Chemical Derivatization of Compact Disc Polycarbonate Surfaces for

Feb 7, 2008 - ... based on hybridization of cDNA strands and single nucleotide polymorphism discrimination (SNPs). A demonstration of the applicabilit...
0 downloads 6 Views 676KB Size
Download PDF
Bioconjugate Chem. 2008, 19, 665–672

665

Chemical Derivatization of Compact Disc Polycarbonate Surfaces for SNPs detection María-José Bañuls, Francisco García-Piñón, Rosa Puchades, and Ángel Maquieira* Instituto de Química Molecular Aplicada, Departamento de Química, Universidad Politécnica de Valencia, Camino de Vera s/n, Valencia, Spain. Received September 7, 2007; Revised Manuscript Received December 7, 2007

Compact discs have been proposed as an efficient analytical platform, with potential to develop high-throughput affinity assays for genomics, proteomics, clinics, and health monitoring. Chemical derivatization of CD surfaces is one of the keys to developing highly efficient microarraying-based assays on discs. Approaches for mild chemical modification of polycarbonate (PC) disc surface based on nitration, reduction, and chloromethylation reactions have been developed. Derivatized surfaces as amino and thiol are obtained for PC, maintaining unchanged the mechanical and optical properties of the discs. Studies of covalent attachment of oligonucleotide probes (5′ Cy5labeled, 3′ NH2-ended) on the modified surfaces have been performed to develop microarraying assays based on hybridization of cDNA strands and single nucleotide polymorphism discrimination (SNPs). A demonstration of the applicability to the compact disc audio/video technology for its use as analytical system is performed, including the employment of a commercial CD player to read the results on disc.

INTRODUCTION Biologists, chemists, material scientists, and engineers have collaborated to develop bioassays, mainly DNA and protein microarraying chips. The development of surface-based assays in which numerous probes are immobilized in a spatially addressable manner has been one of the keys of these technologies. Such assay formats lend themselves well to miniaturization and multiplexing (1, 2). Nucleic acids (NAs) chip technology uses microscopic arrays of oligonucleotides immobilized on solid supports, as glass or silicon, for gene expression analysis (3), polymorphism (4, 5) or mutation detection (6, 7), DNA sequencing (8, 9), and gene discovery (10, 11). Microarraying technologies have been developed quickly from the 1990s, but there are still a lot of improvements to be achieved. New immobilization ways, different assay formats, and alternative detection modes to improve microarraying methodologies are necessary. Although glass is a popular support for DNA chip technology (12), efforts have led to the use of polymeric materials in the preparation of chip-based devices (13, 14). Solid polymers offer attractive mechanical and chemical properties, presentations, low cost, fabrication facility and flexibility, biocompatibility, and so forth. Attention has mainly been focused on the applications of microfluidic devices, and their fabrication techniques (15), alternative to glass as integrated platforms accomplishing sample manipulation and other analytical steps. Devices as biomicroelectromechanical systems (BioMEMS), laboratory-on-a-chip, and compact disc (CD) are being proposed for different applications (16, 17). Standard CDs are composed of a polycarbonate (PC) substrate (1.2 mm thick), a reflective metalized layer (100 nm thick), and a poly(methyl methacrylate) (PMMA) protective lacquer (10 µm thick) as the ISO:9660 industry standard describes (18). Among the advantages of audio/video CD as analytical platform, one can highlight their big surface to spot thousands of capture probes; a low fluorescent background; the availability of highquality materials at very low cost; the quadratic, circular, and * Corresponding author. Fax: +34 96 387 93 49; Tel: +34 96 387 73 42; E-mail: [email protected].

spiral indexing; the easy handling and manufacture; and the possibility to use the top side for detection and the down side for recording; and further use of CD and DVD audio/video players as detectors making possible their application as pointof-care systems, especially interesting for the developing countries. From the arraying applications of standard CDs, we must point out the seminal work of Kido et al. (17) demonstrating the potential to develop micro-ELISAs by surface adsorption of immunoreagents. Adsorption is a useful mode for protein immobilization; however, for nucleic acids it is necessary to use electrostatic forces (e.g., glass supports) or, more preferably, covalent attachment (19). In previous works, we showed the possibilities of using compact disc surfaces as high-throughput screening platforms for DNA microarraying (20) and for detection of low-abundancy pesticide residues (21). Considering all these features, the chemical derivatization of PC, the main CD constituent, to be applied on raw discs for microarrayingbased assays can be achieved by means of different chemical or physical processes; the most common techniques include plasma-ion beam treatment, electric discharge, spin-coating, adsorption (22), surface grafting, chemical reaction, photoactivation (23), vapor deposition of metals, and flame treatment (24, 25). The problem is that most of the methods employed for the chemical surface modification of this polymer affect their optical (transparency) and mechanical (resistance, hardness, roughness, etc.) properties, not being applicable to compact discs without perturbing the original performance. The covalent attachment of probes, on the contrary, offers the advantage of a robust resulting surface while retaining its chemical integrity over an extended period of time. Besides, covalent interactions allow the performance of highly homogeneous and reproducible surfaces as selfassembled monolayers. There are few works studying the chemical modification of CDs to attach probes on the surface. Remacle (26) developed DNA microarrays on CD by surface activation employing basic hydrolysis of polycarbonate. Acid groups generated on the polymeric surface allowed the attachment of DNA after treatment with a diamine. The information regarding this procedure

10.1021/bc7003457 CCC: $40.75  2008 American Chemical Society Published on Web 02/07/2008

666 Bioconjugate Chem., Vol. 19, No. 3, 2008

Bañuls et al.

Table 1. Nucleotide Sequence of Probes and Targets Used name

sequence (5′ to 3′)

5′ end

3′ end

SYM8 SYM22 SYM23 SYM25 SYM26

AATGCTAGCTAATCAATCGGG (T)15CCCGATTGATTAGCTAGCATT TTACGATCGATTAGTTAGCCC(T)15 AATGCTAGCTAATCAATCGGG AATGCTAGATAATCAATCGGG

Cy5 none Cy5 biotin biotin

none C7-NH2 C7-NH2 none none

is limited and fragmentary. LaClair (27) proposed a screening method for the recognition between small-molecule ligands and biomolecules. It consists of the phosphorylation of the PC surface employing dichlorophosphate to achieve the covalent attachment of hydroxyl-ended ligands. Recognition between surface-expressed moieties and biomolecules is screened by an error determination routine. This innovative approximation shows the limitation in which each drive manufacturer has its own propietary firmware for error correction displaying a different sensitivity and thus different ability for analysis; thus, it necessary to always employ the same disc player to read the results. Also, they use a PTFE mask to perform the assays in wells on the disc surface. Recently, Li (28) reported a polycarbonate surface-activation protocol by UV/ozone treatment which allows the covalent attachment of DNA microarrays and further hybridization assays. This method employs compact discs but cuts them into sheets and not in their original shape, and for the detection uses conventional optical drives (as microarray scanning). Other authors performed high-quality self-assembled monolayers of alkanethiols on the gold side of CDs, employing them to fabricate inorganic material microstructures (29, 30). Likewise, they proposed the idea of DNA micropatterning by a tipcontact CD printer and water-resistant ink onto the gold CD substrate, and subsequent treatment with aqueous gold-etching reagent (31). Recently, our group has reported the procedure for covalently attaching aminated oligonucleotides on PMMA isocyanatemodified compact discs to perform hybridization assays, carrying out the detection with a CD player (32). In the present work, several approaches of covalent modification of PC discs are carried out, in order to get NH2- and SHmodified surfaces. Results are applied for DNA probe immobilization,hybridization,andSNP(singlenucleotidepolymorphisms) discrimination assays on polycarbonate disc surface. A CD player is also integrated as a detection system to demonstrate the feasibility of the developed methodology.

EXPERIMENTAL PROCEDURES Reagents. Ethylenediamine was purchased from Acros (Barcelona, Spain). Glutaraldehyde, Tween 20, 11-mercaptoundecanoic acid, gold-conjugated streptavidin from Streptomyces aVidinii, and silver enhancer (solutions A and B) liquid substrate from membranes were purchased from Sigma-Aldrich (Madrid, Spain). Hibridization and SNP oligonucleotides (Table 1) were from Sigma-Genosys (Suffolk, UK). Oligonucleotide solutions were tip-contact printed onto the surfaces using a stamper (6 × 4 pins) from V&P Scientific, Inc. (San Diego, CA, USA). Buffers employed were as follows: Saline sodium citrate (10xSSC, 0.9 M sodium chloride, 0.09 M sodium citrate, pH 7); carbonate buffer (10xCB, 0.5 M sodium carbonate, pH 9.6); phosphate buffer saline (10xPBS, 0.08 M sodium phosphate dibasic, 0.02 M sodium phosphate monobasic, 1.37 M sodium chloride, 27 M potassium chloride, pH 11); MES buffer (0.1 M 2-morpholinoethanesulfonic acid monohydrate, pH 6.5). Apparatus. Fluorescent-arrayed probes were detected by both a microarray scanner, Genepix 4000B, from Axon Instruments (Union City, CA) at λexc 635 nm and λem 670 nm, and a homemade disc fluorescence reader (DFR) (33). Hybridization

assays were detected by employing a standard CD player modified as described below. Sessile drop contact angle measurements were performed with a Data Physics contact angle system OCA (Filderstadt, Germany). Two solvents were employed: water 18 MΩ and glycerol 99.9%. The attenuated total reflectance Fourier transform infrared (ATR-FTIR) spectra were obtained using a Nicolet-Nexus FTIR with Multi-Bounce HATR, ZnSe 45° (Madrid, Spain). Each spectrum represents the average of 256 scans in 4 cm-1 resolution. The energy dispersion spectra (EDS) were collected on scattering electron microscopy JASCO-SEM, resolution 59 eV (Easton, MA). Compact Discs. Golden CD-Rs partially transparents (30% reflectivity) provided by U-Tech Media Corp. (Tau-Yuan Shien, China) were used as platforms. These low-reflectivity recordable compact discs (L-CD, 1.2 mm thick polycarbonate discs, with a gold reflective layer of 30 nm, 12 cm diameter) allow the laser (780 nm) two functions: (a) reflected light (30%) lets the laser to follow the track, maintaining the rotation of the disc (autotracking) and, (b) transmitted light (70%) reaches the microarray spots located on the upper side of the CD, detecting the hybridization intensities by the amount of precipitate produced by an catalytic marker (gold) and a substrate (silver developer). Disc Reader. A standard CD player from Plextor LLC (Fremont, CA) was used as the detector. The drive uses the servo control system to center and focus the beam on the spiral data track across the whole disc surface. The CD reader uses the original design of the CD players, taking advantage of the CD driver optical system to illuminate accurately the polycarbonate face of the L-CD (partially reflecting the laser and transmitting the rest through the PC surface to the photodiode). The controlled parameters of the optical disc drive include positioning of the laser toward the disc, scanning the whole disc surface while controlling the spatial resolution, and the linear rotation velocity of the disc. A planar photodiode (SLSD71N6, Silonex, Montreal, Canada), 25.4 mm long, with a spectral sensitivity of 0.55 A/W at 940 nm and a spectral range between 400 and 1100 nm, absorbs the transmitted laser light and converts it into an analog electrical signal. A reflective photosensor (EE-SY125, Omron, Scahumburg, USA) used to detect the analytical areas includes an infrared led of 950 nm and a phototransistor, with a sensing distance ranging from 0.5 mm to 2 mm. The operational principle of the photosensor is based on the detection of the different reflectivity between the sensing object and the disc. For that, the analytical areas are marked in the outer rim of the disc by low-reflectivity trigger footprints of 3.5 cm size. Because the unmarked perimeter presents higher reflectivity, the photosensor detects the marked areas, providing a trigger signal to the data acquisition board in order to start capturing data exclusively from those zones. A custom-built electronic board (DAB) incorporates the planar photodiode and the photosensor. The function of the board is twofold: first, the detection of analytical areas, and second the amplification of the analog signal. Both functions are carried out at the same time the CD drive performs its original function of reading and writing data. In this way, during the data acquisition process only the signals from the detection areas are digitized by the data acquisition board (DAQ), stored in the computer, and deconvoluted into an image to further quantify. A scheme of the developed detection system is shown in Figure 1. The detector system is controlled by software running on a Windows-based computer connected to the PC through a universal serial bus interface (USB2.0) to become portable.

Chemical Derivatization of CD Surfaces

Bioconjugate Chem., Vol. 19, No. 3, 2008 667

Figure 1. Detection system. The set of servo systems of the CD drive allows disc rotation and laser scanning. The transmitted light through the disc is transformed by the photodiode into an analog electrical signal (RF signal). At the same time, the photosensor detects the trigger footprints, starting the data collection on disc. The amplification/detection board (DAB) is integrated into the CD drive unit and contains the planar photodiode and the photosensor. The data acquisition board (DAQ) digitizes the analog signals and transfers them to the computer for processing.

Custom software was writing in Visual C++. The software provides the control to the CD/DVD driver to scan the surface of the disc, to modulate the disc linear rotation velocity to a specified spatial resolution, and to write data in the CD or DVD. Also, the software provides the control to the data acquisition board to configure the sampling frequency according to the disc rotation speed and desired angular resolution. To scan completely the surface of the L-CD, the software simulates the writing process of a 700 MBytes size file to a controlled disc rotation speed. The scan begins from the inner tracks of the disc, following the continuous spiral toward the outer tracks. The captured data of each detection area are represented within a sector that is formed by a set of arcs centered over a radial direction, starting from the inner toward the outer radio. The software collects the data of each area and stores them in independent files in uncompressed binary format, and displays them into a graphical gray scale code image. Due to the spatial difference between samples taken horizontally (each 13 µm) and vertically (each 1.6 µm), a graphical horizontal adjustment is done to display a proportional x-y image. This software allows export of the image in a gray-scale code to a compressed tif format or bitmap. Then, the images were processed with Photoshop 7.0 (Adobe Systems Inc., San Jose, CA), to map the lightest and darkest pixels into black and white before quantifying with GenePix software (Axon Inst., Union City, CA). Signal intensities of each spot were calculated by background subtraction. Disc Surface Modification. Approach 1. Amination. Transparent polycarbonate discs (PC1) were stirred in aqueous 30% HNO3 solution for 30 min at 65 °C. The chips were washed with abundant distilled water (PC2). To reduce the nitro groups, chips were immersed into a solution of NaBH4 10% in 1xPBS and stirred at room temperature for 6 h, washed first with 1xPBS and finally with distilled water (PC3).

Approach 2. Glutaraldehyde Cross-Linking of Aminated PC. NH2-functionalized PC discs (PC3, approach 1) were immersed into a solution of aqueous glutaraldehyde (5%, 1xPBS, pH 7) and stirred for 2 h at room temperature. Finally, they were thoroughly washed with 1xPBS and water, and airdried (PC4). Tollen′s and p-anisaldehyde tests were used to confirm the presence of aldehyde groups (34). Freshly prepared aldehyde-modified discs were always employed for DNA assay. Approach 3. Thiolation. SH-modified discs were prepared as follows: aminated PC3 chips (approach 1) were immersed into an aqueous solution of 5 mM ethylenecarbodiimide (EDC), 5 mM sulfo-N-hydroxysuccinimide (NHSS), and 5 mM 11mercaptoundecanoic acid in 0.1 M MES buffer, pH 6.5 (100 mL), and stirred at room temperature for 3 h. SH-modified discs were washed with water and ethanol and dried. The presence of SH groups on the treated surface was detected by Ellman’s test (34). Material obtained was named PC5. Approach 4. Chloromethylation. In a round-bottomed-flask, 2 g of ZnCl2 and 2 mL of chloromethyl methyl ether were added to polycarbonate slides (PC1) immersed in cyclohexane (80 mL). The mixture was allowed to react at 60 °C for 2 h. Then, the slides were washed with distilled water (PC6). Oligonucleotide Arraying. Six 5′ Cy5-labeled, 3′ NH2-ended oligonucleotide (SYM23) solutions (1 and 10 µM) were prepared by employing different solvents: SSC (1x, 10x) pH 7, CB (1x, 10x) pH 9.6, and PBS (1x, 10x) pH 11. Afterward, 3 × 3 microarrays of each solution were printed onto the PC disc surface and incubated in a wet, dark chamber for 1 h at 42 °C or 4 h at room temperature. Finally, discs were thoroughly rinsed with PBS-T and water and dried. Immobilization results were read with a microarray scanner (cutting the discs in slides of 55 × 25 mm2 size) or using the homemade DFR detector (whole disc). Hybridization Assays. Amino-ended oligonucleotide SYM22 (0.1, 0.5, 1, and 5 µM) was covalently immobilized on the PC

668 Bioconjugate Chem., Vol. 19, No. 3, 2008

surface as described above. After that, 35 µL of OVA in 1xCB (pH 9.6) was dispensed on each printed area, spread under a coverslip, and incubated for 30 min at room temperature in a moist chamber. After washing 5 min with PBS-T and water (5 min), discs were air-dried. Cy5-labeled target oligonucleotide (SYM8) was serial diluted between 0.001 and 0.2 µM in a mixture containing 6xSSC, 0.6% SDS, 0.1% salmon sperm DNA, and 2% BSA. 35 µL of the complementary oligonucleotide solution was dispensed on the microarrays and spread under a coverslip (22 × 22 mm2). The temperature of hybridization was 37 °C, performing the incubation in a dark and humidified chamber for 1 h. After that, the discs were washed with PBS-T for 15 min, then water (5 min), and airdried to be read. For hybridization assays employing the CD player as detector, the biotin-ended target oligonucleotide (SYM25) was used following the procedure describe above. After the incubation and washing steps, 35 µL of 10 µg/mL streptavidin-gold in 1xPBS was deposited on each zone of the disc and again incubated for 20 min under a coverslip, in a moist chamber at 37 °C. After rinsing with PBS-T (15 min), water (5 min), and drying, 20 µL of silver developer solution was dispensed, and after 12 min, black spots appeared on the microarrays (35, 36). The transparent polycarbonate disc was placed on a gold metallized CD and read with the CD driver as before. Single Nucleotide Polymorphism Assays. SYM22 0.1, 0.5, 1, and 5 µM was covalently immobilized on polycarbonate aldehydized discs (PC4). After the OVA blocking step, different solutions (0.05 µM to 0.0005 µM) of SYM25 and SYM26 in 6xSSC, 0.6% SDS, 0.1% salmon sperm DNA, 2% BSA, and 25% formamide were prepared, dispensed on each printing zone, and spread under a coverslip. Discs were incubated for 1 h at 40 °C in a moist, dark chamber, washed with PBS-T then water, and air-dried. Treatment with streptavidin-gold and silver developer was carried out as described before.

RESULTS AND DISCUSSION All the chemical modifications of chip materials including CD surfaces must consider two key points. First of all, they must maintain the mechanical and optical properties of the raw polymer, as otherwise, optical disc reading and chemical detection using a CD player is inapplicable. Moreover, the functionalization must perform the biomolecule covalent attachment in aqueous media, working at pH and ionic strength values close to the physiological ones, because proteins and nucleic acids can change their behavior in denaturing conditions. These requirements restrict the chemical treatments to mild reaction media. Amine and thiol functionalizations have been chosen because they offer a well-known chemistry in the conjugation of biomolecules to different surfaces (37). They can be converted into suitable moieties for covalent immobilization of aminoended biomolecules, making use of different cross-linkers such as dialdehydes or diisocyanates. Thiol functionalization is also of interest, because it can directly attach sulfhydryl-ended molecules through the formation of disulfide bridges. Surface Modifications. Chemical derivatizations successfully developed are divided in four groups: amination, glutaraldehyde cross-linking, thiolation, and chloromethylation. Figure 2 shows the principal steps for each approach and the denomination of the transformed materials as well as the reaction conditions employed for amination, aldehydization, thiolation, and chloromethylation of PC. The effect of solvents on plastic properties (diethyl ether, dichloromethane, hexane, cyclohexane, methanol, 2-propanol, water) was studied in order to select the most gentle with polycarbonate. It was found that cyclohexane, 2-propanol, and

Bañuls et al.

Figure 2. Scheme of surface chemical modifications performed to obtain PC2, PC3, PC4, PC5, and PC6. Reaction conditions employed for approaches 1, 2, 3, and 4.

water maintained the physical properties of PC discs without curling or cracking. Pieces of 55 × 25 mm2 were immersed from 3 to 7 days in these solvents, confirming that the slides remained unaltered after these treatments. In approach 1 (Figure 2), nitration of PC by heating at 65 °C in 30% aqueous HNO3 for 30 min followed by reduction with NaBH4 afforded an NH2-modified surface. For approaches 2 and 3, NH2-modified surfaces (PC3) were treated with glutaraldehyde to give CHO-modified PC and with 11-mercaptoundecanoic acid and EDC/NHSS to give SH-modified PC (approaches 2 and 3, Figure 2). On the other hand, for the chloromethylation of PC (approach 4, Figure 2), reaction times from 1 to 24 h were studied. It was observed that, applying long exposure times, the roughness of chip surface increased. It resulted in cracking, and the slide became more fragile. Similar effects of fissuring were noticed when working at high temperatures (80–100 °C) for prolonged times (more than 2 h). Although the extent of the surface derivatization was larger when hard conditions were applied, we concluded that 2 h at 60 °C was optimal to reach enough surface modification without alteration of the physical properties of the material (Figure S4 in Supporting Information). In order to confirm the success of NH2, CHO, SH, and CH2Cl modifications, and to study their surface and optical properties, several techniques were employed: contact angle, ATR-FTIR, EDS, and SEM. Contact Angle. For all the raw and treated polymers, the water and glycerol contact angles were measured. The results are summarized in Table 2. The left and right contact angles of the solvent drops were measured immediately after its placement on the polymeric surface; no differences between contact angles

Chemical Derivatization of CD Surfaces

Bioconjugate Chem., Vol. 19, No. 3, 2008 669

Table 2. Sessile Drop Contact Angles surface

θ water

θ glycerol

PC1 PC2 PC3 PC4 PC5 PC6

78 ( 2 57 ( 2 66 ( 2 59 ( 2 63 ( 2 53.9 ( 0.6

71.6 ( 0.9 58 ( 7 69 ( 1 61.7 ( 0.9 74.9 ( 1.5 60.8 ( 1.5

were found. The reported values are the average of five separated water drops on a given substrate, and no significant variation among a set of substrates was found, so we asserted the homogeneity of the modifications carried out. The measured values correlated well with those found in the literature for unaltered and treated PC surfaces. After chemical modification, a decrease in the water contact angle values was experimentally observed due to the presence of polar groups that increase the hydrophility of the materials. ATR-FTIR. The attenuated total reflectance-Fourier transform infrared spectra were registered for PC1, PC2, PC3, PC4, PC5, and PC6 (Figure S1 of Supporting Information). PC3 showed a prominent peak around 3200–3400 cm-1 characteristic of OH and NH2 stretching. Because the slides were baked at 40–50 °C before taking the spectra and they remained unaltered after several weeks, the possibility that these peaks were due to the surface solvatation or humidity was discarded. Besides, the derivatized surfaces containing neither amine nor hydroxyl groups (PC1, PC2, PC5, and PC6) did not show any peak around 3200 cm-1 after the baking process. EDS. Energy dispersion spectra were collected for PC1, PC2, PC3, PC4, PC5, and PC6 (Figure S2 of Supporting Information). The successful incorporation of 11-mercaptoundecanoic acid and chloromethyl subunits was clearly observed in PC5 and PC6, respectively, because of the presence of heavy atoms such as S or Cl that are not present in the raw material. On the other hand, as the reaction with 11-mercaptoundecanoic acid might lead to partial polymerization of the bifunctional acid and to the adsorption of the (hydrophobic) polymer on the substrate, a control experiment was performed to asses the amide formation. For that, PC1 was treated with 11mercaptoundecanoic acid in a similar manner as PC3. After the reaction, both surfaces were washed exhaustively with a basic aqueous solution (NaOH 0.5 M), then with water, and ED spectra were registered; again for PC5, the existence of S was detected, while in the case of PC1, the presence of S was not observed. The SEM images of derivatized PC surfaces showed smooth and defect-free surfaces; those images confirmed the homogeneity of the reactions (Figure S2 of Supporting Information). Oligonucleotide Immobilization Studies. In order to demonstrate the viability of the developed chemical modifications for the covalent attachment of oligonucleotide probes on CD supports, PC discs were treated following the approaches 2 and 4 (Figure 2), because those approaches leave on the surfaces functional moieties (aldehyde and chloromethyl) able to covalently attach aminated probes. Preliminary studies of Cy5labeled, NH2-ended oligonucleotides arraying onto PC1, PC2, PC3, and PC4 (approaches 1 and 2, Figure 2) were done employing the above-described method. Results obtained for every surface showed that no signal was detected for PC1 (raw material) and PC2 (approach 1, Figure 2). For PC3, the fluorescence reading gave some signal, although the oligonucleotide covalent attachment on PC3 was not possible. It was in agreement with the establishment of hydrogen bonds as well as electrostatic interactions between the oligo and the aminated surface.

Figure 3. PC3 and PC4 fluorescence emission intensities for 10 µM Cy5-labeled, NH2-ended oligonucleotide immobilized using different pH and ionic strength conditions. After washings, no significant fluorescence signal was obtained for PC3, while for PC4, the highestintensity values are obtained for 1xPBS, pH 11.

PC4 provided significant signal (Figure 3); in this case, covalent attachment between NH2-ended oligonucleotide and aldehydized surface was possible. Theoretically, the reaction should produce a Schiff base. However, the reaction is irreversible. Glutaraldehyde yields polymers in solution (38) that at acidic pH are cyclic hemiacetals. At neutral or slightly alkaline pHs at which cross-linking occurs, the R,β-unsaturated aldehyde polymers are formed which increase in length as pH is raised. It is probably the unsaturated polymer that cross-links the amino group of oligonucleotides. The interaction of the Schiff base with adjacent double bonds provides stability toward hydrolysis. With an excess of amino groups, nucleophilic addition of the ethylenic double bond is possible. Thus, it was noted (Figure 3) that the more basic the pH (11) is the more effective the covalent attachment. On the other hand, it was also observed that an increase in the ionic strength of the printing solution decreased the effectiveness of the attachment. In order to eliminate possible electrostatic and hydrophobic/hydrophilic interactions between the surface and Cy5-labeled oligonucleotides, slides were treated with an acidic solution (aq 5% HCl). A 100% signal diminution was observed for PC3, while the signal in PC4 only suffers a reduction between 15% and 30%). This fact also confirmed the existence of covalent attachment for PC4. In all cases, SYM8 was used as a control to test the nonspecific interaction, and a fluorescence signal was almost inexistent for PC1, PC2, PC3, and PC4. For PC6, derivatized following approach 4, attachment of aminated oligos via nucleophilic attack to the chloromethyl benzene rings was tried. Several times (0, 2, 4, and 16 h) and incubation temperatures (room temperature and 42 °C) were assayed. The best results were obtained for 4 h at 25 °C. The registered fluorescence signal remained unchanged after washings for PC6 (Figure 4) indicating the existence of covalent interactions. However, the signal of PC1, used as control, was low and disappeared when the chips were exhaustively washed with water. In conclusion, derivatized polycarbonate PC6 seemed to also be appropriate for covalent attachment of the aminated oligonucleotides. This strategy has not been employed before for DNA microarraying, nor on glass. Thus, it is a novel and promising way to develop new surfaces to perform a stable link with DNA probes, and surely with proteins. The main advantage of this approach is that, by using one chemical modification step, the chip is ready for the oligonucleotide covalent attachment. On the other hand, this chemical modification could be successfully applied in other aromatic polymers such as polystyrene. The problem is that the reagents employed are more hazardous than for approach 2: organic solvent is used

670 Bioconjugate Chem., Vol. 19, No. 3, 2008

Bañuls et al.

Figure 4. PC1 and PC6 fluorescence emission intensities (neat fluorescence) for 1 µM and 10 µM Cy5-labeled, NH2-ended oligonucleotide immobilized at different pH and ionic strength conditions. For PC6, the best results are obtained for 1xPBS, pH 11. For PC1, there exists some remaining signal; this signal decreases after exhaustive washings, but not for PC6. Table 3. Advantages and Disadvantages of Approaches 2 and 4 for Their Employment in Aminated Oligonucleotide Attachment on PC and Application to CD Technology approach

advantages

disadvantages

2

aqueous solutions mild conditions better signal-to-noise ratio immobilization

three steps functionalization

4

one step functionalization applicable to other aromatic polymers higher neat fluorescence

very toxic reagents employed organic solvent required

instead of aqueous solutions, and chloromethyl ethyl ether is highly toxic. For that, approach 2 providing PC4 was chosen to perform the application to CD supports. In Table 3, the advantages and disadvantages of the proposed approaches are summarized. Application to CD Supports. (a) Hybridization Tests. To demonstrate the applicability of the method to CD technology, PC transparent discs 0.6 mm thick were employed to perform the bioassay. The PC disc was derivatized according to the procedure involving nitration and reduction of the polycarbonate (approach 1), and then treated with glutaraldehyde (approach 3). Due to the big sample spotting CD surface, eight different zones, each one also with four different probe concentrations,

were printed. After the covalent attachment of SYM22, hybridization was performed employing serial dilutions of SYM 25 (0.2 to 0.001 µM). Afterwards, the CD was treated with goldconjugated streptavidin for 20 min, washed, and revealed with silver enhancer for 12 min. The black precipitate was detected by the CD player. For this, the PC disc was fixed on the metallic layer of a standard gold metallized and unlacquered CD, partially transparent (70% light transmission) to 780 nm laser wavelength (this disc would allow the laser device to follow the track). To set up the hybridization conditions, different concentrations of probe (from 0.1 to 20 µM) and target (from 0.5 to 100 nM), times, and temperatures were assayed. Black spots were obtained until 2.5 µM of target for all the probe concentrations. Also, several controls were performed avoiding the following: glutaraldehyde treatment, covalent attachment of probe, OVA blocking, hybridization solution, and streptavidin-gold incubation. None of them developed black spots except in the case of the control avoiding the treatment with OVA, as was expected. Once the hybridization assay was finished, positive spots were obtained for all the target concentrations observable even to the naked eye. Results are shown in Figure 5. The ammount of precipitate is directly related with the transmitted light of the CD player laser (the greater the precipitate, the less the light transmission). Thus, it is possible to establish a relationship between the hybridization effectiveness and the transmitted (or absorbed) light. In Figure 6, probe and target saturation curves are shown. The optimal values were found for 5 µM of probe concentration, with it being possible to detect target concentrations of 2.5 nM. Also, it was possible to detect hybridization with probe concentrations as low as 0.1 µM. The sensitivity and efficiency reached with our procedure produced results slightly better than that obtained on PC CD surfaces employing other methodologies such as adsorption immobilization of probes and target hybridization reading with a fluorescence microarray scanner (20). In this case, 25 nM of target was detected by employing probe concentrations between 0.5 and 1.0 µM. This demonstrated the feasibility of our detection system, which provides results as good as or even better than those from the standard techniques. (b) SNPs Assays. Finally, the application of the methodology to discriminate single nucleotide polymorphism was attempted. Two oligonucleotide strands with different sequences were selected: SYM25, the complementary strand of the immobilized probe on the PC disc (SYM22), and SYM26 differs from SYM25 in the base number nine, substituting cytosine for adenine (see Table 1). For that, different conditions were assayed

Figure 5. (a) Microarray spots developed on the PC disc after the chemical treatment and the hybridization assays. (b) Computer screen image displayed by the CD reader after the bioassay detection.

Chemical Derivatization of CD Surfaces

Bioconjugate Chem., Vol. 19, No. 3, 2008 671

CD reader agrees with that obtained for similar assays employing adsorption immobilization methodologies and fluorescence reading detectors. The described procedure has potencial applications beyond merely the use of biotinylated targets; this strategy has been chosen as a proof of principle, but a big number of potential applications and variations can be easily envissoned; in general, every reaction providing a dark precipitate can be used as developer (e.g., oligonucleotides HRP, phosphatase alkaline, or gold labeling could be used with the proposed methodology). Besides, the employment of DVD technology (650 nm) as detector should allow the reading of fluorescence-labeled (Cy5) targets; in addition, Blu-ray technology (405 nm) could be employed. This work is now in progress. Finally, the search for suitable markers compatible with the CD player wavelength could be of great interest as well.

ACKNOWLEDGMENT Figure 6. Probe saturation curves for chemically modified polycarbonate discs (approach 1). Reported data are from replicates of nine spots of each oligonucleotide concentration for each CD. (Experiment performed in triplicate).

(concentrations of probe and target; the use of formamide, temperature, and time) to find the optimal discrimination medium. At the best assay conditions, SNPs resulted at 40 °C, for 1 h and 25% of formamide in the hybridization solution, with it being possible to discriminate between SYM25 and SYM26 at concentrations of 2.5 nM using probe concentrations ranging from 0.1 to 5 µM. These results agreed with our previous equivalent assays employing conventional methodologies. The conditions employed for these hybridization assays are quite conventional, but they are useful for the aim of this work, that is to prove the principle identified in the introduction: the employment of CDs as suitable analytical platforms and CD players as effective and competitive detection systems. Further work focusing on the improvement of the bioassays to achieve better performance is currently in progress.

CONCLUSION In this paper, successful modification of the PC surface has been demonstrated in a practical, mild, and clean way to be applied on compact discs as well as other supports that need to maintain their original physical properties. We have shown that modification of PC converts the surface into a suitable platform for covalently building DNA arrays on a standard CD. Among the derivatization approaches, amine-modified discs, by nitration of PC followed by reduction, were selected for the microarraying assays, because it is an easy and clean approach and employs only aqueous solutions, avoiding organic solvents. One important point to note is that chemical modifications do not affect the general optical properties of the polymeric material, as can be seen from UV–vis or IR spectra of the chip. Also, the fluorescence background remains low. This fact is interesting in order to use different detection devices to read the bioanalytical results obtained on the compact disc. Considering that polymeric materials can be fabricated into very different presentations and at competitive cost in comparison to glass, this is a promising approach for DNA microarraying chip development also with highly potential applications in fields such as protein, biomedical, genetics, drug discovery, or clinical diagnostic. The feasibility of the method is fully demonstrated by the successful development of hybridization and SNP assays, which are read employing a standard CD player. The sensitivity and efficiency reached combining polymer chemical activation and

This work was funded by MCYT BQU 2003-02677 and CTQ2007-64735/BQU. Supporting Information Available: Figure S1. ATR-FTIR of PC1, PC2, PC3, PC4, PC5, and PC6. Figure S2. SEM images and ED spectra of PC1, PC2, PC3, PC4, PC5, and PC6. Figure S3. Preliminary 1H NMR studies for PC5. Figure S4. SEM images of PC6 after chloromethylation at 100 and 60 °C. This material is available free of charge via the Internet at http:// pubs.acs.org/BC.

LITERATURE CITED (1) Schena, M. (2003) DNA Microarray Analysis, John Wiley and Sons, Inc., Hoboken, NJ. (2) Wilson, D. S., and Nock, S. (2002) Functional protein microarrays. Curr. Opin. Chem. Biol. 6, 81–85. (3) Consolandi, C., Severgnini, M., Castiglioni, B., Bordoni, R., Frosini, A., Battaglia, C., Bernardi, L. R., and De Bellis, G. (2006) A structured chitosan-based platform for biomolecule attachment to solid surfaces: application to DNA microarray preparation. Bioconjugate Chem. 17 (2), 371–377. (4) Zammatteo, N., Jeanmort, L., Hamels, S., Courtuis, S., Louette, P., Hevesi, L., and Remacle, J. (2000) Comparison between different strategies of covalent attachment of DNA to glass surfaces to build DNA microarrays. Anal. Biochem. 280 (1), 143– 150. (5) Patnaik, S., Swami, A., Sethi, D., Pathak, A., Garg, B. S., Gupta, K. C., and Kumar, P. (2007) N-(Iodoacetyl)-N′-(anthraquinon2-oyl)-ethylenediamine (IAED): a new heterobifunctional reagent for the preparation of biochips. Bioconjugate Chem. 18 (1), 8– 12. (6) Schena, M., Shalon, D., Davis, R. W., and Brown, P. O. (1995) Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science 270, 467–470. (7) Vainrub, A., and Pettitt, B. M. (2003) Sensitive quantitative nucleic acid detection using oligonucleotide microarrays. J. Am. Chem. Soc. 125 (26), 7798–7799. (8) Becker, H., and Locascio, L. E. (2002) Polymer microfluidic devices. Talanta 56 (2), 267–287. (9) Lin, H., Kim, J., Sun, L., and Crooks, R. M. (2006) Replication of DNA microarrays from zip code masters. J. Am. Chem. Soc. 128 (10), 3268–3272. (10) Henry, A. C., Tutt, T. J., Galloway, M., Davidson, Y. Y., McWhorter, C. S., Soper, S. A., and McCarley, R. L. (2000) Surface modification of poly. (methyl methacrylate) used in the fabrication of microanalytical devices. Anal. Chem. 72, 5331– 5337. (11) Clark, D. T., and Feast, W. J. (1978) Polymer Surfaces, Wiley, Chinchester.

672 Bioconjugate Chem., Vol. 19, No. 3, 2008 (12) Hoheisel, J. D. (2006) Microarray technology: beyond transcript profiling and genotype analysis. Nat. ReV. Genet. 7 (3), 200–210. (13) Soper, S. A., Henry, A. C., Vaidya, B., Galloway, M., Wabuyele, M., and McCarley, R. L. (2002) Surface modification of polymer-based microfluidic devices. Anal. Chim. Acta 470 (1), 87–99. (14) Reyes, D. R., Iossifidis, D., Auroux, P. A., and Manz, A. (2002) Micro total analysis systems. 1. introduction, theory, and technology. Anal. Chem. 74 (12), 2623–2636. (15) Auroux, P. A., Iossifidis, D., Reyes, D. R., and Manz, A. (2002) Micro total analysis systems. 2. analytical standard operations and applications. Anal. Chem. 74 (12), 2637–2652. (16) Madou, M., Zoval, J., Jia, G., Kido, H., Kim, J., and Kim, N. (2006) Lab on a CD. Annu. ReV. Biomed. Eng. 8, 601–628. (17) Kido, H., Maquieira, A., and Hammock, B. (2000) Disc-based immunoassay microarrays. Anal. Chim. Acta 411, 1–11. (18) Pohlmann, K. C. (1992) The Compact Disc Handbook, A-R Editions, Madison, WI. (19) Heise, C., and Bier, F. F. (2006) Immobilization of DNA on microarrays. Top. Curr. Chem. 261, 1–25. (20) Morais, S., Marco-Molés, A., Puchades, R., and Maquieira, A. (2006) DNA microarraying on compact disc surfaces. Application to the analysis of single nucleotide polymorphisms in Plum Pox virus. Chem. Commun. 22, 2368–2370. (21) Morais, S., Carrascosa, J., Mira, D., Puchades, R., and Maquieira, A. (2007) Micro-immunoanalysis on standard compact discs to determine low abundant compounds. Anal. Chem. 79 (20), 7628–7635. (22) Carion, O., Souplet, V., Olivier, C., Maillet, C., Medard, N., El-Mahdi, O., Durand, J. O., and Melnyk, O. (2007) Chemical micropatterning of polycarbonate for site-specific peptide immobilization and biomolecular interactions. ChemBioChem 8, 315–322. (23) Bora, U., Sharma, P., Kumara, S., Kannanb, K., and Nahar, P. (2006) Photochemical activation of a polycarbonate surface for covalent immobilization of a protein ligand. Talanta 70, 624– 629. (24) Garbassi, F., Morra, M., and Occhiello, E. (1994) Polymer Surfaces, Wiley, Chichester.

Bañuls et al. (25) Chan, C. M. (1993) Polymer Surface Modification and Characterization, Hanser Publications, Munich. (26) Remacle, J., Alexandre, I., and Houbion, Y. US Patent 177144, 2002. (27) La Clair, J. J., and Burkart, M. D. (2003) Molecular screening on a compact disc. Org. Biol. Chem. 1, 3244–3249. (28) Li, Y., Wang, Z., Ou, L. M. L., and Yu, H.-Y. (2007) DNA detection on plastic: Surface activation protocol to convert polycarbonate substrates to biochip platforms. Anal. Chem. 79, 426–433. (29) Yu, H. Z. (2001) Self-assembly on ”recordable CDs”. Anal. Chem. 73 (19), 4743–4747. (30) Yu, H. Z., Rowe, A. W., and Waugh, D. M. (2002) Templated electrochemical deposition of zirconia thin films on ”recordable CDs”. Anal. Chem. 74 (22), 5742–5747. (31) Yu, H.-Z. (2004) New chemistry on old CDs. Chem. Commun. 23, 2633–2636. (32) Bañuls, M. J., Gonzalez-Pedro, M. V., Puchades, R., and Maquieira, A. (2007) PMMA-Isocyanate-modified digital disc as support for oligonucleotide based assays. Bioconjugate Chem. 18 (5), 1408–1414. (33) Maquieira, A., Puchades, R., Bañuls M. J., Mira, D., LlorenteSáez, R., and Martí, J. (2006) System for Chemical Analysis and Data Storage and Treatment on Compact Discs. European Patent Pending, P160ES00, 2006. (34) Vazquez, J., Qushair, G., and Albericio, F. (2003) Tests for SPS. Methods Enzym. 369, 21–27. (35) Cao, X., Wang, Y. F., Zhang, C. F., and Gao, W. J. (2006) Visual DNA microarrays for simultaneous detection of Ureaplasma urealyticum and Chlamydia trachomatis coupled with multiplex asymmetrical PCR. Biosens. Bioelectron. 22, 393–398. (36) Alexandre, I., Hamels, S., Dufour, S., Collet, J., Zammatteo, N., De Longueville, F., Gala, J. L., and Remacle, J. (2001) Colorimetric silver detection of DNA microarrays. Anal. Biochem. 295, 1–8. (37) Hermanson, G. T. (1996) Bioconjugate Techniques, Academic Press, San Diego, CA. (38) Wong, S. S. (1991) Homobifunctional cross-linking reagents. In Chemistry of protein conjugation and cross-linking pp 75, CRC Press Inc., Boca Raton. BC7003457