology of the insect may also play a role in the insect’s immune response. Finally, variation in the insect’s microbiome may also influence the response of the hemolymph to CLas.94 Separation of these critical factors in future analyses may increase our understanding of the nuanced responses of D. citri to CLas, and should be a focus of future proteomic research.

Acknowledgements: The authors gratefully acknowledge the Cornell University Insect Collection (CUIC) for assistance with imaging and Kathy Moulton (USDA ARS) for assistance with insect collection and colony maintenance. Funding for this study was provided by the USDA Specialty 47 ACS Paragon Plus Environment


Crops Grants Numbers 2015-70016-23028 and 2016-70016-24779, and California Citrus Research Board Grant number 5300-163.

Supporting Information: Supplemental Material S1- Sequences of Class 1 and differentially expressed vitellogenin proteins annotated to show cleavage motifs and serine-rich regions. Table S1- List of all proteins detected in D. citri hemolymph with spectral counts for each biological replicate. Table S2- List of all bacterial proteins detected in D. citri hemolymph, with average spectral counts from three biological replicates each of CLas(+) and CLas(-) hemolymph samples. Table S3- NCBI annotation of the ten vitellogenin proteins identified in this study. Table S4- List of proteins identified as having acetylation (K) or phosphorylation (S, T, Y) posttranslational modifications. Table S5- List of all peptides from D. citri hemolymph samples identified as acetylated or phosphorylated. Table S6- Ct values from 30 individual D. citri adults from the CLas(+) colony used in this study tested using qPCR to detect levels of CLas. References 1. Wang, N.; Trivedi, P., Citrus Huanglongbing: A Newly Relevant Disease Presents Unprecedented Challenges. Phytopathology 2013, 103 (7), 652-665. 2. da Graca, J. V.; Douhan, G. W.; Halbert, S. E.; Keremane, M. L.; Lee, R. F.; Vidalakis, G.; Zhao, H., Huanglongbing: An overview of a complex pathosystem ravaging the world's citrus. Journal of integrative plant biology 2016, 58 (4), 373-87. 48 ACS Paragon Plus Environment

Page 48 of 56

Page 49 of 56 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3. Gottwald, T. R.; McCollum, T. G., Huanglongbing solutions and the need for anti-conventional thought. Journal of Citrus Pathology 2017, 4 (1). Retrieved from https://escholarship.org/uc/item/2fp8n0g1. 4. Ammar, E. D.; Ramos, J. E.; Hall, D. G.; Dawson, W. O.; Shatters, R. G., Acquisition, Replication and Inoculation of Candidatus Liberibacter asiaticus following Various Acquisition Periods on HuanglongbingInfected Citrus by Nymphs and Adults of the Asian Citrus Psyllid. Plos One 2016, 11 (7), e0159594. 5. Ghanim, M.; Achor, D.; Ghosh, S.; Kontsedalov, S.; Lebedev, G.; Levy, A., 'Candidatus Liberibacter asiaticus' Accumulates inside Endoplasmic Reticulum Associated Vacuoles in the Gut Cells of Diaphorina citri. Scientific reports 2017, 7 (1), 16945. 6. Inoue, H.; Ohnishi, J.; Ito, T.; Tomimura, K.; Miyata, S.; Iwanami, T.; Ashihara, W., Enhanced proliferation and efficient transmission of Candidatus Liberibacter asiaticus by adult Diaphorina citri after acquisition feeding in the nymphal stage. Annals of Applied Biology 2009, 155 (1), 29-36. 7. Pelz-Stelinski, K. S.; Killiny, N., Better Together: Association With 'Candidatus Liberibacter Asiaticus' Increases the Reproductive Fitness of Its Insect Vector, Diaphorina citri (Hemiptera: Liviidae). Ann Entomol Soc Am 2016, 109 (3), 371-376. 8. Kruse, A.; Fattah-Hosseini, S.; Saha, S.; Johnson, R.; Warwick, E.; Sturgeon, K.; Mueller, L.; MacCoss, M. J.; Shatters, R. G., Jr.; Cilia Heck, M., Combining 'omics and microscopy to visualize interactions between the Asian citrus psyllid vector and the Huanglongbing pathogen Candidatus Liberibacter asiaticus in the insect gut. PLoS One 2017, 12 (6), e0179531. 9. Ren, S. L.; Li, Y. H.; Zhou, Y. T.; Xu, W. M.; Cuthbertson, A. G.; Guo, Y. J.; Qiu, B. L., Effects of Candidatus Liberibacter asiaticus on the fitness of the vector Diaphorina citri. Journal of applied microbiology 2016, 121(6):1718-1726. 10. Martini, X.; Hoffmann, M.; Coy, M. R.; Stelinski, L. L.; Pelz-Stelinski, K. S., Infection of an Insect Vector with a Bacterial Plant Pathogen Increases Its Propensity for Dispersal. PLOS ONE 2015, 10 (6), e0129373. 11. Killiny, N.; Hijaz, F.; Ebert, T. A.; Rogers, M. E., A Plant Bacterial Pathogen Manipulates Its Insect Vector's Energy Metabolism. Applied and environmental microbiology 2017, 83 (5), e03005-16. 12. Ghanim, M.; Fattah-Hosseini, S.; Levy, A.; Cilia, M., Morphological abnormalities and cell death in the Asian citrus psyllid (Diaphorina citri) midgut associated with Candidatus Liberibacter asiaticus. Scientific reports 2016, 6, 33418. 13. Mann, M., Fattah-Hosseini, S, Ammar, E.D., Stange, R, Warwick, E, Sturgeon, K, Shatters, R, Heck, M, Diaphorina citri nymphs are resistant to morphological changes induced by "Candidatus Liberibacter asiaticus" in midgut epithelial cells. Infection and immunity 2018, 86(4), e00889-17 14. Ramsey, J. S.; Chavez, J. D.; Johnson, R.; Hosseinzadeh, S.; Mahoney, J. E.; Mohr, J. P.; Robison, F.; Zhong, X.; Hall, D. G.; MacCoss, M.; Bruce, J.; Cilia, M., Protein interaction networks at the host–microbe interface in Diaphorina citri, the insect vector of the citrus greening pathogen. Royal Society Open Science 2017, 4 (2), 160545. 15. Orduño-Cruz, N.; Guzmán-Franco, A. W.; Rodríguez-Leyva, E., Diaphorina citri populations carrying the bacterial plant pathogen Candidatus Liberibacter asiaticus are more susceptible to infection by entomopathogenic fungi than bacteria-free populations. Agricultural and Forest Entomology 2016, 18 (1), 95-98. 16. Saha, S.; Hosmani, P. S.; Villalobos-Ayala, K.; Miller, S.; Shippy, T.; Flores, M.; Rosendale, A.; Cordola, C.; Bell, T.; Mann, H.; DeAvila, G.; DeAvila, D.; Moore, Z.; Buller, K.; Ciolkevich, K.; Nandyal, S.; Mahoney, R.; Van Voorhis, J.; Dunlevy, M.; Farrow, D.; Hunter, D.; Morgan, T.; Shore, K.; Guzman, V.; Izsak, A.; Dixon, D. E.; Cridge, A.; Cano, L.; Cao, X.; Jiang, H.; Leng, N.; Johnson, S.; Cantarel, B. L.; Richards, S.; English, A.; Shatters, R. G.; Childers, C.; Chen, M. J.; Hunter, W.; Cilia, M.; Mueller, L. A.; Munoz-Torres, M.; Nelson, D.; Poelchau, M. F.; Benoit, J. B.; Wiersma-Koch, H.; D'Elia, T.; Brown, S. J., Improved annotation of the insect vector of citrus greening disease: biocuration by a diverse genomics community. Database (Oxford) 2017, 2017, doi: 10.1093/database/bax032. 17. Gerardo, N. M.; Altincicek, B.; Anselme, C.; Atamian, H.; Barribeau, S. M.; de Vos, M.; Duncan, E. J.; Evans, J. D.; Gabaldon, T.; Ghanim, M.; Heddi, A.; Kaloshian, I.; Latorre, A.; Moya, A.; Nakabachi, A.; Parker, B. J.; Perez-Brocal, V.; Pignatelli, M.; Rahbe, Y.; Ramsey, J. S.; Spragg, C. J.; Tamames, J.; 49 ACS Paragon Plus Environment


Tamarit, D.; Tamborindeguy, C.; Vincent-Monegat, C.; Vilcinskas, A., Immunity and other defenses in pea aphids, Acyrthosiphon pisum. Genome biology 2010, 11 (2), R21. 18. Nachappa, P.; Levy, J.; Tamborindeguy, C., Transcriptome analyses of Bactericera cockerelli adults in response to "Candidatus Liberibacter solanacearum" infection. Molecular genetics and genomics : MGG 2012, 287 (10), 803-17. 19. Chen, W.; Hasegawa, D. K.; Kaur, N.; Kliot, A.; Pinheiro, P. V.; Luan, J.; Stensmyr, M. C.; Zheng, Y.; Liu, W.; Sun, H.; Xu, Y.; Luo, Y.; Kruse, A.; Yang, X.; Kontsedalov, S.; Lebedev, G.; Fisher, T. W.; Nelson, D. R.; Hunter, W. B.; Brown, J. K.; Jander, G.; Cilia, M.; Douglas, A. E.; Ghanim, M.; Simmons, A. M.; Wintermantel, W. M.; Ling, K.-S.; Fei, Z., The draft genome of whitefly Bemisia tabaci MEAM1, a global crop pest, provides novel insights into virus transmission, host adaptation, and insecticide resistance. BMC Biology 2016, 14 (1), 110. 20. Mesquita, R. D.; Vionette-Amaral, R. J.; Lowenberger, C.; Rivera-Pomar, R.; Monteiro, F. A.; Minx, P.; Spieth, J.; Carvalho, A. B.; Panzera, F.; Lawson, D.; Torres, A. Q.; Ribeiro, J. M.; Sorgine, M. H.; Waterhouse, R. M.; Montague, M. J.; Abad-Franch, F.; Alves-Bezerra, M.; Amaral, L. R.; Araujo, H. M.; Araujo, R. N.; Aravind, L.; Atella, G. C.; Azambuja, P.; Berni, M.; Bittencourt-Cunha, P. R.; Braz, G. R.; Calderon-Fernandez, G.; Carareto, C. M.; Christensen, M. B.; Costa, I. R.; Costa, S. G.; Dansa, M.; Daumas-Filho, C. R.; De-Paula, I. F.; Dias, F. A.; Dimopoulos, G.; Emrich, S. J.; Esponda-Behrens, N.; Fampa, P.; Fernandez-Medina, R. D.; da Fonseca, R. N.; Fontenele, M.; Fronick, C.; Fulton, L. A.; Gandara, A. C.; Garcia, E. S.; Genta, F. A.; Giraldo-Calderon, G. I.; Gomes, B.; Gondim, K. C.; Granzotto, A.; Guarneri, A. A.; Guigo, R.; Harry, M.; Hughes, D. S.; Jablonka, W.; Jacquin-Joly, E.; Juarez, M. P.; Koerich, L. B.; Lange, A. B.; Latorre-Estivalis, J. M.; Lavore, A.; Lawrence, G. G.; Lazoski, C.; Lazzari, C. R.; Lopes, R. R.; Lorenzo, M. G.; Lugon, M. D.; Majerowicz, D.; Marcet, P. L.; Mariotti, M.; Masuda, H.; Megy, K.; Melo, A. C.; Missirlis, F.; Mota, T.; Noriega, F. G.; Nouzova, M.; Nunes, R. D.; Oliveira, R. L.; Oliveira-Silveira, G.; Ons, S.; Orchard, I.; Pagola, L.; Paiva-Silva, G. O.; Pascual, A.; Pavan, M. G.; Pedrini, N.; Peixoto, A. A.; Pereira, M. H.; Pike, A.; Polycarpo, C.; Prosdocimi, F.; Ribeiro-Rodrigues, R.; Robertson, H. M.; Salerno, A. P.; Salmon, D.; Santesmasses, D.; Schama, R.; Seabra-Junior, E. S.; SilvaCardoso, L.; Silva-Neto, M. A.; Souza-Gomes, M.; Sterkel, M.; Taracena, M. L.; Tojo, M.; Tu, Z. J.; Tubio, J. M.; Ursic-Bedoya, R.; Venancio, T. M.; Walter-Nuno, A. B.; Wilson, D.; Warren, W. C.; Wilson, R. K.; Huebner, E.; Dotson, E. M.; Oliveira, P. L., Genome of Rhodnius prolixus, an insect vector of Chagas disease, reveals unique adaptations to hematophagy and parasite infection. Proceedings of the National Academy of Sciences of the United States of America 2015, 112 (48), 14936-41. 21. Xue, J.; Zhou, X.; Zhang, C. X.; Yu, L. L.; Fan, H. W.; Wang, Z.; Xu, H. J.; Xi, Y.; Zhu, Z. R.; Zhou, W. W.; Pan, P. L.; Li, B. L.; Colbourne, J. K.; Noda, H.; Suetsugu, Y.; Kobayashi, T.; Zheng, Y.; Liu, S.; Zhang, R.; Liu, Y.; Luo, Y. D.; Fang, D. M.; Chen, Y.; Zhan, D. L.; Lv, X. D.; Cai, Y.; Wang, Z. B.; Huang, H. J.; Cheng, R. L.; Zhang, X. C.; Lou, Y. H.; Yu, B.; Zhuo, J. C.; Ye, Y. X.; Zhang, W. Q.; Shen, Z. C.; Yang, H. M.; Wang, J.; Wang, J.; Bao, Y. Y.; Cheng, J. A., Genomes of the rice pest brown planthopper and its endosymbionts reveal complex complementary contributions for host adaptation. Genome biology 2014, 15 (12), 521. 22. Wang, L.; Tang, N.; Gao, X.; Guo, D.; Chang, Z.; Fu, Y.; Akinyemi, I. A.; Wu, Q., Understanding the immune system architecture and transcriptome responses to southern rice black-streaked dwarf virus in Sogatella furcifera. Scientific reports 2016, 6, 36254. 23. Arp, A. P.; Hunter, W. B.; Pelz-Stelinski, K. S., Annotation of the Asian Citrus Psyllid Genome Reveals a Reduced Innate Immune System. Front Physiol 2016, 7(570), eCollection 2016. 24. Saha, S.; Hunter, W. B.; Reese, J.; Morgan, J. K.; Marutani-Hert, M.; Huang, H.; Lindeberg, M., Survey of Endosymbionts in the Diaphorina citri Metagenome and Assembly of a Wolbachia wDi Draft Genome. PLoS ONE 2012, 7 (11), e50067. 25. Nakabachi, A.; Ueoka, R.; Oshima, K.; Teta, R.; Mangoni, A.; Gurgui, M.; Oldham, N. J.; van EchtenDeckert, G.; Okamura, K.; Yamamoto, K.; Inoue, H.; Ohkuma, M.; Hongoh, Y.; Miyagishima, S. Y.; Hattori, M.; Piel, J.; Fukatsu, T., Defensive bacteriome symbiont with a drastically reduced genome. Current biology : CB 2013, 23 (15), 1478-84. 50 ACS Paragon Plus Environment

Page 50 of 56

Page 51 of 56 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


26. Browne, N.; Heelan, M.; Kavanagh, K., An analysis of the structural and functional similarities of insect hemocytes and mammalian phagocytes. Virulence 2013, 4 (7), 597-603. 27. Hou, Y.; Zou, Y.; Wang, F.; Gong, J.; Zhong, X. W.; Xia, Q. Y.; Zhao, P., Comparative analysis of proteome maps of silkworm hemolymph during different developmental stages. Proteome Sci 2010, 8(45). 28. Handke, B.; Poernbacher, I.; Goetze, S.; Ahrens, C. H.; Omasits, U.; Marty, F.; Simigdala, N.; Meyer, I.; Wollscheid, B.; Brunner, E.; Hafen, E.; Lehner, C. F., The Hemolymph Proteome of Fed and Starved Drosophila Larvae. Plos One 2013, 8 (6), e67208. 29. Rocha, I. F.; Mailer, A.; Simao, R. D. G.; Kadowaki, M. K.; Alves, L. F. A.; Huergo, L. F.; Silva, J. L. D., Proteomic profile of hemolymph and detection of induced antimicrobial peptides in response to microbial challenge in Diatraea saccharalis (Lepidoptera: Crambidae). Biochem Bioph Res Co 2016, 473 (2), 511-516. 30. Arrese, E. L.; Soulages, J. L., Insect fat body: energy, metabolism, and regulation. Annu Rev Entomol 2010, 55, 207-25. 31. Guo, J. Y.; Dong, S. Z.; Yang, X. L.; Cheng, L.; Wan, F. H.; Liu, S. S.; Zhou, X. P.; Ye, G. Y., Enhanced Vitellogenesis in a Whitefly via Feeding on a Begomovirus-Infected Plant. Plos One 2012, 7 (8), e43567. 32. The International Aphid Genomics Consortium, Genome sequence of the pea aphid Acyrthosiphon pisum. PLoS Biol 2010, 8(2), e1000313. 33. Li, Z. J.; Zhang, S. C.; Zhang, J.; Liu, M.; Liu, Z. H., Vitellogenin is a cidal factor capable of killing bacteria via interaction with lipopolysaccharide and lipoteichoic acid. Mol Immunol 2009, 46 (16), 32323239. 34. Tufail, M.; Nagaba, Y.; Elgendy, A. M.; Takeda, M., Regulation of vitellogenin genes in insects. Entomological Science 2014, 17 (3), 269-282. 35. Salmela, H.; Amdam, G. V.; Freitak, D., Transfer of Immunity from Mother to Offspring Is Mediated via Egg-Yolk Protein Vitellogenin. Plos Pathog 2015, 11 (7), e1005015. 36. Niere, M.; Dettloff, M.; Maier, T.; Ziegler, M.; Wiesner, A., Insect immune activation by apolipophorin III is correlated with the lipid-binding properties of this protein. Biochemistry-Us 2001, 40 (38), 1150211508. 37. Zdybicka-Barabas, A.; Cytrynska, M., Apolipophorins and insects immune response. Isj-Invert Surviv J 2013, 10 (1), 58-68. 38. Clark, K. D.; Strand, M. R., Hemolymph Melanization in the Silkmoth Bombyx mori Involves Formation of a High Molecular Mass Complex That Metabolizes Tyrosine. J Biol Chem 2013, 288 (20), 14476-14487. 39. Dudzic, J. P.; Kondo, S.; Ueda, R.; Bergman, C. M.; Lemaitre, B., Drosophila innate immunity: regional and functional specialization of prophenoloxidases. Bmc Biol 2015, 13(81). 40. Killiny, N.; Hijaz, F.; El-Shesheny, I.; Alfaress, S.; Jones, S. E.; Rogers, M. E., Metabolomic analyses of the haemolymph of the Asian citrus psyllid Diaphorina citri, the vector of huanglongbing. Physiol Entomol 2017, 42 (2), 134-145. 41. Gill, T. A.; Chu, C.; Pelz-Stelinski, K. S., Comparative proteomic analysis of hemolymph from uninfected and Candidatus Liberibacter asiaticus-infected Diaphorina citri. Amino acids 2017, 49 (2), 389406. 42. Ramsey, J. S.; Johnson, R. S.; Hoki, J. S.; Kruse, A.; Mahoney, J.; Hilf, M. E.; Hunter, W. B.; Hall, D. G.; Schroeder, F. C.; MacCoss, M. J.; Cilia, M., Metabolic Interplay between the Asian Citrus Psyllid and Its Profftella Symbiont: An Achilles' Heel of the Citrus Greening Insect Vector. PLoS One 2015, 10 (11), e0140826. 43. Hall, D. G., Incidence of “Candidatus Liberibacter asiaticus” in a Florida population of Asian citrus psyllid. Journal of Applied Entomology 2018, 142 (1-2), 97-103. 44. Adusumilli, R.; Mallick, P., Data Conversion with ProteoWizard msConvert. In Proteomics: Methods and Protocols, Comai, L.; Katz, J. E.; Mallick, P., Eds. Springer New York: New York, NY, 2017; pp 339368.



45. Beausoleil, S. A.; Villen, J.; Gerber, S. A.; Rush, J.; Gygi, S. P., A probability-based approach for highthroughput protein phosphorylation analysis and site localization. Nature Biotechnology 2006, 24 (10), 1285-1292. 46. Bendtsen, J. D.; Kiemer, L.; Fausbøll, A.; Brunak, S., Non-classical protein secretion in bacteria. BMC Microbiology 2005, 5 (1), 58. 47. Petersen, T. N.; Brunak, S.; von Heijne, G.; Nielsen, H., SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat Methods 2011, 8 (10), 785-6. 48. Lin, J.-r.; Hu, J., SeqNLS: Nuclear Localization Signal Prediction Based on Frequent Pattern Mining and Linear Motif Scoring. PLOS ONE 2013, 8 (10), e76864. 49. Kumar, S.; Stecher, G.; Tamura, K., MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Molecular biology and evolution 2016, 33 (7), 1870-4. 50. Li, W.; Hartung, J. S.; Levy, L., Quantitative real-time PCR for detection and identification of Candidatus Liberibacter species associated with citrus huanglongbing. Journal of microbiological methods 2006, 66 (1), 104-15. 51. Shen, Y.; Kim, J.; Strittmatter, E. F.; Jacobs, J. M.; Camp, D. G., 2nd; Fang, R.; Tolie, N.; Moore, R. J.; Smith, R. D., Characterization of the human blood plasma proteome. Proteomics 2005, 5 (15), 4034-45. 52. Gudderra, N. P.; Sonenshine, D. E.; Apperson, C. S.; Roe, R. M., Hemolymph proteins in ticks. Journal of insect physiology 2002, 48 (3), 269-278. 53. de Morais Guedes, S.; Vitorino, R.; Domingues, R.; Tomer, K.; Correia, A. J.; Amado, F.; Domingues, P., Proteomics of immune-challenged Drosophila melanogaster larvae hemolymph. Biochemical and biophysical research communications 2005, 328 (1), 106-15. 54. Kogan, P. H.; Hagedorn, H. H., Polyamines, and effects from reducing their synthesis during egg development in the yellow fever mosquito, Aedes aegypti. Journal of insect physiology 2000, 46 (7), 10791095. 55. Halwani, A. E.; Niven, D. F.; Dunphy, G. B., Apolipophorin-III and the Interactions of Lipoteichoic Acids with the Immediate Immune Responses of Galleria mellonella. Journal of Invertebrate Pathology 2000, 76 (4), 233-241. 56. Babin, P. J.; Bogerd, J.; Kooiman, F. P.; Van Marrewijk, W. J. A.; Van der Horst, D. J., Apolipophorin II/I, Apolipoprotein B, Vitellogenin, and Microsomal Triglyceride Transfer Protein Genes Are Derived from a Common Ancestor. Journal of Molecular Evolution 1999, 49 (1), 150-160. 57. Salmela, H.; Amdam, G. V.; Freitak, D., Transfer of Immunity from Mother to Offspring Is Mediated via Egg-Yolk Protein Vitellogenin. PLoS pathogens 2015, 11 (7), e1005015. 58. Tufail, M.; Takeda, M., Molecular characteristics of insect vitellogenins. Journal of insect physiology 2008, 54 (12), 1447-1458. 59. Singh, N. K.; Pakkianathan, B. C.; Kumar, M.; Prasad, T.; Kannan, M.; König, S.; Krishnan, M., Vitellogenin from the Silkworm, Bombyx mori: An Effective Anti-Bacterial Agent. PLOS ONE 2013, 8 (9), e73005. 60. Lee, J. B.; Park, K.-E.; Lee, S. A.; Jang, S. H.; Eo, H. J.; Jang, H. A.; Kim, C.-H.; Ohbayashi, T.; Matsuura, Y.; Kikuchi, Y.; Futahashi, R.; Fukatsu, T.; Lee, B. L., Gut symbiotic bacteria stimulate insect growth and egg production by modulating hexamerin and vitellogenin gene expression. Developmental & Comparative Immunology 2017, 69 (Supplement C), 12-22. 61. Huo, Y.; Liu, W.; Zhang, F.; Chen, X.; Li, L.; Liu, Q.; Zhou, Y.; Wei, T.; Fang, R.; Wang, X., Transovarial Transmission of a Plant Virus Is Mediated by Vitellogenin of Its Insect Vector. PLoS pathogens 2014, 10 (3), e1003949. 62. Burmester, T., Evolution and function of the insect hexamerins. 1999; Vol. 96, p 213-225. 63. Eliautout, R.; Dubrana, M.-P.; Vincent-Monégat, C.; Vallier, A.; Braquart-Varnier, C.; Poirié, M.; Saillard, C.; Heddi, A.; Arricau-Bouvery, N., Immune response and survival of Circulifer haematoceps to Spiroplasma citri infection requires expression of the gene hexamerin. Developmental & Comparative Immunology 2016, 54 (1), 7-19. 64. Coates, C. J.; Nairn, J., Diverse immune functions of hemocyanins. Developmental & Comparative Immunology 2014, 45 (1), 43-55. 52 ACS Paragon Plus Environment

Page 52 of 56

Page 53 of 56 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


65. Hajek, K. L.; Friesen, P. D., Proteolytic processing and assembly of gag and gag-pol proteins of TED, a baculovirus-associated retrotransposon of the gypsy family. Journal of virology 1998, 72 (11), 8718-24. 66. Hansen, L. J.; Chalker, D. L.; Sandmeyer, S. B., Ty3, a yeast retrotransposon associated with tRNA genes, has homology to animal retroviruses. Molecular and Cellular Biology 1988, 8 (12), 5245-5256. 67. Konuma, T.; Tsukamoto, Y.; Nagasawa, H.; Nagata, S., Imbalanced Hemolymph Lipid Levels Affect Feeding Motivation in the Two-Spotted Cricket, Gryllus bimaculatus. PLoS One 2016, 11 (5), e0154841. 68. Nie, Z. M.; Zhu, H. I.; Zhou, Y.; Wu, C. C.; Liu, Y.; Sheng, Q.; Lv, Z. B.; Zhang, W. P.; Yu, W.; Jiang, C. Y.; Xie, L. F.; Zhang, Y. Z.; Yao, J. M., Comprehensive profiling of lysine acetylation suggests the widespread function is regulated by protein acetylation in the silkworm, Bombyx mori. Proteomics 2015, 15 (18), 3253-3266. 69. Yang, L.; Vaitheesvaran, B.; Hartil, K.; Robinson, A. J.; Hoopmann, M. R.; Eng, J. K.; Kurland, I. J.; Bruce, J. E., The Fasted/Fed Mouse Metabolic Acetylome: N6-Acetylation Differences Suggest Acetylation Coordinates Organ-Specific Fuel Switching. Journal of proteome research 2011, 10 (9), 413449. 70. Ibanez, F.; Tang, X.; Tamborindeguy, C., Bactericera cockerelli vitellogenin-6 like, a vitellogenin without a direct reproductive function? Insect Molecular Biology, 2018, 27(2), 166-176. 71. Sappington, T. W.; Raikhel, A. S., Molecular characteristics of insect vitellogenins and vitellogenin receptors. Insect biochemistry and molecular biology 1998, 28 (5-6), 277-300. 72. Ibanez, F.; Levy, J.; Tamborindeguy, C., Identification and expression analyses of vitellogenin in Bactericera cockerelli (Sulc). Journal of insect physiology 2017, 98, 205-213. 73. Ammar E. D., H. D. G., Hosseinzadeh, S., Heck, M. , The quest for a non-vector psyllid: Natural variation in acquisition and transmission of the huanglongbing pathogen “Candidatus Liberibacter asiaticus” by Asian citrus psyllid isofemale lines. PLoS One 2018, 13(4), e0195804. 74. Baldo, L.; Desjardins, C. A.; Russell, J. A.; Stahlhut, J. K.; Werren, J. H., Accelerated microevolution in an outer membrane protein (OMP) of the intracellular bacteria Wolbachia. BMC Evol Biol 2010, 10, 48. 75. Brattig, N. W.; Bazzocchi, C.; Kirschning, C. J.; Reiling, N.; Buttner, D. W.; Ceciliani, F.; Geisinger, F.; Hochrein, H.; Ernst, M.; Wagner, H.; Bandi, C.; Hoerauf, A., The major surface protein of Wolbachia endosymbionts in filarial nematodes elicits immune responses through TLR2 and TLR4. Journal of immunology (Baltimore, Md. : 1950) 2004, 173 (1), 437-45. 76. Christie, P. J.; Vogel, J. P., Bacterial type IV secretion: conjugation systems adapted to deliver effector molecules to host cells. Trends in Microbiology 2000, 8 (8), 354-360. 77. Dale, C.; Moran, N. A., Molecular Interactions between Bacterial Symbionts and Their Hosts. Cell 2006, 126 (3), 453-465. 78. Wu, M.; Sun, L. V.; Vamathevan, J.; Riegler, M.; Deboy, R.; Brownlie, J. C.; McGraw, E. A.; Martin, W.; Esser, C.; Ahmadinejad, N.; Wiegand, C.; Madupu, R.; Beanan, M. J.; Brinkac, L. M.; Daugherty, S. C.; Durkin, A. S.; Kolonay, J. F.; Nelson, W. C.; Mohamoud, Y.; Lee, P.; Berry, K.; Young, M. B.; Utterback, T.; Weidman, J.; Nierman, W. C.; Paulsen, I. T.; Nelson, K. E.; Tettelin, H.; O'Neill, S. L.; Eisen, J. A., Phylogenomics of the Reproductive Parasite Wolbachia pipientis wMel: A Streamlined Genome Overrun by Mobile Genetic Elements. PLOS Biology 2004, 2 (3), e69. 79. Henderson, B.; Allan, E.; Coates, A. R., Stress wars: the direct role of host and bacterial molecular chaperones in bacterial infection. Infection and immunity 2006, 74 (7), 3693-706. 80. Bouvaine, S.; Boonham, N.; Douglas, A. E., Interactions between a luteovirus and the GroEL chaperonin protein of the symbiotic bacterium Buchnera aphidicola of aphids. J Gen Virol 2011, 92 (Pt 6), 1467-74. 81. Rana, V. S.; Singh, S. T.; Priya, N. G.; Kumar, J.; Rajagopal, R., Arsenophonus GroEL Interacts with CLCuV and Is Localized in Midgut and Salivary Gland of Whitefly B. tabaci. PLoS ONE 2012, 7 (8), e42168. 82. Poliakov, A.; Russell, C. W.; Ponnala, L.; Hoops, H. J.; Sun, Q.; Douglas, A. E.; van Wijk, K. J., Largescale label-free quantitative proteomics of the pea aphid-Buchnera symbiosis. Molecular & cellular proteomics : MCP 2011, 10 (6), M110.007039. 53 ACS Paragon Plus Environment


83. Cilia, M.; Fish, T.; Yang, X.; McLaughlin, M.; Thannhauser, T. W.; Gray, S., A comparison of protein extraction methods suitable for gel-based proteomic studies of aphid proteins. Journal of biomolecular techniques : JBT 2009, 20 (4), 201-15. 84. Jain, M.; Fleites, L. A.; Gabriel, D. W., A Small Wolbachia Protein Directly Represses Phage Lytic Cycle Genes in “Candidatus Liberibacter asiaticus” within Psyllids. mSphere 2017, 2 (3), e00171-17. 85. Chu, C.-C.; Hoffmann, M.; Braswell, W. E.; Pelz-Stelinski, K. S., Genetic variation and potential coinfection of Wolbachia among widespread Asian citrus psyllid (Diaphorina citri Kuwayama) populations. Insect Science 2017. 86. Ramsey, J. S., Chavez, J.D., Johnson, R., Hosseinzadeh, S., Mahoney, J.E., Mohr, J.P., Robison, F., Zhong, X., Hall, D.G., MacCoss, M., Bruce, J., Cilia, M., Protein Interaction Networks at the host-microbe interface in Diaphorina citri, the insect vector of the citrus greening pathogen. Royal Society Open Science 2017, 4 (160545). 87. Vyas, M.; Fisher, T. W.; He, R.; Nelson, W.; Yin, G.; Cicero, J. M.; Willer, M.; Kim, R.; Kramer, R.; May, G. A.; Crow, J. A.; Soderlund, C. A.; Gang, D. R.; Brown, J. K., Asian Citrus Psyllid Expression Profiles Suggest Candidatus Liberibacter Asiaticus-Mediated Alteration of Adult Nutrition and Metabolism, and of Nymphal Development and Immunity. PLoS ONE 2015, 10 (6), e0130328. 88. Pelz-Stelinski, K. S.; Brlansky, R. H.; Ebert, T. A.; Rogers, M. E., Transmission parameters for Candidatus liberibacter asiaticus by Asian citrus psyllid (Hemiptera: Psyllidae). J Econ Entomol 2010, 103 (5), 1531-41. 89. Ingwell, L. L.; Eigenbrode, S. D.; Bosque-Perez, N. A., Plant viruses alter insect behavior to enhance their spread. Scientific reports 2012, 2, 578. 90. Coy, M.; Stelinski, L., Great Variability in the Infection Rate of ‘ Candidatus Liberibacter Asiaticus’ in Field Populations of Diaphorina citri (Hemiptera: Liviidae) in Florida. 2015, In press. 91. Meng, L.; Wang, Y.; Wei, W. H.; Zhang, H., Population genetic structure of Diaphorina citri Kuwayama (Hemiptera: Liviidae): host-driven genetic differentiation in China. Scientific reports 2018, 8 (1), 1473. 92. Folimonova, S. Y.; Robertson, C. J.; Garnsey, S. M.; Gowda, S.; Dawson, W. O., Examination of the responses of different genotypes of citrus to huanglongbing (citrus greening) under different conditions. Phytopathology 2009, 99 (12), 1346-54. 93. Wenninger, E. J.; Hall, D. G., Daily and Seasonal Patterns in Abdominal Color in Diaphorina citri (Hemiptera: Psyllidae). Annals of the Entomological Society of America 2008, 101 (3), 585-592. 94. Chu, C. C.; Gill, T. A.; Hoffmann, M.; Pelz-Stelinski, K. S., Inter-Population Variability of Endosymbiont Densities in the Asian Citrus Psyllid (Diaphorina citri Kuwayama). Microbial ecology 2016, 71 (4), 999-1007.


Page 54 of 56

Page 55 of 56 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


For TOC Only

Mass spectrometry provides insights into the hemolymph content of the insect vector associated with Huanglongbing (citrus greening disease).



Mass spectrometry provides insights into the hemolymph content of the insect vector associated with Huanglongbing (citrus greening disease). 61x47mm (150 x 150 DPI)

ACS Paragon Plus Environment

Page 56 of 56

'Candidatus Liberibacter asiaticus' minimally alters expression of

Recommend Documents