Characterization of a Glycoside Hydrolase Family 27 α-Galactosidase

Mar 7, 2016 - The degree of synergy on enzymatic degradation of locust bean gum and guar gum by an endomannanase and rAgaAHJ8 was 1.22–1.54...
0 downloads 0 Views 5MB Size
Download PDF
Article pubs.acs.org/JAFC

Characterization of a Glycoside Hydrolase Family 27 α‑Galactosidase from Pontibacter Reveals Its Novel Salt−Protease Tolerance and Transglycosylation Activity Junpei Zhou,†,‡,#,⊥,∥ Yu Liu,‡,∥ Qian Lu,‡ Rui Zhang,†,‡,#,⊥ Qian Wu,†,‡,#,⊥ Chunyan Li,‡ Junjun Li,†,‡,#,⊥ Xianghua Tang,†,‡,#,⊥ Bo Xu,†,‡,#,⊥ Junmei Ding,†,‡,#,⊥ Nanyu Han,†,‡,#,⊥ and Zunxi Huang*,†,‡,#,⊥ †

Engineering Research Center of Sustainable Development and Utilization of Biomass Energy, Ministry of Education, Yunnan Normal University, Kunming, Yunnan 650500, People’s Republic of China ‡ College of Life Sciences, Yunnan Normal University, Kunming, Yunnan 650500, People’s Republic of China # Key Laboratory of Yunnan for Biomass Energy and Biotechnology of Environment, Kunming, Yunnan 650500, People’s Republic of China ⊥ Key Laboratory of Enzyme Engineering, Yunnan Normal University, Kunming, Yunnan 650500, People’s Republic of China S Supporting Information *

ABSTRACT: α-Galactosidases are of great interest in various applications. A glycoside hydrolase family 27 α-galactosidase was cloned from Pontibacter sp. harbored in a saline soil and expressed in Escherichia coli. The purified recombinant enzyme (rAgaAHJ8) was little or not affected by 3.5−30.0% (w/v) NaCl, 10.0−100.0 mM Pb(CH3COO)2, 10.0−60.0 mM ZnSO4, or 8.3−100.0 mg mL−1 trypsin and by most metal ions and chemical reagents at 1.0 and 10.0 mM concentrations. The degree of synergy on enzymatic degradation of locust bean gum and guar gum by an endomannanase and rAgaAHJ8 was 1.22−1.54. In the presence of trypsin, the amount of reducing sugars released from soybean milk treated by rAgaAHJ8 was approximately 3.8-fold compared with that treated by a commercial α-galactosidase. rAgaAHJ8 showed transglycosylation activity when using sucrose, raffinose, and 3-methyl-1-butanol as the acceptors. Furthermore, potential factors for salt adaptation of the enzyme were presumed. KEYWORDS: α-galactosidase, salt tolerance, protease tolerance, transglycosylation, glycoside hydrolase family 27

■

been sequenced and many GH 27 α-galactosidases have been revealed from bacterial genomes in recent years. To date, the number of GH 27 α-galactosidases from bacteria is far more than that from eukaryota (www.cazy.org). However, we found that only three GH 27 α-galactosidases from bacteria have been characterized.8−10 Besides hydrolysis activity, transglycosylation activity has been detected for some α-galactosidases that are mainly distributed among fungi, plants, and Bifidobacterium strains.1,2,11−18 The donor is melibiose or p-nitrophenyl-α-Dgalactopyranoside or guar gum, and the acceptor can be a variety of sugars, sugar alcohols, or alcohols.1,2,11 Selfcondensation, one substrate serving as both glycosyl donor and acceptor, is commonly observed for α-galactosidases that have transglycosylation activity.1,2,11−18 The potential application of transglycosylation products is expected in the medicine, food, and feed industries,1,2,11,14,15,17 such as the use of galactosyl glycerol for the synthesis of new functional glycolipids2 and α-galactooligosaccharides, which are claimed to behave as dietary fibers and prebiotics.17 However, to the

INTRODUCTION α-Galactose is the constituent of short-chain α-galactooligosaccharides and the primary side chain of galactomannans, which are abundant in the plant endosperm and mature seed.1 α-Galactosidases are known as α-1,6-D-galactoside galactohydrolases or melibiases (EC 3.2.1.22) and catalyze the hydrolysis of α-1,6-linked galactoside moieties from α-galactooligosaccharides and polymeric galactomannans.1 α-Galactosidases are of great interest in various biotechnological applications. For example, α-galactosidases are used to improve the rheological property of guar gum,2 increase the yield of crystallized sugar,3 ameliorate pulp bleaching,4 enhance the nutritional value of animal feeds,5 remove the raffinose family oligosaccharides from soybean milk,6 and treat Fabry disease.7 An αgalactosidase that can tolerate NaCl and proteases is very attractive to the food industry because NaCl and proteases are extensively present or used in the industry. Glycoside hydrolases (GH) have been classified into 133 families on the basis of their amino acid sequences in the carbohydrate active enzyme (CAZy) database (www.cazy.org). Among the 133 families, GH 4, GH 27, GH 36, GH 57, GH 97, and GH 110 contain α-galactosidases. α-Galactosidases from eukaryota were previously grouped predominantly into GH 27, whereas those from bacteria were grouped primarily into GH 4, GH 36, GH 57, and GH 110.1 With the rapid development of genome sequencing technology, many bacterial genomes have © XXXX American Chemical Society

Received: January 30, 2016 Revised: March 4, 2016 Accepted: March 7, 2016

A

DOI: 10.1021/acs.jafc.6b00255 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

enzyme that releases 1 μmol of p-nitrophenol, glucose, or galactose per minute at 50 °C and pH 5.5. Biochemical Characterization. Biochemical characterization of the purified recombinant AgaAHJ8 (rAgaAHJ8) was determined using pNPGal as substrate unless otherwise noted. The effect of pH on rAgaAHJ8 was determined at 37 °C. Enzyme stability at pH 3.0−10.0 was estimated by measuring the residual enzyme activity after incubation of the enzyme in buffers of various pH values at 37 °C for 1 h. The buffers used were McIlvaine buffer for pH 3.0−8.0 and 0.1 M glycine−NaOH for pH 9.0−10.0. The optimal temperature for purified rAgaAHJ8 was determined using a range of 10−70 °C. The enzyme thermostability was determined after pre-incubation of the enzyme at 37 or 50 °C without substrate for various periods of time, and aliquots were removed at specific time points to measure residual enzyme activity under standard assay conditions (50 μL of αgalactosidase, 450 μL of 2.0 mM pNPGal, pH 5.5 McIlvaine buffer, 37 °C, 10 min; reaction was terminated by adding 2.0 mL of 1.0 M Na2CO3 and measured at 405 nm). Various metal ions and chemical reagents were individually added to the reaction solution to investigate their effects on rAgaAHJ8. Any precipitations were removed by centrifugation before the absorption was measured. To examine resistance to different proteases, 0.01 mg of purified rAgaAHJ8 was incubated at 37 °C for 1 h with 8.3−100.0 mg mL−1 trypsin (pH 7.2) and proteinase K (pH 7.2), and the residual activity was measured under standard assay conditions. Km, Vmax, and kcat values of purified rAgaAHJ8 were determined using 0.05−2.0 mM pNPGal or 2.9−36.5 mM melibiose as the substrate in McIlvaine buffer (pH 5.5) at 50 °C. The data were plotted according to the Michaelis−Menten method using the computer software GraphPad Prism (GraphPad Software, San Diego, CA, USA). Degradation of Locust Bean Gum and Guar Gum by the Combination of Mannanase and rAgaAHJ8. We previously studied a novel surfactant-, NaCl-, and protease-tolerant endomannanase rMan5HJ14 from Bacillus sp. HJ14 isolated from the saline soil.25 rMan5HJ14 exhibited apparent optimal activity at pH 6.5 and 65 °C and endoacting activity to locust bean gum and guar gum. To investigate the synergy between purified rMan5HJ14 and rAgaAHJ8, degradations of locust bean gum and guar gum were carried out as previously described26 with modification. Degradation reactions were performed at 37 °C and pH 6.0 (McIlvaine buffer). Reactions containing 500 μL of 0.5% (w/v) locust bean gum or guar gum and either rMan5HJ14 (0.30 U) or rAgaAHJ8 (0.15 U) or both enzymes were incubated for 10 min, boiled for 5 min, and then incubated under the same conditions for another 10 min. Sequential addition of rMan5HJ14 and rAgaAHJ8 was performed as follows: the initial reaction mixture containing rMan5HJ14 alone was incubated for 10 min; the reaction was boiled for 5 min to inactivate the enzyme and then cooled to 37 °C; rAgaAHJ8 was then added to the reaction and incubated under the same conditions for another 10 min. Control experiments were performed using heat-inactivated rAgaAHJ8 (100 °C, 5 min). Released reducing sugars in the mixture were measured using the DNS method. Each reaction and its control were run in triplicate. Hydrolysis of Oligosaccharides in Soybean Milk. Fresh soybean milk was purchased from a local market. Hydrolysis reactions were performed at 37 °C for 1 and 24 h at the natural pH (6.75) of soybean milk. Reactions contained 1.0 mL of soybean milk and purified rAgaAHJ8 (0.2 U) or the commercial α-galactosidase QBSAga from Kunming Qactive Bio-Science (Kunming, China; 0.2 U) alone or in combination with trypsin (trypsin/α-galactosidase = 1:10, w/w). Control experiments were performed using heat-inactivated rAgaAHJ8 (100 °C, 5 min). The release of reducing sugars was determined using the DNS method. Any precipitations were removed by centrifugation before the absorption was measured. Transglycosylation Reactions. Self-condensation reactions were carried out using 40 mM pNPGal or 400 mM Mel, Raf, or Sta as the substrate serving as both glycosyl donor and acceptor. Transglycosylation reactions were performed using 40 mM pNPGal as the donor with 400 mM acceptors including various monosaccharides, oligosaccharides, sugar alcohols, and alcohols. Monosaccharides

best of our knowledge, the transglycosylation activity for Pontibacter α-galactosidase has not been reported. The town of Heijing, well-known as the “town of salt” in Yunnan province, China, is a town on the famous “Silk Route of the South”.19 We previously sampled saline soil from an abandoned salt mine located in the town and reported a salttolerant xylanase from bacteria isolated from the saline soil.19 In this study, a novel GH 27 α-galactosidase, designated AgaAHJ8, was discovered from Pontibacter sp. HJ8 harbored in the same saline soil and expressed in Escherichia coli. Molecular and biochemical characterizations of the α-galactosidase were made.

■

MATERIALS AND METHODS

Vectors and Reagents. E. coli BL21 (DE3) and pEASY-E2 vector (TransGen, Beijing, China) were used for gene expression. pNitrophenyl-α-D-galactopyranoside (pNPGal) was purchased from Apollo Scientific Limited (Cheshire, UK). p-Nitrophenol, D-galactose (Gal), D-glucose (Glc), D-mannose (Man), L-sorbose (Sor), D-fructose (Fru), D-xylose (Xyl), α-lactose (Lac), sucrose (Suc), mannitol (Mant), sorbitol (Sort), locust bean gum from Ceratonia siliqua seeds, and guar gum were purchased from Sigma-Aldrich (St. Louis, MO, USA). Stachyose (Sta) was purchased from Tokyo Chemical Industry (Tokyo, Japan). Melibiose (Mel) was purchased from Wako (Osaka, Japan). A glucose kit was purchased from Rsbio (Shanghai, China). All chemicals were of analytical grade. Strain. The details of strain isolation and identification were described in our previous study.19 The pure culture was deposited in the Strains Collection of the Yunnan Institute of Microbiology under registration no. YMF 4.00008. Genome Sequencing. The genome of HJ8 was sequenced on a Miseq sequencer (Illumina), and genomic data were analyzed on an NF supercomputing server (Inspur, Shandong, China) in our laboratory. Other details are as described in our previous study.20 Sequence and Structure Analyses. Open reading frames from the draft genome of HJ8 were predicted as previously described.20 The signal peptide and catalytic domain were predicted by SignalP (http:// www.cbs.dtu.dk/services/SignalP/) and InterPro online tool (http:// www.ebi.ac.uk/interpro/), respectively. Tertiary structures of GH 27 α-galactosidase were predicted by homology modeling using SwissModel (http://swissmodel.expasy. org/). Salt bridges (distances ≤ 4 Å) and total accessible surface area (ASA) were predicted with VMD21 and VADAR,22 respectively. The Discovery Studio 2.5 was used to predict the charge distributions on the surfaces of tertiary structures (Accelrys, San Diego, CA, USA). Heterologous Expression of α-Galactosidase. The AgaAHJ8encoding gene (agaAHJ8) was partially amplified (without the signal peptide-encoding sequence) by PCR using the primer sets ragaAHJ8EF (CAACAGAAGGCATCCCTTGCCCCC) and ragaAHJ8ER (GATCTTTTTGAGGCGGAAAAGCTTTG). The recombinant plasmid, designated pEASY-agaAHJ8, was constructed with agaAHJ8 and pEASY-E2 vectors (the C-terminal His-tag remaining) and transformed into E. coli BL21 (DE3) competent cells. Enzyme expression was induced as previously described.23 Purification and Identification of Recombinant Enzyme. E. coli cells were harvested and disrupted as previously described.23 The recombinant enzyme was purified by immobilized metal ion affinity chromatography. The purity of eluted fractions was evaluated by sodium dodecyl sulfate−polyacrylamide gel electrophoresis (SDSPAGE). The purified protein in the gel was identified using matrixassisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) performed by Tianjin Biochip (Tianjin, China). The protein concentration was determined with the Bradford method using bovine serum albumin as the standard. Enzyme Assay and Substrate Specificity. α-Galactosidase activity was determined using different methods including the pNPGal method, the glucose oxidase peroxidase method, and the DNS method depending on the substrate used. These methods have been previously described.24 One unit of α-galactosidase was defined as the amount of B

DOI: 10.1021/acs.jafc.6b00255 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Table 1. Frequencies of Amino Acid Residues and Structural Property of GH 27 α-Galactosidases frequency (%)

a

α-galactosidase (accession no.)

acidic D and E

basic K and R

C

identity with 1UAS (%)

total ASAa (103 Å2)

salt bridge (60 min. At 50 °C, the half-life of the enzyme was approximately 5 min (Figure 3D). Purified rAgaAHJ8 exhibited good salt tolerance. The addition of most metal ions and chemical reagents at 1.0 and 10.0 mM or 0.5 and 1.0% (v/v) final concentration showed little or no effect (retaining 83.7−107.4% activity) on the enzyme activity (Table 2). In the presence of some metal ions

with high final concentration, purified rAgaAHJ8 was still active. The enzyme showed >71.5% activity when 10.0−100.0 mM Pb(CH3COO)2, 10.0−60.0 mM ZnSO4, 10.0−200.0 mM NaCH3COO, or Na2SO4 was added to the standard reaction system (Figure 3E,F). In the presence of 3.5−30.0% (w/v) NaCl, the enzyme showed 70.3−90.5% activity (Figure 3G). However, the activity of purified rAgaAHJ8 was completely inhibited by HgCl2, AgNO3, and SDS and inhibited by 120.0− 200.0 mM Pb(CH3COO)2 (retaining 19.7−39.3% activity) and 80.0−200.0 mM ZnSO4 (retaining 25.9−54.2% activity; Table 2; Figure 3E,F). Purified rAgaAHJ8 was strongly resistant to trypsin digestion; nearly no activity was lost after incubation with 8.3−100.0 mg mL−1 trypsin at 37 °C for 60 min (pH 7.2; Figure 3H). Meanwhile, the enzyme retained 53.5−71.1% of its E

DOI: 10.1021/acs.jafc.6b00255 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Hydrolysis of Oligosaccharides in Soybean Milk. The hydrolytic abilities of rAgaAHJ8 and the commercial αgalactosidase QBS-Aga to fresh soybean milk are shown in Table 4. When α-galactosidase was used in the absence of

Table 2. Effects of Metal Ions and Chemical Reagents on the α-Galactosidase Activity of Purified rAgaAHJ8 relative activitya (%) substance

1.0 mM

none KCl MgSO4 NiSO4 CoCl2 CuSO4 MnSO4 CaCl2 FeSO4 AgNO3 HgCl2 Triton X-100 Tween 80 EDTA β-mercaptoethanol SDS

100.0 95.5 94.4 94.0 93.7 93.1 92.4 91.0 90.3 0.0 0.0 93.7 92.4 86.1 83.7 0.0

± ± ± ± ± ± ± ± ±

3.2 0.7 3.0 1.0 0.9 2.5 5.9 5.1 0.6

± ± ± ±

3.1b 3.2b 1.5 6.1

10.0 mM 100.0 98.8 100.0 98.4 100.8 100.8 100.0 101.0 100.9 0.0 0.0 104.5 107.4 101.6 98.6 0.0

± ± ± ± ± ± ± ± ±

3.2 2.9 1.4 4.4 2.1 2.8 1.4 7.3 3.2

Table 4. Hydrolysis of Oligosaccharides in Soybean Milk by Purified rAgaAHJ8 or the Commercial α-Galactosidase QBSAga from Kunming Qactive Bio-Science (Kunming, China)

± ± ± ±

7.0c 5.1c 2.5 1.2

trypsin for 1 and 24 h, the amounts of reducing sugars released from soybean milk treated by QBS-Aga were greater than those after treatment by rAgaAHJ8. However, the hydrolytic ability of QBS-Aga to soybean milk was strongly inhibited by trypsin. The amounts of reducing sugars released from soybean milk by QBS-Aga were around 0.23 μmol for 1 and 24 h treatments in the presence of trypsin, which are much lower than the values in the absence of trypsin (0.52 and 0.89 μmol for 1 and 24 h treatments, respectively). As a result, the amount of reducing sugars released from soybean milk treated by rAgaAHJ8 for 24 h (0.87 μmol) was approximately 3.8-fold compared with that treated by QBS-Aga when α-galactosidase was used in combination with trypsin. Transglycosylation Activity. Self-condensation activity of purified rAgaAHJ8 was not detected when 40 mM pNPGal or 400 mM Mel, Raf, or Sta was used as the substrate. With 40 mM pNPGal as the donor, purified rAgaAHJ8 did not transfer the galactosyl moiety of pNPGal to most substrates tested in this study except Suc, Raf, and mBuOH (Figure 4A). Purified rAgaAHJ8 transferred one or two galactosyl moieties of pNPGal to Suc and mBuOH, and the enzyme transferred one or two or three galactosyl moieties of pNPGal to Raf (Figure 4C). In addition, rAgaAHJ8 showed transglycosylation activity when 40 mM pNPGal was used as the donor with 20 and 40 mM Suc and mBuOH as the acceptors. However, no transglycosylation product was observed when the substrate was 20 or 40 mM Raf (Figure 4B). Characterization of Mutants. The predicted catalytic residues D148 and D206 were successfully mutated to be lysines. The mutated enzymes were individually purified (Figure 2B), but their α-galactosidase activities were not detected. The result suggests that D148 and D206 are the catalytic residues for AgaAHJ8.

reducing sugar (μmol)

Values represent the means ± SD (n = 3) relative to the untreated control samples. bFinal concentration = 0.5% (w/v). cFinal concentration = 1.0% (w/v).

a

initial activity after 8.3−100.0 mg mL−1 proteinase K digestion at 37 °C for 60 min (pH 7.2; Figure 3H). Determined at pH 5.5 and 50 °C, the specific activities of purified rAgaAHJ8 toward substrates of 2.0 mM pNPGal and 0.5% (w/v) melibiose and raffinose were 43.5 ± 1.0, 0.47 ± 0.07, and 1.93 ± 0.07 U mg−1, respectively. However, no activity of rAgaAHJ8 was detected toward locust bean gum or guar gum. The kinetic parameters of purified rAgaAHJ8 were determined at pH 5.5 and 50 °C. Toward pNPGal, the Km, Vmax, and kcat values of the enzyme were 0.93 ± 0.08 mM, 68.7 ± 2.8 μmol min−1 mg−1, and 51.5 ± 2.1 s−1, respectively. Toward melibiose, the Km, Vmax, and kcat values of the enzyme were 17.3 ± 1.1 mM, 1.01 ± 0.03 μmol min−1 mg−1, and 0.76 ± 0.02 s−1, respectively. Synergistic Action. As shown in Table 3, purified rAgaAHJ8 did not hydrolyze locust bean gum or guar gum alone. However, simultaneous addition of rMan5HJ14 and rAgaAHJ8 increased locust bean gum and guar gum degradation by 1.22- and 1.30-fold, respectively, compared with the sum of the activities of each enzyme separately. In addition, sequential addition of rMan5HJ14 and rAgaAHJ8 also increased locust bean gum and guar gum degradation by 1.25and 1.54-fold, respectively.

enzyme

1h

24 h

rAgaAHJ8 rAgaAHJ8 with trypsin QBS-Aga QBS-Aga with trypsin

0.35 0.30 0.52 0.22

0.79 0.87 0.89 0.23

Table 3. Synergy between rMan5HJ14 and rAgaAHJ8 for Degradation of Locust Bean Gum and Guar Gum order of enzyme addition and reaction time first enzyme rAgaAHJ8 rMan5HJ14 rAgaAHJ8/rMan5HJ14 rMan5HJ14

time (min) 10 10 10 10

second enzyme no no no rAgaAHJ8

reducing sugar (μmol) time (min)

locust bean gum b

10 10 10 10

ND 1.31 ± 0.08 1.60 ± 0.21 1.64 ± 0.04

degree of synergy (fold increase in activity)a

guar gum

locust bean gum

guar gum

ND 0.87 ± 0.05 1.13 ± 0.08 1.33 ± 0.14

1.00 1.22 1.25

1.00 1.30 1.54

a These values were calculated as the ratio between the activity of both enzymes and the sum of the activities of each enzyme separately. bND, not detected.

F

DOI: 10.1021/acs.jafc.6b00255 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 4. Analyses of transglycosylation products: TLC analyses of transglycosylation products catalyzed by rAgaAHJ8 using 400 mM (A) or 20 and 40 mM (B) acceptors; (C) electrospray ionization mass spectra of transglycosylation products. Arrows indicate transglycosylation products. Lanes CK-X and S-X represent control and experimental groups, respectively, and X represents raffinose (Raf), sucrose (Suc), or 3-methyl-1-butanol (mBuOH); 20 and 40 represent 20 and 40 mM acceptors, respectively; XT represents the transglycosylation product from X. pNPGal, p-nitrophenylα-D-galactopyranoside; Gal, D-galactose; Glc, D-glucose; Mel, melibiose; Sta, stachyose.

■

cillus sp. A4,13 Ruminococcus gnavus E1,34 and Aspergillus nidulans FGSC;17 acceptors at 250 mM for α-galactosidase from T. leycettanus JCM12802;12 acceptors at 600 mM or 10% (w/v) for α-galactosidase from Candida guilliermondii H-404;35 and 40% (w/v) melibiose was used for self-condensation reaction of α-galactosidase from Bifidobacterium bifidum NCIMB 41171.14 However, rAgaAHJ8 can show transglycosylation activity when 20 and 40 mM Suc and mBuOH are used as the acceptors. Like rAgaAHJ8, transglycosylation activities were observed with acceptor at low concentrations for α-galactosidases from T. reesei36 and Penicillium oxalicum SO.11 Among the 20 acceptors tested in this study, only 3 were useful for transglycosylation of rAgaAHJ8. The enzyme demonstrated a narrower acceptor specificity than α-galactosidases from Alicyclobacillus sp. A4, 13 R. gnavus E1, 34 C. guilliermondii H-404,35 and P. oxalicum SO.11 Furthermore, mBuOH has not been characterized as a transglycosylation acceptor for previously reported α-galactosidases. The activity of transglycosylation to mBuOH is a unique characteristic of rAgaAHJ8. Alkyl-glycosides are nonionic surfactants distinguished by unique properties because they possess high surface activity, low toxicity, and good biocompatibility that provide a wide range of possibilities for usage in food, particularly in emulsified products such as mayonnaise and margarine.37 Their

DISCUSSION

Pontibacter, a bacterial genus, is poorly understood.32 Studies on the isolation and classification of Pontibacter strains have mostly been reported, such as the novel Pontibacter species from the Kutch Desert.33 However, to our knowledge, studies on other respects of Pontibacter strains have rarely been reported. For example, enzymes from Pontibacter strains have not been characterized for function. Although the genome sequence of Pontibacter korlensis X14-1 has been public and showed diverse glycoside hydrolases,32 GH 27 α-galactosidases from Pontibacter strains have not been found in available literature and databases to date. In this study, the low identities (≤97.0%) resulting from 16S rDNA sequence comparison suggest Pontibacter sp. HJ8 is a potential novel species. Furthermore, characterization of the GH 27 α-galactosidase from HJ8 reveals the novel enzyme properties including salt− protease tolerance and transglycosylation activity. Transglycosylation activity has not been reported for the three GH 27 α-galactosidases from bacteria.8−10 For most GH 27 and GH 36 α-galactosidases showing transglycosylation activity, transglycosylation reactions occur at high acceptor concentrations. For example, acceptors at 400 mM are used for transglycosylation activities of α-galactosidases from AlicyclobaG

DOI: 10.1021/acs.jafc.6b00255 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

rarely been reported.12,26,49 The α-galactosidase from Bispora sp. MEY-1 is tolerant to 1, 5, and 10 mM Pb2+.26 The αgalactosidase from T. leycettanus JCM12802 is tolerant to both Pb2+ and Zn2+ at the concentration of 5 mM.12 Addition of 5 mM Pb2+ has no effect on the enzyme activity of two αgalactosidases rGal27A and rGal27B from Neosartorya fischeri P1, but 5 mM Zn2+ inhibited rGal27B activity.49 In the presence of 10−100 mM Pb2+ or 10−60 mM Zn2+, purified rAgaAHJ8 showed >71.5% activity. However, to the best of our knowledge, all GH 27 α-galactosidases (including rAgaAHJ8) are drastically inhibited by Ag+ and Hg2+. Because Ag+, Hg2+, Zn2+, and Pb2+ can react irreversibly with sulfhydryl groups or bind irreversibly with the main polypeptide chain, the lead− zinc tolerance of α-galactosidases may be interesting, but the mechanism behind this tolerance requires further study to clarify. Furthermore, soybean products, such as soybean milk and soybean meal, are widely used as food and feed.5,6,50 The raffinose family oligosaccharides in soybean products are the major drawback to nutrient utilization and even lead to flatulence.5,6,50 It is well-known that endogenous proteases (such as trypsin) are widely found in animals. Addition of exogenous proteases can improve digestibility.5,6,50 Thus, tolerance to proteases can enhance the potential of αgalactosidases used in food and animal feed.5,6,50 In this study, the enzyme showed better performance than the commercial QBS-Aga in hydrolyzing oligosaccharides in soybean milk in the presence of trypsin. In conclusion, this study reported the gene cloning, expression, and molecular and biochemical characterizations of a bacterial GH 27 α-galactosidase. The recombinant enzyme exhibited novel salt−protease tolerance and transglycosylation activity and showed better performance than a commercial αgalactosidase on hydrolyzing oligosaccharides in soybean milk in the presence of trypsin. Synergistic action of the αgalactosidase with an endomannanase for enzymatic degradation of locust bean gum and guar gum was observed. These excellent properties may enable the enzyme to have great potential in the food and feed industries. In addition, high proportions of acidic and basic amino acid residues but low cysteine residues and solvent accessibility are presumed to be involved in the salt tolerance of the enzyme.

application in the chemical and pharmaceutical industries as surface active agents also seems very promising.37 α-GalactosylmBuOH might be a potential candidate for these applications. rAgaAHJ8 exhibited good salt tolerance, especially the tolerance to sodium, lead, and zinc salts, which has not been reported among the published studies on GH 27 αgalactosidases to date. The potential of salt-tolerant enzymes is their use in food processing, biosynthetic processes, and other harsh industrial processes requiring high salt concentrations,19,38−42 such as soy sauce production by liquid fermentation under high NaCl concentration (18−20%).43 Fermentation and material processing under high NaCl concentration can also reduce the total cost because the sterilization process is not necessary.19,38−42 Because galactomannans are abundant in the mature seeds of leguminous plants1 and efficient degradation of galactomannans by the synergistic interactions of an endomannanase and rAgaAHJ8 was observed, the potential application of rAgaAHJ8 in the food industry may be very promising, especially in the soy sauce production by liquid fermentation under high NaCl concentration. Compared with salt-affected counterparts, the commonly observed salt-tolerant enzymes possess fewer cysteine residues and lower solvent accessibility but a higher proportion of acidic amino acid residues.39−42,44−46 As shown in Table 1, AgaAHJ8 possesses fewer cysteine residues and lower solvent accessibility but a higher proportion of acidic amino acid residues than most GH 27 α-galactosidases. It is argued that specific interactions between salt ions, water molecules, and the polypeptides will intervene in the solubility of enzymes and then affect the salt tolerance of enzymes.46 Over-representation of acidic residues can result in large negatively charged surface and finally enhance the binding capacity of enzymes to water and salt ions.39−42,44−46 As shown in Figure 1, the negatively charged surface of AgaAHJ8 was not smaller than α-Gal (1UAS) and αGalTr (ISZN). However, the NaCl-tolerant α-amylase isolated from Halothermothrix orenii lacks the conserved acidic surface,47 and E267R mutation of the malate dehydrogenase from Haloarcula marismortui does not affect NaCl-dependent catalytic activity of the enzyme.48 The study on the malate dehydrogenase further indicates that the enzyme appears to be stabilized by not only ordered water molecule networks but also salt bridge networks, which can recruit solvent chloride and sodium ions.48 It is well-known that salt bridges are formed by acidic carboxyl groups and basic amino groups. Compared with GH 27 α-galactosidases from various organisms listed in Table 1, the total frequency of basic amino acid residues (K and R) of AgaAHJ8 is strikingly higher. These basic amino acid residues of AgaAHJ8 result in strikingly more salt bridges and larger positively charged surface than GH 27 α-galactosidases shown in Table 1 and Figure 1. Accordingly, high proportions of both acidic and basic amino acid residues may help AgaAHJ8 bind water molecules and form salt bridges to harness the high ionic concentration in the environment. As discussed above, high proportions of acidic and basic amino acid residues but low cysteine residues and solvent accessibility are presumed to be involved in the salt tolerance of the GH 27 α-galactosidase AgaAHJ8. Although Pb2+ is one of the heavy metal ions and inhibited the activity of some GH 36 α-galactosidases, our previous study found that several GH 36 α-galactosidases are tolerant to Pb2+ or even enhanced 12.4-fold by Pb2+.23 Unlike GH 36 αgalactosidases, the effect of Pb2+ to GH 27 α-galactosidases has

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jafc.6b00255. Nucleotide sequences cloned in the study; Table S1 shows the purification of rAgaAHJ8 expressed in E. coli; Figure S1 shows the partial amino acid sequence alignment; Figure S2 shows the MALDI-TOF MS spectrum (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*(Z.H.) Mail: College of Life Sciences, Yunnan Normal University, No. 1 Yuhua District, Chenggong, Kunming, Yunnan 650500, People’s Republic of China. Phone: +86 871 65920830. Fax: +86 871 65920952. E-mail: huangzunxi@163. com. Author Contributions ∥

H

J.Z. and Y.L. contributed equally to this work. DOI: 10.1021/acs.jafc.6b00255 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Funding

synthesizing Gal-α-1,4 linkage. FEMS Microbiol. Lett. 2008, 285, 278− 283. (16) Shabalin, K. A.; Kulminskaya, A. A.; Savel’ev, A. N.; Shishlyannikov, S. M.; Neustroev, K. N. Enzymatic properties of αgalactosidase from Trichoderma reesei in the hydrolysis of galactooligosaccharides. Enzyme Microb. Technol. 2002, 30, 231−239. (17) Nakai, H.; Baumann, M. J.; Petersen, B. O.; Westphal, Y.; Abou Hachem, M.; Dilokpimol, A.; Duus, J. O.; Schols, H. A.; Svensson, B. Aspergillus nidulans α-galactosidase of glycoside hydrolase family 36 catalyses the formation of α-galacto-oligosaccharides by transglycosylation. FEBS J. 2010, 277, 3538−3551. (18) Shivam, K.; Mishra, S. K. Purification and characterization of a thermostable α-galactosidase with transglycosylation activity from Aspergillus parasiticus MTCC-2796. Process Biochem. 2010, 45, 1088− 1093. (19) Zhou, J. P.; Gao, Y. J.; Dong, Y. Y.; Tang, X. H.; Li, J. J.; Xu, B.; Mu, Y. L.; Wu, Q.; Huang, Z. X. A novel xylanase with tolerance to ethanol, salt, protease, SDS, heat, and alkali from actinomycete Lechevalieria sp. HJ3. J. Ind. Microbiol. Biotechnol. 2012, 39, 965−975. (20) Zhou, J. P.; Shen, J. D.; Zhang, R.; Tang, X. H.; Li, J. J.; Xu, B.; Ding, J. M.; Gao, Y. J.; Xu, D. Y.; Huang, Z. X. Molecular and biochemical characterization of a novel multidomain xylanase from Arthrobacter sp. GN16 isolated from the feces of Grus nigricollis. Appl. Biochem. Biotechnol. 2015, 175, 573−588. (21) Humphrey, W.; Dalke, A.; Schulten, K. VMD: visual molecular dynamics. J. Mol. Graphics 1996, 14, 33−38. (22) Willard, L.; Ranjan, A.; Zhang, H. Y.; Monzavi, H.; Boyko, R. F.; Sykes, B. D.; Wishart, D. S. VADAR: a web server for quantitative evaluation of protein structure quality. Nucleic Acids Res. 2003, 31, 3316−3319. (23) Zhou, J. P.; Lu, Q.; Zhang, R.; Wang, Y. Y.; Wu, Q.; Li, J. J.; Tang, X. H.; Xu, B.; Ding, J. M.; Huang, Z. X. Characterization of two glycoside hydrolase family 36 α-galactosidases: novel transglycosylation activity, lead−zinc tolerance, alkaline and multiple pH optima, and low-temperature activity. Food Chem. 2016, 194, 156−166. (24) Zhou, J. P.; Shi, P. J.; Huang, H. Q.; Cao, Y. N.; Meng, K.; Yang, P. L.; Zhang, R.; Chen, X. Y.; Yao, B. A new α-galactosidase from symbiotic Flavobacterium sp. TN17 reveals four residues essential for α-galactosidase activity of gastrointestinal bacteria. Appl. Microbiol. Biotechnol. 2010, 88, 1297−1309. (25) Zhang, R.; Song, Z. F.; Wu, Q.; Zhou, J. P.; Li, J. J.; Mu, Y. L.; Tang, X. H.; Xu, B.; Ding, J. M.; Deng, S. C.; Huang, Z. X. A novel surfactant-, NaCl-, and protease-tolerant β-mannanase from Bacillus sp. HJ14. Folia Microbiol. 2015, DOI: 10.1007/s12223-015-0430-y. (26) Wang, H.; Luo, H. Y.; Li, J. A.; Bai, Y. G.; Huang, H. G.; Shi, P. J.; Fan, Y. L.; Yao, B. An α-galactosidase from an acidophilic Bispora sp. MEY-1 strain acts synergistically with β-mannanase. Bioresour. Technol. 2010, 101, 8376−8382. (27) Fujimoto, Z.; Kaneko, S.; Momma, M.; Kobayashi, H.; Mizuno, H. Crystal structure of rice α-galactosidase complexed with Dgalactose. J. Biol. Chem. 2003, 278, 20313−20318. (28) Zhu, A.; Goldstein, J. Cloning and functional expression of a cDNA encoding coffee bean α-galactosidase. Gene 1994, 140, 227− 231. (29) Gurkok, S.; Soyler, B.; Biely, P.; Ogel, Z. B. Cloning and heterologous expression of the extracellular α-galactosidase from Aspergillus f umigatus in Aspergillus sojae under the control of gpdA promoter. J. Mol. Catal. B: Enzym. 2010, 64, 146−149. (30) Denherder, I. F.; Rosell, A. M. M.; Vanzuilen, C. M.; Punt, P. J.; Vandenhondel, A. Cloning and expression of a member of the Aspergillus niger gene family encoding α-galactosidase. Mol. Gen. Genet. 1992, 233, 404−410. (31) Golubev, A. M.; Nagem, R. A. P.; Neto, J. R. B.; Neustroev, K. N.; Eneyskaya, E. V.; Kulminskaya, A. A.; Shabalin, K. A.; Savel’ev, A. N.; Polikarpov, I. Crystal structure of α-galactosidase from Trichoderma reesei and its complex with galactose: implications for catalytic mechanism. J. Mol. Biol. 2004, 339, 413−422. (32) Dai, J.; Dai, W. K.; Qiu, C. Z.; Yang, Z. Y.; Zhang, Y.; Zhou, M. Z.; Zhang, L.; Fang, C. X.; Gao, Q.; Yang, Q.; Li, X.; Wang, Z.; Wang,

This work was supported by the National Natural Science Foundation of China (No. 31260215), the Reserve Talents Project for Young and Middle-Aged Academic and Technical Leaders of Yunnan Province (No. 2015HB033), and the Applied and Basic Research Foundation of Yunnan Province (No. 2013FZ045 and 201401PC00224). Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Weignerova, L.; Simerska, P.; Kren, V. α-Galactosidases and their applications in biotransformations. Biocatal. Biotransform. 2009, 27, 79−89. (2) Kurakake, M.; Okumura, T.; Morimoto, Y. Synthesis of galactosyl glycerol from guar gum by transglycosylation of α-galactosidase from Aspergillus sp. MK14. Food Chem. 2015, 172, 150−154. (3) Ganter, C.; Bock, A.; Buckel, P.; Mattes, R. Production of thermostable, recombinant α-galactosidase suitable for raffinose elimination from sugar beet syrup. J. Biotechnol. 1988, 8, 301−310. (4) Clarke, J. H.; Davidson, K.; Rixon, J. E.; Halstead, J. R.; Fransen, M. P.; Gilbert, H. J.; Hazlewood, G. P. A comparison of enzyme-aided bleaching of softwood paper pulp using combinations of xylanase, mannanase and α-galactosidase. Appl. Microbiol. Biotechnol. 2000, 53, 661−667. (5) Ghazi, S.; Rooke, J. A.; Galbraith, H. Improvement of the nutritive value of soybean meal by protease and α-galactosidase treatment in broiler cockerels and broiler chicks. Br. Poult. Sci. 2003, 44, 410−418. (6) Cao, Y. N.; Yuan, T. Z.; Shi, P. J.; Luo, H. Y.; Li, N.; Meng, K.; Bai, Y. G.; Yang, P. L.; Zhou, Z. G.; Zhang, Z. F.; Yao, B. Properties of a novel α-galactosidase from Streptomyces sp. S27 and its potential for soybean processing. Enzyme Microb. Technol. 2010, 47, 305−312. (7) Germain, D. P.; Charrow, J.; Desnick, R. J.; Guffon, N.; Kempf, J.; Lachmann, R. H.; Lemay, R.; Linthorst, G. E.; Packman, S.; Scott, C. R.; Waldek, S.; Warnock, D. G.; Weinreb, N. J.; Wilcox, W. R. Tenyear outcome of enzyme replacement therapy with agalsidase beta in patients with Fabry disease. J. Med. Genet. 2015, 52, 353−358. (8) Post, D. A.; Luebke, V. E. Purification, cloning, and properties of α-galactosidase from Saccharopolyspora erythraea and its use as a reporter system. Appl. Microbiol. Biotechnol. 2005, 67, 91−96. (9) Halstead, J. R.; Fransen, M. P.; Eberhart, R. Y.; Park, A. J.; Gilbert, H. J.; Hazlewood, G. P. α-Galactosidase A from Pseudomonas f luorescens subsp. cellulosa: cloning, high level expression and its role in galactomannan hydrolysis. FEMS Microbiol. Lett. 2000, 192, 197−203. (10) Jindou, S.; Karita, S.; Fujino, E.; Fujino, T.; Hayashi, H.; Kimura, T.; Sakka, K.; Ohmiya, K. α-Galactosidase Aga27A, an enzymatic component of the Clostridium josui cellulosome. J. Bacteriol. 2002, 184, 600−604. (11) Kurakake, M.; Moriyama, Y.; Sunouchi, R.; Nakatani, S. Enzymatic properties and transglycosylation of α-galactosidase from Penicillium oxalicum SO. Food Chem. 2011, 126, 177−182. (12) Wang, C. H.; Wang, H. M.; Ma, R.; Shi, P. J.; Niu, C. F.; Luo, H. Y.; Yang, P. L.; Yao, B. Biochemical characterization of a novel thermophilic α-galactosidase from Talaromyces leycettanus JCM12802 with significant transglycosylation activity. J. Biosci. Bioeng. 2016, 121, 7. (13) Wang, H. M.; Ma, R.; Shi, P. J.; Xue, X. L.; Luo, H. Y.; Huang, H. Q.; Bai, Y. G.; Yang, P. L.; Yao, B. A new α-galactosidase from thermoacidophilic Alicyclobacillus sp. A4 with wide acceptor specificity for transglycosylation. Appl. Biochem. Biotechnol. 2014, 174, 328−338. (14) Goulas, T.; Goulas, A.; Tzortzis, G.; Gibson, G. A novel αgalactosidase from Bif idobacterium bifidum with transgalactosylating properties: gene molecular cloning and heterologous expression. Appl. Microbiol. Biotechnol. 2009, 82, 471−477. (15) Zhao, H.; Lu, L. L.; Xiao, M.; Wang, Q. P.; Lu, Y.; Liu, C. H.; Wang, P.; Kumagai, H.; Yamamoto, K. Cloning and characterization of a novel α-galactosidase from Bif idobacterium breve 203 capable of I

DOI: 10.1021/acs.jafc.6b00255 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Z. Y.; Jia, Z. H.; Chen, X. Unraveling adaptation of Pontibacter korlensis to radiation and infertility in desert through complete genome and comparative transcriptomic analysis. Sci. Rep. 2015, 5, 10929. (33) Subhash, Y.; Sasikala, C.; Ramana, C. V. Pontibacter ruber sp. nov. and Pontibacter deserti sp. nov., isolated from the desert. Int. J. Syst. Evol. Microbiol. 2014, 64, 1006−1011. (34) Cervera-Tison, M.; Tailford, L. E.; Fuell, C.; Bruel, L.; Sulzenbacher, G.; Henrissat, B.; Berrin, J. G.; Fons, M.; Giardina, T.; Juge, N. Functional analysis of family GH36 α-galactosidases from Ruminococcus gnavus E1: insights into the metabolism of a plant oligosaccharide by a human gut symbiont. Appl. Environ. Microb. 2012, 78, 7720−7732. (35) Hashimoto, H.; Katayama, C.; Goto, M.; Okinaga, T.; Kitahata, S. Transgalactosylation catalyzed by α-galactosidase from Candida guilliermondii H-404. Biosci., Biotechnol., Biochem. 1995, 59, 619−623. (36) Eneyskaya, E. V.; Golubev, A. M.; Kachurin, A. M.; Savel’ev, A. N.; Neustroev, K. N. Transglycosylation activity of α-D-galactosidase from Trichoderma reesei − an investigation of the active site. Carbohydr. Res. 1997, 305, 83−91. (37) Mladenoska, I.; Winkelhausen, E.; Kuzmanova, S. Transgalactosylation/hydrolysis ratios of various β-galactosidases catalyzing alkyl-β-galactoside synthesis in single-phased alcohol media. Food Technol. Biotechnol. 2008, 46, 311−316. (38) Margesin, R.; Schinner, F. Potential of halotolerant and halophilic microorganisms for biotechnology. Extremophiles 2001, 5, 73−83. (39) Liu, X. S.; Huang, Z. Q.; Zhang, X. N.; Shao, Z. Z.; Liu, Z. D. Cloning, expression and characterization of a novel cold-active and halophilic xylanase from Zunongwangia prof unda. Extremophiles 2014, 18, 441−450. (40) Warden, A. C.; Williams, M.; Peat, T. S.; Seabrook, S. A.; Newman, J.; Dojchinov, G.; Haritos, V. S. Rational engineering of a mesohalophilic carbonic anhydrase to an extreme halotolerant biocatalyst. Nat. Commun. 2015, 6, 10278. (41) Qin, Y. J.; Huang, Z. Q.; Liu, Z. D. A novel cold-active and salttolerant α-amylase from marine bacterium Zunongwangia prof unda: molecular cloning, heterologous expression and biochemical characterization. Extremophiles 2014, 18, 271−281. (42) Shi, R. R.; Li, Z. M.; Ye, Q.; Xu, J. H.; Liu, Y. Heterologous expression and characterization of a novel thermo-halotolerant endoglucanase Cel5H from Dictyoglomus thermophilum. Bioresour. Technol. 2013, 142, 338−344. (43) Luh, B. S. Industrial production of soy sauce. J. Ind. Microbiol. 1995, 14, 467−471. (44) Paul, S.; Bag, S. K.; Das, S.; Harvill, E. T.; Dutta, C. Molecular signature of hypersaline adaptation: insights from genome and proteome composition of halophilic prokaryotes. Genome Biol. 2008, 9, R70. (45) Premkumar, L.; Greenblatt, H. M.; Bageshwar, U. K.; Savchenko, T.; Gokhman, I.; Sussman, J. L.; Zamir, A. Threedimensional structure of a halotolerant algal carbonic anhydrase predicts halotolerance of a mammalian homolog. Proc. Natl. Acad. Sci. U. S. A. 2005, 102, 7493−7498. (46) Madern, D.; Ebel, C.; Zaccai, G. Halophilic adaptation of enzymes. Extremophiles 2000, 4, 91−98. (47) Sivakumar, N.; Li, N.; Tang, J. W.; Patel, B. K. C.; Swaminathan, K. Crystal structure of AmyA lacks acidic surface and provide insights into protein stability at poly-extreme condition. FEBS Lett. 2006, 580, 2646−2652. (48) Richard, S. B.; Madern, D.; Garcin, E.; Zaccai, G. Halophilic adaptation: novel solvent protein interactions observed in the 2.9 and 2.6 Å resolution structures of the wild type and a mutant of malate dehydrogenase from Haloarcula marismortui. Biochemistry 2000, 39, 992−1000. (49) Wang, H. M.; Ma, R.; Shi, P. J.; Huang, H. Q.; Yang, P. L.; Wang, Y. R.; Fan, Y. L.; Yao, B. Insights into the substrate specificity and synergy with mannanase of family 27 α-galactosidases from Neosartorya f ischeri P1. Appl. Microbiol. Biotechnol. 2015, 99, 1261− 1272.

(50) Cao, Y.; Yang, P.; Shi, P.; Wang, Y.; Luo, H.; Meng, K.; Zhang, Z.; Wu, N.; Yao, B.; Fan, Y. Purification and characterization of a novel protease-resistant α-galactosidase from Rhizopus sp. F78 ACCC 30795. Enzyme Microb. Technol. 2007, 41, 835−841.

J

DOI: 10.1021/acs.jafc.6b00255 J. Agric. Food Chem. XXXX, XXX, XXX−XXX