Cardioprotection of Tetrahedral DNA Nanostructures in Myocardial

Subscriber access provided by University of Groningen

Biological and Medical Applications of Materials and Interfaces

The Cardioprotection of Tetrahedral DNA Nanostructures in Myocardial Ischemia Reperfusion Injury Mei Zhang, Junyao Zhu, Xin Qin, Mi Zhou, Xiaolin Zhang, Yang Gao, Tianxu Zhang, Dexuan Xiao, Weitong Cui, and Xiaoxiao Cai ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.9b10645 • Publication Date (Web): 06 Aug 2019 Downloaded from pubs.acs.org on August 6, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

The Cardioprotection of Tetrahedral DNA Nanostructures in Myocardial Ischemia Reperfusion Injury Mei Zhang 1†, Junyao Zhu 1†, Xin Qin 1, Mi Zhou 1, Xiaolin Zhang 1, Yang Gao 1, Tianxu Zhang 1, Dexuan Xiao1, Weitong Cui 1 and Xiaoxiao Cai1*

1. State Key Laboratory of Oral Diseases, National Clinical Research Center for Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu 610041, P. R. China;

*Corresponding Author: Xiaoxiao Cai

Tel/Fax: 86-28-85503487

Email: [email protected]

†

Mei Zhang and Junyao Zhu contributed equally to the work.

ACS Paragon Plus Environment

1

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 44

ABSTRACT

Acute myocardial infarction (AMI), which can be extremely difficult to treat, is the worst deadly disease around the world. Reperfusion is expedient to reverse myocardial ischemia. However, during reperfusion, reactive oxygen species (ROS) produced by myocardial ischemia reperfusion injury (MIRI) and further cell apoptosis are the most serious challenge to cardiomyocytes. Therefore, searching for reagents that can simultaneously reduce oxidative damage and MIRI-induced apoptosis is the pivotal strategy to rescue injured cardiomyocytes. Nevertheless, current cardioprotective drugs have some shortcoming, such as cardiotoxicity, inadequate intravenous administration, or immature technology. Previous studies have shown that tetrahedral DNA nanostructures (TDNs) have biological safety with promising anti-inflammatory and antioxidative potential. However, the progress that TDNs have made in the biological behavior of cardiomyocytes has not been explored. In this experiment, a cellular model of MIRI was first established. Then, confirmed by a series of experiments, our study indicates that TDNs can significantly decrease oxidative damage and apoptosis by


2

Page 3 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


limiting the overexpression of ROS, along with effecting the expression of apoptosisrelated proteins. In addition, western blot analysis demonstrated that TDNs could activate the Akt/Nrf2 signaling pathway to improve the myocardial injury induced by MIRI. Above all, the antioxidant and anti-apoptotic capacities of TDNs make them a potential therapeutic drug for MIRI. This study provides new ideas and directions for more homogeneous diseases induced by oxidative damage.

KEYWORDS: Tetrahedral DNA nanostructure, Oxidative stress, Myocardial ischemia reperfusion injury, Akt/Nrf2 signaling pathway, Nanomaterials, Acute myocardial infarction


3


Page 4 of 44

1.INTRODUCTION AMI, originating from coronary heart disease, remains the worst ischemic heart disease (IHD).1 Previous studies have proved that timely reperfusion is the most effective treatment strategy for AMI.2 Reperfusion can restore coronary artery blood flow in ischemic tissue. However, accumulating evidence has shown that myocardial injury and cell death caused by MIRI is the primary reason for global morbidity and mortality.35

MIRI involves widespread pathological processes, including barriers to endothelial

cells, microvascular dysfunction, activated cell death, and activated autoimmune system processes. In addition to necrosis and autophagy, the process of cell death is mostly due to apoptosis.6 ROS seem to be the main mediators of various pathological dysfunction. At the onset of reperfusion, massive ROS are progressively produced, along with calcium overload, caspase activation, upregulation of cytokines, and peroxidation of DNA and proteins, which induce further cell apoptosis and death.7-8 Excess ROS, which upregulate apoptotic factors such as Bax and caspase-3, trigger cardiomyocytic apoptosis through mitochondrial-dependent pathways.9 Therefore, protecting cardiomyocytes from oxidative stress is considered an effective method for


4

Page 5 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


curing MIRI.10-11 Previous attempts, such as ischemic pre- and postconditioning, drugs, and appropriate care, which translate various nursing strategies and medical treatments into clinical practice, have all failed to reduce infarcted tissue and reverse death.8 Some drugs, such as cyclosporin A, MTP-131, TRO40303 and microRNA, have failed to successfully ameliorate MIRI because of adverse reactions, small scope of application and no targeting.6,

12

Consequently, the exploration of new cardioprotective drugs is

urgent. The emergence of structured DNA nanotechnology, especially the appearance of various two-dimensional as well as three-dimensional DNA nanostructures, has shown potential prospect in a number of applications, including the auxiliary diagnosis and treatment of diseases.13-14 Compared with other cardioprotective drugs, DNA nanostructures have illustrated excellent biological safety, biocompatibility, ease of uptake in cells and imaging, etc.15-16 Self-assembled three-dimensional DNA nanostructures show excellent biological effects on many important cells, especially differentiated cells.17 Nevertheless, as a highly differentiated cell, the loss of cardiomyocytes can aggravate cardiac insufficiency, heart failure and even lead to


5


death.

18-19

Page 6 of 44

In addition, TDNs that can inhibit neuronal apoptosis and reduce the ROS

produced by macrophages by raising the level of heme oxygenase-1 (HO-1) have been reported.20-21 Thus, the study of TDNs on the biological behavior of cardiomyocytes is particularly necessary. According to the aforementioned findings, by establishing an in vitro MIRI model, we confirmed that TDNs can downregulate ROS by activating Akt/Nrf2 signaling pathway, and then upregulate HO-1 expression, thereby reducing the overexpression of apoptotic proteins induced by ROS. These findings bring new hope for therapy of IHD because of the cardioprotective function of TDNs in MIRI.

2.MATERIALS AND METHODS 2.1 Materials Single strands of DNA with a particular base sequence were synthesized and characterized by Takara (Dalian, China). Cell Counting Kit-8 (CCK-8) was obtained from Shanghai Dojindo Technology Chemical Corp. The fluorescent probe 2 ′ , 7 ′ ‐ dichlorofluorescein diacetate (DCFH ‐ DA) Kit was obtained from the Beyotime


6

Page 7 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(Shanghai, China). ProteoPrep® Total Extraction Sample Kits were obtained from KeyGEN (Jiangsu, China). All antibodies in this experiment used for protein determination were purchased from Abcam (Cambridge, U.K.). 2.2 Synthesis of TDNs As shown in Table 1, four specific ssDNAs in the same concentration were poured into prepared TM buffer, which was constituted of 10 mM Tris-HCl and 50 mM MgCl2. Additionally, the pH of TM buffer was adjusted to 8.0. By hybridization of ssDNAs22, the TDNs were successfully synthesized by swirling, mixing and centrifuging the mixture, raising the temperature rapidly to 95 °C for 10 minutes, then cooling to 4 ° C for 20 minutes.23 2.3 Characterization of TDNs To validate the successful synthesis of TDNs, as described previously20, the distribution of molecular weight

was determined by

polyacrylamide

gel

electrophoresis (PAGE) and high performance capillary electrophoresis (HPCE). Transmission electron microscopy (TEM) and zeta potential were performed to analyze the morphological characterization and material stability of TDNs.


7


Page 8 of 44

2.4 Cellular Treatment H9c2 cells (ATCC, VA) were cultivated with growth medium, which consisted of highglucose Dulbecco’s modified Eagle’s medium (H-DMEM, Grand Island, NY) supplemented with 10% (v/v) FBS (New York, USA) and 1% (v/v) penicillin-streptomycin solution (Grand Island, NY). The simulated ischemia-reperfusion injury (SIR) used concentrations of potassium, calcium, lactate and internal environment similar to that of ischemia in vivo.

24

Briefly, by using a buffer (in mM: 10 deoxyglucose, 4 Hepes, 137

NaCl, 0.49 MgCl2, 12 KCl, 20 lactate and 0.9 CaCl2·2H2O, pH 6.5) to simulate a damaged environment, H9c2 cells were treated for 3 hour in an anaerobic incubator (1% N2, 5% CO2, 37 °C). Next, H9c2 cells were separated into three groups at random: (1) Control: H9c2 cells were cultivated with H-DMEM with 1% (v/v) FBS in an incubator (95% air, 5% CO2, 37 °C) (2) SIR: After 3 hours of anaerobic culture, H9c2 cells were then cultured as the same as the control group for 24 hours to simulate reperfusion; and (3) SIR + TDNs: After 3 hours of anaerobic culture, H9c2 cells were incubated with HDMEM supplemented with TDNs (250 nM) and 1% (v/v) FBS for 24 hours to simulate reperfusion.


8

Page 9 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.5 Uptake of Cy5-Loaded-TDNs The uptake of TDNs in H9c2 cells was analyzed by fluorescence tracer technique to ensure the role of TDNs in the whole experimental process. Briefly, H9c2 cells were cultured in confocal dishes (3 × 104/dish) with fresh H-DMEM for 24 hours. Then, the cells received ischemic management. After 3 hours of hypoxia, the cells were exposed to the H-DMEM with Cy5-loaded TDNs (250 nM, 1.5 mL/well) for 6 hours in a normoxic cell culture environment. Next, we sucked away the medium and used PBS to rinse the dishes three times. A 4% cold paraformaldehyde solution was applied to soak all samples for 15 minutes and samples were then washed thrice again. The cytoskeleton and nucleus of samples was stained respectively with FITC-phalloidin for 20 minutes and DAPI for 10 minutes. Subsequently, we used an ultrahigh resolution two-photon laser confocal microscope (N-SIM, Nikon, Tokyo, Japan) to observe the results. 2.6 Cell Viability Assay H9c2 cells were grouped and cultivated in a 96-well plate (5 × 103/well) with fresh high-glucose DEME (100µl/well) overnight; then cells were treated by SIR as previously mentioned.25 Briefly, After 3 hours of hypoxia, the medium of treatment group was


9


Page 10 of 44

substituted by the fresh high-glucose DEME containing 1% (v/v) FBS and TDNs at concentrations of 62.5 nM, 125 nM, and 250 nM for 24 hours. While, the other groups were replaced with the fresh H-DEME containing 1% (v/v) FBS without TDNs. Later, we applied the CCK-8 assay to determine cell viability. Put simply, we removed the original medium and, after rinsing, then added serum-free DMEM with 10% (v/v) CCK-8 solution. After the following incubation for 2 hours at 37 °C, the OD of samples was detected at a 450 nm wavelength. 2.7 Measurement of Intracellular ROS The DCFH-DA assay was selected to detect the quantitative and qualitative content of ROS as previously described.

21

Briefly, H9C2 cells were grouped and cultivated in a

12-well plate (3 × 104/well) with H-DMEM for 24 hours. Then, during the specified durations, the cells were subjected to treatment with SIR and TDNs. After the relative treatment, the cells were further cultured with H-DEME plus DCFH-DA (1:1000) for 20 minutes in the incubator environment, followed by rinsing with DMEM three times to dislodge any remaining DCFH-DA. Next, the nuclei were stained with DMEM containing 5 µl Hoechst in each pore. Finally, the microscope was used to obtain


10

Page 11 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


immunofluorescence images. Flow cytometry (FC500 Beckman, IL, USA) was applied to further analyze the fluorescent intensity of ROS. To be brief, H9c2 cells were inoculated into a 6-well plate (1 × 105/well) for 24 hours, which was subjected to the same treatment. After dyeing was completed, the cells were rinsed with DMEM three times and further digested. Next, 500 µl PBS was used to resuspend H9c2 cells. Finally, the samples were immediately tested with an excitation wavelength of 488 nm and an emission wavelength of 525 nm. The mean fluorescent intensity was analyzed by FlowJo software. 2.8 Determination of LDH In a 96-well plate, H9c2 cells were captured (5 × 103/well) with H-DEME (100µl/well) overnight; the cells were grouped as follow: (1) control, (2) SIR, (3) SIR + TDNs, and (4) maximum enzyme activity control group. The maximum enzyme activity control group was used for the subsequent lysis without management of drugs and injury. One hour before determination, 10% (v/v) LDH release reagent supplied by the Lactate Dehydrogenase Cytotoxicity Detection Kit (Beyotime, Shanghai, China) was applied to the maximum enzyme activity control group. The reagent was repeatedly blown to mix,


11


Page 12 of 44

and then incubation in the cell incubator was continued. After reperfusion for 24 hours, cell culture plates were centrifuged. The supernatant (120 µl/well) was separately moved onto the other same plate. Finally, at 490 nm, the OD of samples were measured. 2.9 Immunofluorescence Assay H9c2 cells were cultured over the slides of cells in a 12-well plate (3 × 104/well) with growth medium. As noted earlier, after hypoxia (3 hours) and reoxygenation (24 hours), PBS was used to rinse the plates three times; afterwards, cold 4% paraformaldehyde solution and 0.5% Triton X-100 were applied for 15 minutes and 10 minutes, respectively.26 Then, the slides were rinsed again and followed by blockade with goat serum for 1 hour. Subsequently, after washing again, samples were immersed at 4°C with diluted antibody against Bcl-2 (1:250), Nrf2 (1:250), Bax (1:500), caspase-3 (1:500) and HO-1 (1:250). The next day, after rinsing three times, the relevant fluorescent secondary antibody (1:500; Invitrogen, CA, USA) was used for 1 hour. The cytoskeleton and nucleus of cells was then stained with FITC-phalloidin (20 minutes) and DAPI (10


12

Page 13 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


minutes), respectively. Finally, the confocal laser microscope (TCS SP8; Leica, Wetzlar, Germany) was applied to obtain the outcome. 2.10 Quantitative PCR Quantitative PCR (q-PCR) was applied to detect the gene expression of Bax,

caspase-3, Bcl-2, HO-1, and Nrf2 in each group. TRIzol (Thermo Fisher Scientific ， MA)was used to extract total RNA; then, cDNA was obtained by further gene purification and reverse transcription. The PrimeScript RT-PCR Kit (TaKaRa, Dalian, China) was applied to perform q-PCR. The cDNAs was amplified in accordance with previous procedures27. The base sequences of corresponding primers are listed in Table 2. 2.11 Western Blot The proteins of Bax, caspase-3, HO-1, Nrf2, Akt and pAkt were quantified by western blotting. First, total proteins were extracted, and their concentrations were further determination. After adding loading buffer, the samples were blended and boiled. Then, the proteins were isolated by PAGE electrophoresis. After transmembrane and being sealed by 5% skim milk or 5% BSA, the first antibody was incubated at 4 ℃ over night. The next day, after one hour of rewarming in a shaking bed, the corresponding second


13


Page 14 of 44

antibody (1:2000; Beyotime, Shanghai, China) was incubated. After each operation, the strips were rinsed thrice over 30 minutes with TBST throughout the whole process. Finally, the strips were revealed as before.20 2.12 Flow Cytometry KeyGEN’s Annexin V-FITC Apoptosis Detection Kit (Jiangsu, China) was selected to detect apoptosis of the H9c2 cells. Then the outcomes were analyzed by flow cytometry. After SIR treatment, we used PBS to rinse the cells twice. Next, we digested and harvested the cells into corresponding centrifugal tubes. After two bouts of centrifugation, we then resuspended cells in binding buffer (500 μL/ tube) at 4 °C. In the dark, dyestuffs were added in sequence. Approximately ten to fifteen minutes later, the samples were tested by flow cytometry. 2.13 Statistical Analysis All data are showed as the mean ± standard difference (SD). The two-tailed t-test was applied to detect statistical difference. At p < 0.05, data were regarded as statistically significance. RESULTS AND DISCUSSION


14

Page 15 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3.1 Characterization and Cellular Uptake of TDNs Four single strands of complementary base sequences were assembled to form TDNs with tetrahedral structure (Table 1 and Figure 1B). As shown in the PAGE and HPCE results, the TDNs with the molecular weight of approximately 200 bp were successfully synthesized (Figure 1A and 1B). The results of TEM showed that the morphology and diameter of TDNs (Figure 1C) were triangular structures with a diameter of about 20 nanometers. As shown in Figure 1D, zeta potential was tested in order to further confirm the stability of TDNs, with an absolute value approaching 10 indicating that the stability is acceptable. These results demonstrated that TDNs had been successfully synthesized and had relatively stable nanostructures. In addition, in order to show that TDNs worked in subsequent experiments, it was necessary to prove the uptake of TDNs.28 The observation of confocal microscopy showed the uptake of Cy5-labeled TDNs (Figure 1E). The Cy5-labeled TDNs quickly entered injured H9c2 cells within the first six hours. Moreover, as shown in the images, most of them were found in the cytoplasm and the surface of the cell membrane. These results indicated that TDNs could penetrate the cell membrane and enter the cytoplasm


15


to affect the biological behavior of cells.

20-21, 29

Page 16 of 44

TDNs are ultimately transported to

lysosomes and completely digested, indicating their biological safety.30-31 3.2 Overproduction of ROS Suppressed by TDNs The overproduction of ROS causes oxidative stress and ultimately leads to apoptosis of cardiomyocytes.32-33 ROS at high concentrations are harmful to cells and cause ischemia-reperfusion injury.34 Based on their ability to scavenge free radical, TDNs have been effectively used in anti-inflammatory and antioxidative studies of macrophages.21 To explore whether TDNs can participate in the antioxidant activity of H9c2 cells, the DCFH-DA assay was applied to measure the ROS, and the amount of ROS was further compared by fluorescence intensity. As shown in Figure 2A, 2B and 2C, fluorescence microscope observation and mean fluorescence intensity also indicated SIR greatly increased the production of ROS; nevertheless, TDNs could reduce the increased ROS. 3.3 Inhibitory Effects of TDNs to SIR-Induced Cytotoxicity of H9c2 Cells To define whether TDNs were directly involved in the treatment of SIR-induced H9c2 cells injury, the number of cells was determined. The TDNs at concentrations of 62.5 nM, 125 nM, and 250 nM were applied to SIR-induced and the normal H9c2 cells. As


16

Page 17 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


shown in Figure 2D, there was no significant difference between the control group and all TDNs groups; however, TDNs increased the viability of SIR-injured cells in a concentration-dependent manner (Figure 2E). Like previous studies, 250 nM TDNs had the most obvious effect on promoting the survival of cardiomyocytes.35 Therefore, 250 nM TDNs were selected to participate in other experiments in this study. LDH is a biomarker of cell death in hemolytic diseases and other diseases, as it leaks out of damaged cells.36 When ischemia-reperfusion injury is improved, its microleakage will decrease significantly.36-38 As shown in Figure 2F, compared with the damage to the injured cells, it was significantly improved in the SIR+ TDNs group. These results manifest that TDNs have a therapeutic role in SIR-injured cells. 3.4 Anti-Apoptotic Effect of TDNs For the sake of exploring apoptosis, we further detected and analyzed cells by flow cytometry. Compared with that in the injured group, apoptosis has been greatly improved in the SIR+TDNs group. In particular, more than 70% of late apoptotic cells were treated. (Figure 3B)


17


Page 18 of 44

Mitochondria participate in cell death caused by hypoxia. Bcl-2 not only inhibits ROSinduced apoptosis but also depresses the activation of caspase-3 to improve apoptosis. 39-40

Moreover, the upregulation of proapoptotic Bax gene in cardiomyocytes is usually

accompanied by downregulation of the value of Bcl-2/Bax, promoting apoptosis. 41Then, apoptosis-related factors were further studied. As shown in Figure 3A, 24 hours after reperfusion, TDNs therapy increased the intensity of Bcl-2. The results of q-PCR also show the same trend in Figure 3C. In addition, SIR raised the intensity and expression of Bax and caspase-3. It is worth mentioning that the gene expression and protein intensity of both Bax and caspase-3 were obviously reduced in the SIR + TDNs group. (Figure 4 and 5) These results all indicated the TDNs could improve apoptosis by reversing the SIR-induced change in Bcl-2, Bax and caspase-3. 3.5 Antioxidant and Anti-Apoptotic Effect of TDNs on Akt/Nrf2 Signaling Pathway In this study, we have observed that TDNs can reduce the production of ROS and demonstrate antioxidant function. However, the specific mechanism of TDNs participating in the antioxidant signaling pathway has never been explored. The activation of Akt always plays an increasingly important part in enhancing the


18

Page 19 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


survival ratio of cardiomyocytes and can prevent the myocardial apoptosis induced by ischemia and hypoxia.42-44 HO-1, a protective enzyme, can prevent the death of cardiomyocytes through antioxidation, anti-apoptosis and anti-inflammatory effects.

45-47

Under normal circumstances, Nrf2 is bound to the actin-anchored protein Keap1, existing in the cytoplasm. When oxidative stress occurs, Nrf2 separates from Keap1, transfers to nucleus and upregulates antioxidant genes to enhance cell survival.

48-49

The activation of Akt, which allows displacement and gene expression of Nrf2, further upregulates HO-1 mRNA50-51 The results of western blotting in Figure 6C, 6D, 6E, and 6F show that the intensity of pAkt/Akt, Nrf2 and HO-1 have all been upregulated after treatment with TDNs. Similarly, in Figure 6A and 6B, it is also shown that TDNs can upregulate correlation immunofluorescence intensity. We further measured the expression of related genes. The results shown in Figure 6G and 6H, are consistent with the results of western blotting. After 24 hours of reperfusion in the SIR group, HO-1 and Nrf2 had higher gene expression than that of control group. The front studies indicate that Nrf2 and HO-1 could be slightly upregulated by oxidative stress induced by long-term reperfusion.52-53


19


Page 20 of 44

Nevertheless, in comparison with the SIR group, the gene expression intensity of Nrf2 and HO-1 in the SIR+TDNs group was higher. In conclusion, TDNs by activating the Akt/Nrf-2 signaling pathway plays a mighty cardioprotective role in MIRI, which may reflect its capacity to protect against oxidative damage and death of cardiomyocytes. 43 4. CONCLUSIONS Over the last few decades, timely reperfusion was considered an especially essential means to solve myocardial infarction.54 However, we cannot ignore the oxidative damage and apoptosis induced by reperfusion.55 In addition, it is worth noting that a number of cardioprotective drugs fail clinically. The safety and slight effect of these drugs

are not worth confirmation.8,

12

This is the first study to investigate

whether

activation of the Akt/Nrf2 signaling pathway plays a significant role in TDNs-mediated MIRI therapy. By activating this signaling pathway, TDNs not only reduce the production of ROS to depress oxidative damage, but also regulate the expression of apoptosisrelated gene and proteins to inhibit cell apoptosis.


20

Page 21 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


As far as we are concerned, this is the first comprehensive analysis of TDNs in the treatment of MIRI, including the response to oxidative damage and apoptosis, especially its antioxidant and anti-apoptotic functions. This study demonstrates the tremendous potential of TDNs in cardiac therapy and antioxidant therapy, which will help to rescue more cases of IHD with a new antioxidant. On account of the biosafety and biocompatibility of TDNs, the extension of this novel nanomaterial in the field of cardiology will be very prospective.

ACKNOWLEDGMENT

Fund of this research is from the National Natural Science Foundation of China (81771125, 81471803).

REFERENCES

(1) Hu, C.; Tkebuchava, T.; Hu, D., Managing Acute Myocardial Infarction in China: A Novel Standardized Comprehensive Program IRT-ABCDEF from China is Discussed and Proposed. Eur. Heart J 2019, 40, 1179-1181.


21


Page 22 of 44

(2) Yellon, D. M.; Hausenloy, D. J., Myocardial Reperfusion Injury. New Engl. J. Med 2007, 357, 1121-1135. (3) Roger, V. L.; Go, A. S.; Lloyd-Jones, D. M.; Adams, R. J.; Berry, J. D.; Brown, T. M.; Carnethon, M. R.; Dai, S.; de Simone, G.; Ford, E. S.; Fox, C. S.; Fullerton, H. J.; Gillespie, C.; Greenlund, K. J.; Hailpern, S. M.; Heit, J. A.; Ho, P. M.; Howard, V. J.; Kissela, B. M.; Kittner, S. J.; Lackland, D. T.; Lichtman, J. H.; Lisabeth, L. D.; Makuc, D. M.; Marcus, G. M.; Marelli, A.; Matchar, D. B.; McDermott, M. M.; Meigs, J. B.; Moy, C. S.; Mozaffarian, D.; Mussolino, M. E.; Nichol, G.; Paynter, N. P.; Rosamond, W. D.; Sorlie, P. D.; Stafford, R. S.; Turan, T. N.; Turner, M. B.; Wong, N. D.; Wylie-Rosett, J.; American Heart Association Statistics, C.; Stroke Statistics, S., Heart Disease and Stroke Statistics--2011 Update: A Report from the American Heart Association. Circulation 2011, 123, e18-e209. (4) Raedschelders, K.; Ansley, D. M.; Chen, D. D., The Cellular and Molecular Origin of Reactive Oxygen Species Generation during Myocardial Ischemia and Reperfusion. Pharmacol Ther 2012, 133, 230-255.


22

Page 23 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(5) Wu, L.; Wang, R., Carbon Monoxide: Endogenous Production, Physiological Functions, and Pharmacological Applications. Pharmacol Rev. 2005, 57, 585-630. (6) Eltzschig, H. K.; Eckle, T., Ischemia and Reperfusion—From Mechanism to Translation. Nat. Med 2011, 17, 1391. (7) Heusch, G.; Boengler, K.; Schulz, R., Inhibition of Mitochondrial Permeability Transition Pore Opening: The Holy Grail of Cardioprotection. Basic Res Cardiol 2010, 105, 151-154. (8) Heusch, G.; Gersh, B. J., The Pathophysiology of Acute Myocardial Infarction and Strategies of Protection beyond Reperfusion: A Continual Challenge. Eur. Heart J. 2016, 38, 774-784. (9) Kumar, D.; Jugdutt, B. I., Apoptosis and Oxidants in the Heart. J Clin Lab Med 2003, 142, 288-297. (10) Zhai, M.; Li, B.; Duan, W.; Jing, L.; Zhang, B.; Zhang, M.; Yu, L.; Liu, Z.; Yu, B.; Ren, K.; Gao, E.; Yang, Y.; Liang, H.; Jin, Z.; Yu, S., Melatonin Ameliorates Myocardial Ischemia Reperfusion Injury through SIRT3-Dependent Regulation of Oxidative Stress and Apoptosis. J Pineal Res 2017, 63, e12419.


23


Page 24 of 44

(11) Yang, Y.; Duan, W.; Jin, Z.; Yi, W.; Yan, J.; Zhang, S.; Wang, N.; Liang, Z.; Li, Y.; Chen, W.; Yi, D.; Yu, S., JAK2/STAT3 Activation by Melatonin Attenuates the Mitochondrial Oxidative Damage Induced by Myocardial Ischemia/Reperfusion Injury. J Pineal Res 2013, 55, 275-286. (12) Hausenloy, D. J.; Botker, H. E.; Engstrom, T.; Erlinge, D.; Heusch, G.; Ibanez, B.; Kloner, R. A.; Ovize, M.; Yellon, D. M.; Garcia-Dorado, D., Targeting Reperfusion Injury in Patients with ST-Segment Elevation Myocardial Infarction: Trials and Tribulations. Eur. Heart J. 2016, 38, 935-941. (13) Yan, H.; Zhang, X.; Shen, Z.; Seeman, N. C., A Robust DNA Mechanical Device Controlled by Hybridization Topology. Nature 2002, 415, 62-65. (14) Pinherio, A.; Han, D.; Shih, W.; Yan, H., Challenges and Opportunities for Structural DNA. Nat Nanotechol 2011, 6, 763-772. (15) Pei, H.; Zuo, X.; Zhu, D.; Huang, Q.; Fan, C., Functional DNA Nanostructures for Theranostic Applications. Acc. Chem. Res. 2013, 47, 550-559. (16) Chao, J.; Liu, H.; Su, S.; Wang, L.; Huang, W.; Fan, C., Structural DNA Nanotechnology for Intelligent Drug Delivery. Small 2014, 10, 4626-4635.


24

Page 25 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(17) Li, S.; Tian, T.; Zhang, T.; Cai, X.; Lin, Y., Advances in Biological Applications of Self-Assembled DNA Tetrahedral Nanostructures. Mater. Today 2019, 24, 57-68. (18) Nabel, E. G.; Braunwald, E., A Tale of Coronary Artery Disease and Myocardial Infarction. N. Engl. J. Med. 2012, 366, 54-63. (19) Palojoki, E.; Saraste, A.; Eriksson, A.; Pulkki, K.; Kallajoki, M.; Voipio-Pulkki, L.M.; Tikkanen, I., Cardiomyocyte Apoptosis and Ventricular Remodeling after Myocardial Infarction in Rats. Am J Physiol Heart Circ Physiol 2001, 280, H2726-H2731. (20) Shao, X.; Ma, W.; Xie, X.; Li, Q.; Lin, S.; Zhang, T.; Lin, Y., Neuroprotective Effect of Tetrahedral DNA Nanostructures in a Cell Model of Alzheimer's Disease. ACS Appl. Mater. Interfaces 2018, 10, 23682-23692. (21) Zhang, Q.; Lin, S.; Shi, S.; Zhang, T.; Ma, Q.; Tian, T.; Zhou, T.; Cai, X.; Lin, Y., Anti-Inflammatory and Antioxidative Effects of Tetrahedral DNA Nanostructures via the Modulation of Macrophage Responses. ACS Appl. Mater. Interfaces 2018, 10, 34213430.


25

Page 26 of 44


(22)

Li, X.; Xie, X.; Ma, Z.; Li, Q.; Liu, L.; Hu, X.; Liu, C.; Li, B.; Wang, H.; Chen, N.;

Fan, C.; Song, H. Programming Niche Accessibility and In Vitro Stemness with Intercellular DNA Reactions. Adv Mater 2018, 30, e1804861. (23) Shao, X.; Lin, S.; Peng, Q.; Shi, S.; Wei, X.; Zhang, T.; Lin, Y., Tetrahedral DNA Nanostructure: A Potential Promoter for Cartilage Tissue Regeneration via Regulating Chondrocyte Phenotype and Proliferation. Small 2017, 13, 1602770. (24) Esumi, K.; Nishida, M.; Shaw, D.; Smith, T.; Marsh, J., NADH Measurements in Adult Rat Myocytes during Simulated Ischemia. Am J Physiol-Heart C 1991, 260, H1743-H1752. (25) Liu, N.; Zhou, M.; Zhang, Q.; Yong, L.; Zhang, T.; Tian, T.; Ma, Q.; Lin, S.; Zhu, B.; Cai, X., Effect of Substrate Stiffness on Proliferation and Differentiation of Periodontal Ligament Stem Cells. Cell proliferat 2018, 51, e12478. (26) Zhao, D.; Li, Q.; Liu, M.; Ma, W.; Zhou, T.; Xue, C.; Cai, X., Substrate Stiffness Regulated Migration and Invasion Ability of Adenoid Cystic Carcinoma Cells via RhoA/ROCK Pathway. Cell proliferat 2018, 51, e12442.


26

Page 27 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(27) Zhou, M.; Liu, N.; Zhang, Q.; Tian, T.; Ma, Q.; Zhang, T.; Cai, X., Effect of Tetrahedral DNA Nanostructures on Proliferation and Osteogenic Differentiation of Human Periodontal Ligament Stem Cells. Cell proliferat 2019, e12566. (28) Han, G.; Ghosh, P.; Rotello, V. M., Functionalized Gold Nanoparticles for Drug Delivery. Nanomedicine 2007, 2, 113-123. (29) Peng, Q.; Shao, X.-R.; Xie, J.; Shi, S.-R.; Wei, X.-Q.; Zhang, T.; Cai, X.-x.; Lin, Y.-F., Understanding the Biomedical Effects of the Self-Assembled Tetrahedral DNA Nanostructure on Living Cells. ACS Appl. Mater. Interfaces 2016, 8, 12733-12739. (30) Lee, H.; Lytton-Jean, A. K.; Chen, Y.; Love, K. T.; Park, A. I.; Karagiannis, E. D.; Sehgal, A.; Querbes, W.; Zurenko, C. S.; Jayaraman, M., Molecularly Self-Assembled Nucleic Acid Nanoparticles for Targeted In Vivo SiRNA Delivery. Nat Nanotechnol 2012, 7, 389-393. (31) Liang, L.; Li, J.; Li, Q.; Huang, Q.; Shi, J.; Yan, H.; Fan, C., Single ‐ Particle Tracking and Modulation of Cell Entry Pathways of a Tetrahedral DNA Nanostructure in Live Cells. Angew. Chem. Int. Ed. Engl. 2014, 53, 7745-7750.


27


Page 28 of 44

(32) Song, D.; Cheng, Y.; Li, X.; Wang, F.; Lu, Z.; Xiao, X.; Wang, Y., Biogenic Nanoselenium Particles Effectively Attenuate Oxidative Stress-Induced Intestinal Epithelial Barrier Injury by Activating the Nrf2 Antioxidant Pathway. ACS Appl. Mater. Interfaces 2017, 9, 14724-14740. (33) Von Harsdorf, R. d.; Li, P.-F.; Dietz, R., Signaling Pathways in Reactive Oxygen Species–Induced Cardiomyocyte Apoptosis. Circulation 1999, 99, 2934-2941. (34) Droge, W., Free Radicals in the Physiological Control of Cell Function. Physiol Rev 2002, 82, 47-95. (35) Lin, S.; Zhang, Q.; Zhang, T.; Shao, X.; Li, Y.; Shi, S.; Tian, T.; Wei, X.; Lin, Y., Tetrahedral DNA Nanomaterial Regulates the Biological Behaviors of Adipose-Derived Stem Cells via DNA Methylation on Dlg3. ACS Appl. Mater. Interfaces 2018, 10, 3201732025. (36) Kato, G. J.; McGowan, V.; Machado, R. F.; Little, J. A.; Taylor, J.; Morris, C. R.; Nichols, J. S.; Wang, X.; Poljakovic, M.; Morris, S. M., Lactate Dehydrogenase as a Biomarker of Hemolysis-Associated Nitric Oxide Resistance, Priapism, Leg Ulceration,


28

Page 29 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Pulmonary Hypertension, and Death in Patients with Sickle Cell Disease. Blood 2006, 107, 2279-2285. (37) Bucciarelli, L. G.; Kaneko, M.; Ananthakrishnan, R.; Harja, E.; Lee, L. K.; Hwang, Y. C.; Lerner, S.; Bakr, S.; Li, Q.; Lu, Y., Receptor for Advanced-Glycation End Products. Circulation 2006, 113, 1226-1234. (38) Xiang, S. Y.; Vanhoutte, D.; Del Re, D. P.; Purcell, N. H.; Ling, H.; Banerjee, I.; Bossuyt, J.; Lang, R. A.; Zheng, Y.; Matkovich, S. J., RhoA Protects the Mouse Heart against Ischemia/Reperfusion Injury. J. Clin. Invest. 2011, 121, 3269-3276. (39) Baines, C. P.; Kaiser, R. A.; Sheiko, T.; Craigen, W. J.; Molkentin, J. D., VoltageDependent Anion Channels are Dispensable for Mitochondrial-Dependent Cell Death. Nat. Cell Biol. 2007, 9, 550-555. (40) Kang, P. M.; Haunstetter, A.; Aoki, H.; Usheva, A.; Izumo, S., Morphological and Molecular Characterization of Adult Cardiomyocyte Apoptosis during Hypoxia and Reoxygenation. Circ Res 2000, 87, 118-125. (41) Condorelli, G.; Morisco, C.; Stassi, G.; Notte, A.; Farina, F.; Sgaramella, G.; De Rienzo, A.; Roncarati, R.; Trimarco, B.; Lembo, G., Increased Cardiomyocyte Apoptosis


29


Page 30 of 44

and Changes in Proapoptotic and Antiapoptotic Genes Bax and Bcl-2 During Left Ventricular Adaptations to Chronic Pressure Overload in the Rat. Circulation 1999, 99, 3071-3078. (42) Fujio, Y.; Nguyen, T.; Wencker, D.; Kitsis, R. N.; Walsh, K., Akt Promotes Survival of Cardiomyocytes In Vitro and Protects against Ischemia-Reperfusion Injury in Mouse Heart. Circulation 2000, 101, 660-667. (43) Matsui, T.; Tao, J.; del Monte, F.; Lee, K.-H.; Li, L.; Picard, M.; Force, T. L.; Franke, T. F.; Hajjar, R. J.; Rosenzweig, A., Akt Activation Preserves Cardiac Function and Prevents Injury after Transient Cardiac Ischemia In Vivo. Circulation 2001, 104, 330-335. (44) Shiraishi, I.; Melendez, J.; Ahn, Y.; Skavdahl, M.; Murphy, E.; Welch, S.; Schaefer, E.; Walsh, K.; Rosenzweig, A.; Torella, D., Nuclear Targeting of Akt Enhances Kinase Activity and Survival of Cardiomyocytes. Circ Res 2004, 94, 884-891. (45) Hinkel, R.; Lange, P.; Petersen, B.; Gottlieb, E.; Ng, J. K. M.; Finger, S.; Horstkotte, J.; Lee, S.; Thormann, M.; Knorr, M., Heme Oxygenase-1 Gene Therapy


30

Page 31 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Provides Cardioprotection via Control of Post-Ischemic Inflammation: An Experimental Study in a Pre-Clinical Pig Model. J Am Coll Cardiol 2015, 66, 154-165. (46) Wang, G.; Hamid, T.; Keith, R. J.; Zhou, G.; Partridge, C. R.; Xiang, X.; Kingery, J. R.; Lewis, R. K.; Li, Q.; Rokosh, D. G., Cardioprotective and Anti-Apoptotic Effects of Heme Oxygenase-1 in the Failing Heart. Circulation 2010, 121, 1912. (47) Yoshida, T.; Maulik, N.; Ho, Y.-S.; Alam, J.; Das, D. K., Hmox-1 Constitutes an Adaptive Response to Effect Antioxidant Cardioprotection: A Study with Transgenic Mice Heterozygous for Targeted Disruption of the Heme Oxygenase-1 Gene. Circulation 2001, 103, 1695-1701. (48) Itoh, K.; Wakabayashi, N.; Katoh, Y.; Ishii, T.; Igarashi, K.; Engel, J. D.; Yamamoto, M., Keap1 Represses Nuclear Activation of Antioxidant Responsive Elements by Nrf2 through Binding to the Aminuteso-Terminutesal Neh2 Domain. Gene Dev 1999, 13, 76-86. (49) Kensler, T. W.; Wakabayashi, N.; Biswal, S., Cell Survival Responses to Environmental Stresses via the Keap1-Nrf2-ARE Pathway. Annu. Rev. Pharmacol. Toxicol. 2007, 47, 89-116.


31


Page 32 of 44

(50) Piantadosi, C. A.; Carraway, M. S.; Babiker, A.; Suliman, H. B., Heme Oxygenase-1

Regulates

Cardiac

Mitochondrial

Biogenesis

via

Nrf2-Mediated

Transcriptional Control of Nuclear Respiratory Factor-1. Circ Res 2008, 103, 1232-40. (51) Zheng, K.; Zhang, Q.; Sheng, Z.; Li, Y.; Lu, H. H., Ciliary Neurotrophic Factor (CNTF) Protects Myocardial Cells from Oxygen Glucose Deprivation (OGD)/ReOxygenation via Activation of Akt-Nrf2 Signaling. Cell Physiol Biochem 2018, 51, 18521862. (52) Kang, J. W.; Lee, S. M., Melatonin Inhibits Type 1 Interferon Signaling of TollLike Receptor 4 via Heme Oxygenase-1 Induction in Hepatic Ischemia/Reperfusion. J Pineal Res 2012, 53, 67-76. (53) Ke, B.; Shen, X.-D.; Zhang, Y.; Ji, H.; Gao, F.; Yue, S.; Kamo, N.; Zhai, Y.; Yamamoto, M.; Busuttil, R. W.; Kupiec-Weglinski, J. W., KEAP1-NRF2 Complex in Ischemia-Induced Hepatocellular Damage of Mouse Liver Transplants. J. Hepatol. 2013, 59, 1200-1207. (54) Lassen, J. F.; Bøtker, H. E.; Terkelsen, C. J., Timely and Optimal Treatment of Patients with STEMI. Nat. Rev. Cardiol. 2013, 10, 41-48.


32

Page 33 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(55) Kalogeris, T.; Bao, Y.; Korthuis, R. J. Mitochondrial Reactive Oxygen Species: A Double Edged Sword in Ischemia/Reperfusion vs Preconditioning. Redox bio 2014, 2, 702-714.


33


Page 34 of 44

Table1. Base Sequences of Each Specific ssDNA DNA

Base sequence

S1

5′-ATTTATCACCCGCCATAGTAGACGTATCACC

S2

AGGCAGTTGAGACGAACATTCCTAAGTCTGAA-3′ 5′-ACATGCGAGGGTCCAATACCGACGATTACA

S3

GCTTGCTACACGATTCAGACTTAGGAATGTTCG-3′ 5′-ACTACTATGGCGGGTGATAAAACGTGTAGCA AGCTGTAATCGACGGGAAGAGCATGCCCATCC-3′

S4

5′-ACGGTATTGGACCCTCGCATGACTCAACTGC CTGGTGATACGAGGATGGGCATGCTCTTCCCG-3′

Cy5-S1

5′Cy5-ATTTATCACCCGCCATAGTAGACGTATCAC CAGGCAGTTGAGACGAACATTCCTAAGTCTGAA-3′

Table2. Base Sequences of Relevant Genes for q-PCR mRNA

primer pairs (5′ → 3′)

β-actin

Forward CCTAGACTTCGAGCAAGAGA Reverse GGAAGGAAGGCTGGAAGA

Nrf2

Forward GCCTTCCTCTGCTGCCATTAGTC Reverse TCATTGAACTCCACCGTGCCTTC

HO-1

Forward TATCGTGCTCGCATGAACACTCTG Reverse GTTGAGCAGGAAGGCGGTCTTAG

Bax

Forward TGGCGATGAACTGGACCACA


34

Page 35 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Reverse TAGAAAAGGGCAACCACCCG

Bcl-2

Forward GAGGGGCTACGAGTGGGATA Reverse CGGTAGCGACGAGAGAAGTC

caspase-3

Forward CGGACCTGTGGACCTGAAAA Reverse TAACCGGGTGCGGTAGAGTA


35


Page 36 of 44

Figure Legends

Figure 1. Characteristics and cellular uptake of TDNs. (A) Molecular weight of synthesized TDNs detected by PAGE. (B) Molecular weight of synthesized TDNs detected by HPCE. (C) A TEM image of synthesized TDNs. (TDNs: red; Polymers: yellow) (D) Stability of TDNs measured by zata potential. Data are presented as the


36

Page 37 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mean ± SD (n = 4) (E) Uptaken of cy5-loaded-TDNs in injured H9c2 cells (cytoskeleton: green; Cy5-TDNs: red; nuclear: blue). Scale bars are 20μm.

Figure 2. TDNs depressed overproduction of ROS and SIR-induced cytotoxicity. (A) Immunofluorescence images of ROS in H9c2 cells (100X；Hoechst: blue；ROS: green) (B) The level of ROS in H9c2 cells detected by flow cytometry. (C) Mean fluorescence intensity of ROS analyzed from flow cytometry results. Data are presented as the mean


37


Page 38 of 44

± SD (n = 3) (D) CCK-8 results of normal H9c2 cells after treatment of TDNs for 24h. Data are presented as the mean ± SD (n = 4). (E) CCK-8 results of SIR-injured H9c2 cells after treatment with TDNs for 24h. Data are presented as the mean ± D (n = 4). (F) Production of LDH for 24 hours after treatment with SIR and 250nM TDNs. Data are presented as the mean ± SD (n = 4) Statistic differences are significant among the four groups (p < 0.05); we specifically marked the significant differences between the SIR group and SIR+ TDNs group. Statistical analysis: * p < 0.05, ** p < 0.01, and *** p < 0.001.


38

Page 39 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Effect of TDNs on expression of Bcl-2 and apoptosis (A) Immunofluorescence micrographs of SIR-treated H9c2 cells (cytoskeleton: green, nucleus: blue, Bcl-2: red). Scale bars are 20 μm. (B) Flow cytometry analysis of apoptosis of H9c2 cells after treatment with TDNs (250 nM). (C) Relative gene expression of Bcl-2 in H9c2 cells after


39


Page 40 of 44

treatment with SIR and TDNs (250 nM). Data are presented as mean ± SD (n = 4). Student’s t-test is used for statistical analysis. Statistical analysis: * p < 0.05.

Figure 4. Effect of TDNs on expression of Bax (A) Immunofluorescence micrographs of SIR-treated H9c2 cells (cytoskeleton: green, nucleus: blue, Bax: red). Scale bars are 20 μm. (B) Relative gene expression of Bax in H9c2 cells after treatment with SIR and TDNs (250 nM). (C) Western blot analysis of Bax expression level (β-actin was used as


40

Page 41 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


an internal control). (D) The relative protein expression intensity of Bax. Data are presented as mean ± SD (n = 4). Student’s t-test is used for statistical analysis. Statistical analysis: * p < 0.05, ** p < 0.01, and ***p < 0.001.

Figure 5. Effect of TDNs on expression of caspase-3 (A) Immunofluorescence micrographs of SIR-treated H9c2 cells (cytoskeleton: green, nucleus: blue, caspase-3: red). Scale bars are 20 μm. (B) Relative gene expression of caspase-3 in H9c2 cells


41


Page 42 of 44

after treatment with SIR and TDNs (250 nM). (C) Western blot analysis of caspase-3 expression level (β-actin was used as an internal control). (D) The relative protein expression intensity of caspase-3. Data are presented as mean ± SD (n = 4). Student’s t-test is used for statistical analysis. Statistical analysis: * p < 0.05, ** p < 0.01, and ***p < 0.001.


42

Page 43 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. TDNs decreased oxidation and apoptosis via activating the Akt/Nrf2 signaling pathway (A) Immunofluorescence micrographs of SIR-treated H9c2 cells (cytoskeleton: green, nucleus: blue, Nrf2: red). Scale bars are 20 μm. (B) Immunofluorescence micrographs of SIR-treated H9c2 cells (cytoskeleton: green, nucleus: blue, HO-1: red). Scale bars are 20 μm. (C) Western blot analysis of Akt, p-Akt, Nrf2, HO-1 expression level (β-actin was used as an internal control). (D) The relative protein expression intensity of pAkt/Akt. Data are presented as mean ± SD. (n = 4) (E) The relative protein expression intensity of Nrf2. Data are presented as mean ± SD. (n = 4) (F) The relative protein expression intensity of HO-1. Data are presented as mean ± SD. (n = 4). (G) Relative gene expression of Nrf2 in H9c2 cells after treatment with SIR and TDNs (250 nM). (H) Relative gene expression of HO-1 in H9c2 cells after treatment with SIR and TDNs (250 nM). Data are presented as mean ± SD. Statistics analysis: * p < 0.05, ** p < 0.01, and *** p < 0.001.


43


Page 44 of 44

Figure 7. Graphical abstract shows the cardioprotection of tetrahedral DNA nanostructures in the in vitro model of myocardial ischemia reperfusion injury.


44

Cardioprotection of Tetrahedral DNA Nanostructures in Myocardial

Recommend Documents